Hatiora (Cactaceae) clonal germplasm collection using isozymes. J. Amer. Soc. Hort. Sci. 124:373-376. Palmer, J.D. 1985. Chloroplast DNA and phylogenetic ...
Molecular Genetic Characterization of New Floricultural Germplasm Alan W. Meerow USDA-ARS-SHRS, National Germplasm Repository 13601 Old Cutler Road Miami, FL 33158 USA Keywords: markers, DNA, plant breeding, QTL, fingerprint, linkage, mapping Abstract Understanding the genetics of floricultural germplasm represents a valueadded component of managing collections. Molecular approaches collectively represent a potential goldmine of important information that can be applied to programs of genetic improvement. In fact, they can be applied to almost every component of a unified germplasm program. The use of molecular markers for genetic diversity analysis and as a selection tool is a high priority for new efforts in the development of ornamental cultivars and the exploitation of species diversity. Molecular marker and DNA sequence analysis of extant and new floricultural germplasm collections should allow a more complete characterization and understanding of the genetic relationships between species and cultivars. With the advent of polymerase chain reaction (PCR) technology, numerous genetic approaches such as random amplified polymorphic DNA (RAPD), amplified fragment length polymorphisms (AFLP), microsatellite DNA (SSR), expressed sequence tags (EST) and single nucleotide polymorphisms (SNP) in candidate genes are available for germplasm characterization. In addition to estimating genetic diversity, these tools can be utilized to establish molecular markers for phenotypic traits of interest. Once obtained, such markers can be further applied in marker assisted breeding, developing various sorts of genetic maps, and as quantitative trait loci (QTLs). Molecular markers can also be used to confirm the parentage of individuals in a breeding population, for genetic “finger-printing” with application towards intellectual property rights, and also for understanding systematic relationships of cultivated species. INTRODUCTION Understanding the genetics of floricultural germplasm represents a value-added component of managing collections. Molecular approaches collectively represent a potential goldmine of important information that can be applied to programs of genetic improvement. In fact, they can be applied to almost every component of a unified germplasm program (Bretting and Widrlechner, 1995). The use of molecular markers for genetic diversity analysis and as a selection tool is a high priority for new efforts in the development of ornamental cultivars and the exploitation of species diversity. Molecular marker and DNA sequence analysis of extant and new floricultural germplasm collections should allow a more complete characterization and understanding of the genetic relationships between species and cultivars (Dore et al., 2001). In addition to estimating genetic diversity, these tools can be utilized to establish molecular markers for phenotypic traits of interest. Once obtained, such markers can be further applied in marker assisted breeding, developing various sorts of genetic maps, and as quantitative trait loci (QTLs; Edwards, 1992). Molecular markers can also be used to confirm the parentage of individuals in a breeding population, for genetic “fingerprinting” (Caetano-Anolls et al., 1991) with application towards intellectual property rights, and also for understanding systematic relationships of cultivated species (Hillis et al., 2002).
Proc. Vth IS on New Flor. Crops Eds.: A.F.C. Tombolato and G.M. Dias-Tagliacozzo Acta Hort. 683, ISHS 2005
43
BEFORE DNA: BIOCHEMICAL MARKERS Before the DNA revolution, biochemical markers such as isozymes were the first “molecular” tool to be used for genetic characterization (Tanksley and Orton, 1983; Smith, 1986; Soltis and Soltis, 1990). As proteins, isozymes are primary products of structural genes. Isozymes are different forms of an enzyme exhibiting the same catalytic activity but differing in charge and thus electrophoretic mobility (Scandalios, 1969). In isozyme analysis, crude plant extracts are electrophoresed on starch or polyacrylamide gels. The gels are then placed in stains specific to a particular enzyme. The variation in banding patterns obtained between individual samples can then be used to distinguish the different varieties tested. Isozymes have certain inherent disadvantages (Tanksley and Orton, 1983): 1) there is a limited number of enzyme loci for which staining protocols are available, 2) developmental and seasonally dependent enzyme expression may occur, 3) the stain constituents are highly toxic, and 4) the banding pattern of dimeric loci (enzymes with two subunits) is difficult to interpret without segregating populations. Boyle and O’Leary (Boyle, 1997; Boyle et al., 1994, O’Leary and Boyle, 1998, 1999) used isozymes to study incompatibility and genetic variation among ornamental cacti species and varieties. Though now largely supplanted by DNA-based genetic markers, isozymes are still reliable, co-dominant markers that can be used effectively where laboratory infrastructure is limited. AFTER DNA: GENETIC MARKERS With the revolution in molecular biological techniques, DNA-based markers have replaced enzyme markers in germplasm identification and characterization. Because of its plasticity, ubiquity and stability, DNA is the ideal molecule for these purposes. “Genetic marker” refers to the sequence of nucleotides (bases) at a unique physical location in the genome. The sequence varies sufficiently between individuals that its pattern of inheritance can be tracked through families. The sequence variation - or polymorphism in the DNA is neutral in terms of phenotype (Jones et al., 1997a). Just as with structural genes (loci known to code for phenotypic characters), the position of a marker on a chromosome is called a “locus.” Different DNA sequences at a locus are called “alleles.” Markers are either “dominant” or “codominant.” In a dominant marker, only a single allele will be expressed (visualized as a band on a gel) in an organism, regardless of the characteristics of its counterpart allele on the homologous chromosome. If an individual has two copies of a recessive allele at that marker locus, no band will be resolved in an electrophoretic gel. Relative heterozygosity can thus not be measured directly with dominant markers. Codominant markers are defined for pairs of alleles. All genotypes (heterozygotes and both homozygotes) at a locus can be directly visualized. Some advantages of DNA markers are that they are not influenced by the environment, are expressed in all tissues and can be scored at all stages of plant growth. A large number of markers have been developed, and many are reviewed in Gubta et al. (1999) and Hartl (2000). Restriction Fragment Length Polymorphisms (RFLPs) The first marker technique developed to utilize DNA was restriction fragment length polymorphisms (RFLPs). The approach involves the detection of a polymorphic locus characterized by a number of variable-length restriction fragments (Fig. 1). DNA is digested with restriction endonucleases (enzymes) that recognize and act on specific sequences in the DNA. Cleaved DNA is electrophoresed on agarose gels to separate the fragments according to their size. At first, restriction fragments in stained agarose gels were merely compared visually (Clegg et al., 1984; Hosaka et al., 1984; Palmer, 1985; Palmer and Zamir 1982). The approach was later refined by blotting the fragments onto nitrocellulose or nylon membranes and hybridizing with a radioactive probe of cloned DNA to create restriction site maps (e.g., Sytsma and Schaal, 1985; Sytsma and Gottlieb,
44
1986; Coates and Cullis, 1987; Jansen and Palmer, 1988; Palmer et al. 1988; Zurawski and Clegg, 1988). RFLPs are robust, co-dominant markers that offer a virtually unlimited number of loci, and require no nucleotide sequence information. They can be assayed on many different detection systems and compared across related genomes. The disadvantages of the method are that it is labor intensive, fairly expensive, and frequently slow. A considerable degree of laboratory skill is required to successfully develop RFLPs, and the amount of polymorphism revealed may be quite low. Nonetheless, RFLPs have been used successfully on some floricultural genera, alone or in combination with other types of markers (Scovel et al., 1998 in Dianthus; Strommer et al., 2000 in Petunia). Polymerase Chain Reaction (PCR) The discovery of the polymerase chain reaction (PCR) method of DNA amplification (Saiki et al., 1988) was inarguably the most significant milestone in molecular biology since Watson and Crick published the molecular structure of DNA (Crick, 1962; Watson, 1970). With PCR, target DNA can be amplified many million-fold using two oligonucleotide primers roughly 20 nucleotides in length. The primers specifically hybridize to complementary DNA strands on either side of the desired target. The PCR reaction is carried out with thermostable polymerase in the presence of deoxynucleotides (dNTPs) and primers in a thermocycler (PCR machine). A typical cycle involves denaturation (separation of the strands) of DNA by heating; annealing of primers by cooling, followed by extension of the primers by DNA polymerase (addition of nucleotides). It is a cyclic process; in each cycle, the number of copies of the target DNA doubles. PCR has resulted in an explosion of new types of molecular markers for mapping and genome characterization (Gubta et al., 1999; Hartl, 2000): RAPD (random amplification of polymorphic DNA), AFLP (amplified fragment length polymorphism), SSR (simple sequence repeat, microsatellite), ISSR (inter-simple sequence repeats), SNPs (single nucleotide polymorphisms), CAPS (cleaved amplified polymorphic sequences), STS (sequence tagged site), SCAR (sequence characterized amplified region), EST (expressed sequence tag), SSCP (single strand conformational analysis; especially useful for detecting SNPs), gene sequencing, and FISH (fluorescent in-situ hybridization). Random Amplification of Polymorphic DNA (RAPDs) Random amplification of polymorphic DNA (RAPDs; Williams et al., 1990) is the technique most widely exploited by horticulturists, largely due to the fact that the results are obtained quickly and are fairly inexpensive to generate. RAPDs are abundantly available from genomic DNA, no sequence information is needed, and only relatively small DNA quantities are required. They usually capture high levels of polymorphism and can be assayed with automated equipment. In this approach, primers of arbitrary sequence are designed, and the target sequence(s) to be amplified is/are unknown. Typically, a ten base pair sequence is made up (or computer generated randomly), then synthesized (though kits with random primers are available). PCR reactions are carried out and run out on agarose gels to see if any DNA segments were amplified in the presence of the arbitrary primer. The process is illustrated in Fig. 2. Arrows represent multiple copies of a primer (all have the same sequence) and direction in which DNA synthesis will occur. Numbers represent locations on the DNA template to which the primers anneal. In the first genome (A), the primers anneal to sites 1, 2, and 3 on the top strand of the DNA template and to sites 4, 5, and 6 on the bottom strand of the DNA template. Only 2 RAPD PCR products are formed. Product A is produced by amplification of sequence in between the primers bound at positions 2 and 5. Product B produced by amplification of the sequence in between the primers bound at positions 3 and 6. No PCR product is produced by the primers bound at positions 1 and 4 because these primers are too far apart to allow completion of the PCR reaction. No PCR products are produced by the primers bound at positions 4 and 2 or positions 5 and 3 because these primer pairs are not oriented towards
45
each other. In another DNA template (genome) obtained from a different (yet related) source (Fig. 2B), there was a change in sequence at primer annealing site #2. The primer is no longer able to anneal to site #2, and thus the PCR product A is not produced. RAPDs are highly sensitive to laboratory changes, thus they typically exhibit low reproducibility within and between laboratories (McGregor et al., 2000). They can be sensitive to the amount of DNA template (which must be carefully standardized), and the concentration of free Mg present in the PCR reaction. RAPDs can seldom be used across populations or across species because it is difficult to know if bands of the same size (amplified using a particular primer) really are homologous across species or varieties. Seemingly homologous bands (based on their position in the electrophoretic gel) may actually represent multiple loci. They are dominant markers, thus calculating genotype and allele frequencies is not possible by direct means. Some examples of RAPD application to floricultural germplasm include Anastassopoulos and Keil (1996), De Benedetti et al. (2000), and Dubouzet et al. (1997, 1998) for Alstroemeria; and Zhang et al. (1997) for seed testing in Petunia and Cyclamen. Amplified Fragment Length Polymorphisms (AFLPs) With AFLPs (Vos et al., 1995), genomic DNA is digested with both a restriction enzyme that cuts frequently (e.g., MseI, 4 bp recognition sequence) and one that cuts less frequently (e.g., EcoRI, 6 bp recognition sequence). The resulting fragments are ligated to end-specific adaptor molecules that are complementary to the restriction sites. A preselective PCR amplification is done using primers complementary to each of the two adaptor sequences, except for the presence of one additional base at the 3' end (the specific base is chosen by the user). This imparts additional selectivity, so that each primer amplifies a subset of the restricted DNA fragments. A second, "selective" PCR, using the products of the first as template, is then performed. Primers containing two further additional bases, chosen by the user, are used, one of which bears a label (fluorescent or radioactive). Gel electrophoretic analysis reveals a pattern (fingerprint) of bands representing only a small number of the original fragments (Fig. 3). On certain automatic sequencers, the fragments are visualized as peaks in an electropherogram (Fig. 4). AFLP's can sometimes be codominant markers, like RFLP's. Codominance results when the polymorphism is due to sequences within the amplified region. Because of the number of bands seen at one time, additional evidence is needed to establish that a set of bands result from different alleles at the same locus. If polymorphism is due to the presence/absence of a priming site, the relationship is dominance (more typical). The nonpriming allele will not be detected as a band. AFLPs are a decided improvement in reliability and lab transferability over RAPDs. As with RAPDs, only small quantities of DNA are required, no sequence information is needed, and the process can be automated. The AFLP technique is patented, which keeps the cost high, and it can be technically challenging to achieve success (and costly when one fails!). The sheer number of fragments resolved can be difficult to decipher at times, and the markers are sometimes clustered in only a portion of genome (which makes mapping difficult). The AFLP technique has been successfully applied to a number of floricultural crops including Alstroemeria (Han et al., 2000), Hemerocallis (Tompkins et al., 2001), Impatiens (Carr et al., 2003) Iochroma (Meerow et al., in press), Petunia (Strummer et al., 2002) and Pelargonium (Barcaccia et al., 1999). Microsatellite DNA Microsatellites are DNA sequences of one to four bases (called mono-, di-, tri- or tetranucleotide repeats respectively) that are repeated in tandem arrays (i.e. CACACACACACACACACACACACACACACACA, GATGATGATGATGATGATGATGATGATGAT; Fig. 5). Such microsatellite sequences have been found randomly distributed throughout the genomes of all
46
eukaryotes assayed except yeast (Tautz and Renz, 1984; Hearne et al., 1992; Wang et al., 1994). Microsatellites have been identified for all gymnosperms, angiosperms, monocots, and dicots assayed (Morgante and Olivieri, 1993). They are also frequently referred to as simple sequence repeats (SSRs), simple sequence length polymorphisms (SSLPs), short tandem repeats (STRs), simple sequence motifs (SSMs), and sequence target microsatellites (STMs). SSR loci tend to be imprecisely replicated during DNA synthesis, thus generating new alleles with different numbers of repeating units. The variable number of repeats between individuals or array length is a result of slippage of DNA polymerase during DNA replication (Tautz et al., 1986). This length variation is a source of polymorphisms even between closely related individuals. Microsatellites provide an ideal tool for the assessing the genetic diversity of plants (Powell et al., 1996a), due to their high information content, ease of genotyping, codominant and multiallelic nature, high discriminatory power, and reproducibility (Jones et al., 1997a; Morgante and Olivieri, 1993; Powell et al., 1996a, b; Russell et al., 1997). Microsatellites have been used successfully in agricultural and breeding studies as well as in the analysis of natural population (Powell et al., 1996a; Wang et al., 1994). Microsatellites detect a much higher level of DNA polymorphism than any other marker system (Tautz, 1989). A single locus can have as many as several dozen alleles (Maroof et al., 1994), the alleles differing by the number of repeats of the microsatellite sequence. Alleles are assayed by amplifying the region containing the microsatellite by the polymerase chain reaction (PCR) and separating the alleles by gel electrophoresis which detects the difference in length due to the number of microsatellite repeats. Since the amplified DNA fragments from the microsatellite loci differ in size, heterozygosity can be directly assessed (i.e., they are co-dominant). The highly polymorphic microsatellites have proven very useful in population genetic studies, with five loci sufficient to identify individuals within the population (Edwards et al., 1992). Unlike with RAPDs and AFLPs, where Hardy-Weinberg equilibrium must be assumed to calculate heterozygosity and allele frequencies, microsatellites allow a direct test of Hardy-Weinberg equilibrium, estimation of allele frequency and heterozygosity. Some studies have suggested that the chromosomal segments marked by microsatellite loci are under selective pressure (Maroof et al., 1994), and may therefore provide useful markers for distinguishing genotypes with desired phenotypic characters. SSRs are easily amplified by PCR using a pair of flanking locus-specific oligonucleotides as primers to detect DNA length polymorphisms (Litt and Luty, 1989; Weber and May, 1989). If there are already a number of genes sequenced from the study organism, microsatellite loci can be defined by searching the gene sequence databases for the occurrence of stretches of simple sequence repeats. Once these microsatellites have been found, the unique DNA sequences flanking the repeats are used to design pairs of oligonucleotide primers for PCR. Because the primers are complementary to unique DNA sequences, they can be designed to be 20-25 bases long, which improves the specificity of amplification and the reproducibility. A further advantage to designing specific primer pairs is that it allows multiplex PCR where several microsatellite loci can be assayed in the same amplification reaction. In contrast, the random amplified polymorphic DNA (RAPD) method uses 10 base oligonucleotide primers. They do not bind to unique DNA sequences, amplification is often quite variable and difficult to reproduce, and multiplex PCR is not possible. Generation of microsatellite markers de novo by construction and screening of physically sheared and enzyme-digested genomic, cDNA or microsatellite enriched libraries remains a relatively complex technique. It is time-consuming and relatively expensive. Although costly to identify, SSRs are relatively inexpensive and easy in subsequent use. The enrichment method of SSR marker development includes the following major steps (Edwards et al., 1996). First, it is necessary to isolate microsatellite-containing loci
47
by hybridization with synthetic oligonucleotide probes complementary to simple sequence repeats. Next, a small-insert genomic library is constructed by cloning a particular or specific size fraction of the isolated genomic DNA fragments into vector DNA. Phage and plasmid vectors with M13 priming sites are usually preferable, because M13 primers yield the most consistent high-quality sequence information. The size range of cloned inserts should be not more than 1,500 bp in order to facilitate complete sequencing. It is then necessary to sequence the potential microsatellite-containing clones and design locus-specific oligonucleotide PCR primers that anneal to regions adjacent to the microsatellite repeat. Once the primers have been tested and proven to function (as well as capture polymorphism in the study population), they are used to amplify the respective region from different sources of genomic DNA by PCR. Differences in the size of the amplified fragments are detected using gel electrophoresis (Fig. 6). In addition to the high start up costs, some other disadvantages of SSRs include the fact they may be species-specific, and therefore of limited utility, though a recent study suggests that in plants they are concentrated in conserved portions of the genome (Morgante et al., 2002). Alleles can sometimes be difficult to interpret because of “stuttering” (Fig. 6). Finally, they can only be applied to diploid species, as single loci are usually observed, even in polyploids. Inter-Simple Sequence Repeat (ISSRs; Zietkiewicz et al., 1994) is a related methodology in which the simple sequence repeats are used as primers to amplify regions between their target sequences (i.e, the repeat arrays). Microsatellites are just beginning to be applied to floricultural germplasm, and have been successfully used for cultivar identification in Pelargonium (Becher et al., 2000). Expressed Sequence Tags (ESTs) ESTs are short (about 200 to 500 bp) sequenced fragments of randomly collected mRNAs expressed in a tissue or a cell (Gupta et al., 1999). The mRNAs are collected and reverse transcribed into cDNA that is then cloned and sequenced. ESTs represent the expression of genes in a tissue or a cell at a certain time or condition, and permit rapid identification of the expressed genes. The concept is to sequence bits of DNA that represent genes expressed in certain cells, tissues, or organs from different organisms and use these "tags" to fish a gene out of a portion of chromosomal DNA by matching base pairs (Harmer and Kay, 2001; Schaffer et al., 2000; Richmond and Somerville, 2000). EST libraries have been constructed for some important crop plants. They are typically used in conjunction with microarray analysis (Fiehn et al., 2001). EST databases have great utility for gene “mining” and for sequence comparisons among species. The potential of developing EST libraries for floricultural crops is potentially enormous, but as yet is largely unrealized due to the difficulty in obtaining funding for such research on ornamental crops. Candidate Genes and Single Nucleotide Polymorphisms (SNPs) Candidate genes are genes putatively involved in trait variation based on biological function (Pflieger et al., 2001). Candidate gene markers are developed from highly conserved regions of the biosynthetic enzyme genes as defined in the GenBank database (Wassom et al., 2000). These sequences should be from genes that are functionally related to some phenotype of interest (e. g., for flower color, genes associated with anthocyanin biosynthesis). The gene or a fragment of the gene is isolated, and then its usefulness as a marker is assayed in a population that segregates for the associated phenotype. Polymorphisms in such candidate genes are more often than not in the form of single nucleotide polymorphisms (SNPs), defined as a nucleotide position at which two alternate bases occur at appreciable frequency (Cooper et al., 1985; Kwok et al., 1996). SNPs have been extremely important in human genetics (Wang et al., 1998). SNPs in candidate genes may function as direct markers if the polymorphisms segregate congruently with the phenotypic traits of interest. Single stranded conformational polymorphism (SSCP) is a useful tool for assaying SNPs in genes of interest (Fig. 7),
48
though infrequently used in plant genetics (Isoda et al., 2000; Kohjyouma et al., 2000; Schneider et al., 1999). In plants in which the genome is relatively unknown or unmapped such as many floricultural species, candidate genes can provide a shortcut to finding closely linked markers to the phenotype of interest. SSCP can allow screening for those markers even if there are no length or RFLP differences. Capillary electrophoresis allows screening of fragments up to 600 bp under conditions that require no special alteration of the apparatus. High throughput screening is possible with automatic, multi-capillary sequencers, which makes analysis of large populations of plants feasible. Throughput can be further increased by post-PCR multiplexing of samples. Using PCR-SSCP analysis, a variant sequence is detected by a change in electrophoretic mobility (Fig. 7). This change in mobility is created by denaturing the PCR-generated double-stranded DNA and subjecting it to electrophoresis under nondenaturing conditions (Fig. 7). The two single-stranded molecules have a folded configuration, based on their sequence, that causes them to migrate differentially. This method has been used to detect mutations in plant pathogens (Schnell et al., 2001) and has now begun to be used to detect even single nucleotide polymorphisms in plant genes (Kuhn et al., 2003). By labeling the locus-specific primers with different fluorophors and using an automated capillary electrophoresis system, the SSCP migration patterns can be detected and displayed as an electropherogram (Fig. 7). Choosing the Appropriate Genetic Marker System RAPDs, AFLPs and SSRs are PCR based, while RFLPs are based on hybridization (Table 1). PCR is used to amplify DNA sequences at such magnitude that they can be visualized on an electrophoretic gel. PCR based protocols are usually fast, “cookbook” type applications that require only a small amount of DNA, which makes them easier to use than RFLPs. Ultimately, the amount of genetic polymorphism returned by any application is the most important factor in choosing among them (Ipek et al., 2003; Russell et al., 1997). While RFLPs, RAPDs and AFLPs are all highly polymorphic marker systems, SSRs offer the greatest amount of polymorphism (Table 1). Of the four techniques, RFLPs and SSRs are co-dominant, AFLPs partly co-dominant, and RAPDs only dominant (Table 1). Codominant markers are invariable more informative. RFLPs, AFLPs and SSRs techniques are expensive, laborious and time consuming to set up (Table 1). However, they are much more robust than RAPDs (Powell et al., 1996b), which have serious problems of reproducibility and information content (McGregor et al., 2000). Once the amplifying primers have been obtained, SSRs are easy and relatively inexpensive to use. Until recently, virtually any marker approach required the use of highly toxic chemicals. The adaptation of many of these techniques to automatic sequencing machines has reduced if not eliminated such exposure. However, the purchase and maintenance costs of such equipment limit the number of labs that can obtain them. Fortunately, many educational and research institutions have developed “core” highthroughput molecular facilities that provide such services to the entire institution at relatively reasonable rates. Moreover, as automatic sequencing technology matures, the price of entry-level units continues to drop. In choosing a marker application, one must consider carefully the goals of the investigation (Table 2) in conjunction with the laboratory infrastructure and available technical expertise. The use to which marker data will be applied is as important as the resource considerations when choosing a particular technique to pursue. Certain techniques are useful when combined, such as AFLPs and SSRs (Milbourne et al., 1997). Expressed sequence tags (ESTs) and single nucleotide polymorphisms (SNPs) have potential to lower costs even further, especially if automated facilities are available (Gupta et al., 1999).
49
APPLICATION OF GENETIC MARKERS Mapping One of the most useful functions of genetic markers is in the construction of genomic maps. Gene mapping, loosely defined, is the determination of the location of elements within a genome, with respect to identifiable landmarks. One of the earliest examples is that of Gregor Mendel’s peas. Mendel noticed that certain traits co-segregate across generations, that is, that they are linked. There are many different types of mapping including genetic mapping (linkage, quantitative trait loci [QTLs]), physical mapping (ordered, overlapping cloned fragments of genomic DNA, usually inserted into bacterial artificial chromosomes), restriction mapping, cytogenetic mapping (DNA of a known locus is amplified directly in the chromosome using fluorescent in situ hybridization [FISH]), somatic cell mapping, radiation hybrid mapping, and comparative mapping, most of which are beyond the scope of this review. From the standpoint of germplasm characterization and plant breeding, genetic or linkage mapping is the most commonly utilized. 1. Genetic (Linkage) Mapping. Genetic or linkage mapping involves putting markers in order, indicating the relative genetic distances between them, and assigning them to their linkage groups on the basis of the recombination values from all their pairwise combinations (Jones et al., 1997b). To do this successfully requires highly polymorphic markers such as RFLPs, SNPs, SSRs, or AFLPs, and a population with known relationships (family) in order analyze inheritance and recombination patterns. Maps are made by statistical analysis of data from both genotyping (marker studies in the lab) and phenotyping (field evaluations). Linkage distance is measured in centimorgans (cM), 1 cM defined as the 1% chance of recombination between two marker loci. Markers that map together as one linkage group are assumed to be in close physical proximity (i.e., on the same chromosome). With a fully saturated marker based map, the number of different linkage groups possible to find would equal the basic chromosome number of the species under study. 2. Quantitative Trait Loci (QTLs). Markers can be used to map both qualitatively and quantitatively inherited traits. Such traits are typically affected by more than one gene, and also by the environment. The location of a gene that affects a trait that is measured on a quantitative (linear) scale (e.g., plant height, plant yield) is called a quantitative trait locus (QTL). Mapping a QTL is not as simple as mapping a single gene that affects a qualitative trait (such as flower color). The concept behind QTL mapping is associating the QTLs with linked DNA markers (Darvasi and Soller, 1992; Knapp et al., 1990) and identifying them via their map position (Jones et al., 1997b). QTLs segregate as single genes, and are unaffected by the environment. They are highly polymorphic, which means that many genes can be mapped in a single cross (Jiang and Zeng, 1995; Ronin et al., 1995). Many high quality linkage maps have been created, particularly for food and fiber crops. QTLs have great utility in programs of marker assisted selection. Han et al. (2002) recently published the first QTL study in Alstroemeria. Marker Assisted Selection (MAS) Marker assisted selection is a breeding strategy utilizing indirect selection. Instead of selecting for the phenotype or genotype itself, molecular markers closely linked to the characters and/or gene(s) of interest are used to track the successful introgression of the desired alleles from the donor parent to the progeny (Dudley, 1993). Using reliable molecular markers to screen during the first generations of a breeding program or when plants have a sustained period of juvenility before desired phenotypic characters are expressed can shave years off of the program and also save resources (space, production inputs). MAS may be useful where phenotypic selection is difficult, such as in breeding programs for pest and pathogen resistance. With markers tightly linked to genes for resistance, it may be possible to forego field tests until the final stages of the program. Introgression of genes from wild species into a cultivated variety, while concurrently
50
selecting against the unwanted characteristics of the wild parent might be accomplished more rapidly with MAS than conventional breeding (Solomon-Blackburn and Barker, 2001). MAS can also be used for selecting more than one trait at the same time (Liu et al., 2000). MAS is not a panacea, however (Moreau et al., 2000). It is not an efficient approach unless a highly saturated marker linkage map has been developed. The degree of success is heavily influenced by the type of marker system used as well as the phenotyping quality. The need for large population sizes, numerous replications, and independent verification of the marker linkages can offset the savings in time and resources over traditional trait introgression programs. CONCLUSIONS Molecular markers have been much more widely applied to food and fiber crops than to ornamentals. To a large extent this probably reflects the levels of funding available to researchers in floriculture. Molecular genetic applications are costly, and difficult to initiate without considerable expenditure. However, we are likely to see an ever-increasing reliance on genetic marker technology in programs of evaluation and enhancement of floricultural germplasm as the technology becomes more ubiquitous in university departments and research institutions. Traditional breeders of floricultural crops have much to gain by applying these tools to their selection programs. We can also expect that large-scale genetic mapping efforts will be applied to the highest value floricultural crop genera such as roses in the near future. Literature Cited Anastassopoulos, E. and Keil, M. 1996. Assessment of natural and induced genetic variation in Alstroemeria using random amplified polymorphic DNA (RAPD) markers. Euphytica 90:235-244. Barcaccia, G., Albertini, E., and Falcinelli, M. 1999. AFLP fingerprinting in Pelargonium peltatum: its development and potential in cultivar identification. J. Hort. Sci. Biotech. 74:243-250. Becher, S.A., Steinmetz, K., Weising, K., Boury, S., Peltier, D., Renou, J.P., Kahl, G., and Wolff, K. 2000. Microsatellites for cultivar identification in Pelargonium. Theor. App. Genet. 101:643-651. Boyle T.H. 1997. The genetics of self-incompatibility in the genus Schlumbergera (Cactaceae). J. Hered. 88:209-214. Boyle, T.H., Menalled, F.D. and Oleary, M.C. 1994. Occurrence and physiological breakdown of self-incompatibility in easter cactus. J. Am. Soc. Hort. Sci. 119:10601067. Bretting, P.K. and Widrlechner, M.P. 1995. Genetic markers and plant genetic resource management. Pl. Breeding Rev. 13: 11-86. Caetano-Anolls, G., Bassam, B.J. and Gresshoff, P.M. 1991. DNA amplification fingerprinting: a strategy for genome analysis. Plant Mol. Biol. Rep. 9:294-307. Carr, J., Xu, M. and Korban, S.S. 2003. Estimating Genetic Diversity in New Guinea Impatiens Using AFLP markers. Acta Hort. 623:161-168. Clegg, M.T., Brown, A.H.D. and Whitfield, P.R. 1984. Chloroplast DNA diversity in wild and cultivated barley: implication for genetic conservation. Gen. Res. 43: 339343. Coates, D. and Cullis, C.A. 1987. Chloroplast DNA variability among Linum species. Amer. J. Bot. 74:260-268. Cooper, D.N., Smith, B.A., Cooke, H.J., Niemann, S. and Schmidtke, J. 1985. An estimate of unique DNA sequence heterozygosity in the human genome. Hum.Genet. 69:201-205. Crick, F.H.C. 1962. The genetic code. Sci. Amer. 207(4):66-74. Darvasi, A. and Soller, M. 1992. Selective genotyping for detemination of linkage between a marker locus and a quantitative trait locus. Theor. Appl. Genet. 85:353-359.
51
De Benedetti, L., Burchi, G., Mercuri, A., Pecchioni, N., Faccioli, P. and Schiva, T. 2000. Random amplified polymorphic DNA (RAPD) analysis for the verification of hybridity in interspecific crosses of Alstroemeria. Pl. Breeding 119:443-445. Dore, C., Dosba, F. and Baril, C. (eds.) 2001. Proceedings of the international symposium on molecular markers for characterizing genotypes and identifying cultivars in horticulture. Acta Hort. 546, Leuven, Belgium. Dubouzet, J.G., Murata, N. and Shinoda, K. 1997. RAPD analysis of genetic relationships among Alstroemeria L cultivars. Scientia Hort. 68:181-189. Dubouzet, J.G., Murata, N. and Shinoda, K. 1998. Relationships among some cultivated species and varieties of Alstroemeria L. based on RAPD analysis. Scientia Hort. 73:37-44. Dudley, J.W. 1993. Molecular markers in plant improvement: manipulation of genes affecting quantitative traits. Crop Sci. 33: 660-668. Edwards, M. 1992. Use of molecular markers in the evaluation and introgression of genetic diversity for quantitative traits. Field Crop Res. 29:241-260. Edwards, A., Hammond, H.A., Jin L., Caskey, C.T. and Chakraborty, R. 1992. Genetic variation at five trimeric and tetrameric tandem repeat loci in four human population groups. Genomics 12:241-253. Edwards, K.J., Baker, J.H.A., Daly, A., Jones, C. and Karp, A. 1996. Microsatellite libraries enriched for several microsatellite sequences in plants. BioTechniques 20:758-760. Fiehn, O., Kloska, S. and Altmann, T. 2001. Integrated studies on plant biology using multiparallel techniques. Curr. Op. Biotech. 12:82-86. Gupta, P.K., Varshney, R.K., Sharma, P.C. and Ramesh, B. 1999. Molecular markers and their applications in wheat breeding. Pl. Breeding 118:369-390. Han, T.H., Jeu, M. de, Van Eck, H. and Jacobsen, E. 2000. Genetic diversity of Chilean and Brazilian Alstroemeria species assessed by AFLP analysis. Heredity 84:564-569. Han, T.H., Van Eck, H.J., De Jeu, M.J. and Jacobsen, E. 2002. Mapping of quantitative trait loci involved in ornamental traits in Alstroemeria. Hortscience 37:585-592. Hartl, D.L. 2000. A primer of population genetics, 3rd ed. Sinauer Associates, Sutherland, MA. Harmer, S.L. and Kay, S.A. 2001. Microarrays: determining the balance of cellular transcription. The Plant Cell 12:613-615. Hearne, C.M., Ghosh, S. and Todd, J.A. 1992. Microsatellites for linkage analysis of genetic traits. Trends in Genetics 8:288-294. Hillis, D.M., Moritz, C. and Mable, B.K. 1996. Molecular Systematics, 2nd ed. Sinauer Associates, Sutherland, MA. Hosaka, K., Ogihara, Y., Matsubayashi, M. and Tsunewaki, K. 1984. Phylogenetic relationship between the tuberous Solanum species as revealed by restriction endonuclease analysis of chlorplast DNA. Jpn. J. Genet. 59:349-369. Ipek, M., Ipek. A. and Simon, P.W. 2003. Comparison of AFLPs, RAPD markers, and isozymes for diversity assessment of garlic and detection of putative duplicates in germplasm collections. J. Amer. Soc. Hort. Sci. 128:246-252. Isoda, K., Shiraishi, S., Watanabe, S. and Kitamura, K. 2000. Molecular evidence of natural hybridization between Abies veitchii and A. homolepis (Pinaceae) revealed by chloroplast, mitochondrial and nuclear DNA markers. Mol. Ecol. 9:1965-1974. Jansen, R.K. and Palmer, J.D. 1988. Phylogenetic implications of chloroplast DNA restriction site variation in the Mutisieae (Asteraceae). Amer. J. Bot. 75:751-764. Jiang, C. and Zeng, Z.B. 1995. Multiple trait analysis of genetics mapping for quantitative trait loci. Genetics 140:1111-1127. Jones, C.J., Edwards, K.J., Castaglione, S., Windield, M.O., Sala, F., Wiel, C. van de, Bredemeijer, G., Vosman, B., Mathes, M., Daly, A., Brettschneider, R., Bettini, P., Buiatti, M., Maestri, E., Malcevschi, A., Marmiroli, N., Aert, R., Volckaert, G., Rueda, J., Linacero, R., Vasquez, A. and Karp, A. 1997a. Reproducibility testing of
52
RAPD, AFLP and SSR markers in plants by a network of European laboratories. Mol. Breed. 3: 381-390. Jones, N., Ougham, H. and Thomas, H. 1997b. Markers and mapping: we are all geneticists now. New Phytol. 137:165-177. Knapp, S., Bridges, W.C. and Birkes, D. 1990. Mapping quantitative trait loci using molecular marker linkage maps. Theor. Appl. Genet. 79:583-592. Kohjyouma, M., Lee, I.J., Iida, O., Kurihara, K., Yamada, K., Makino, Y., Sekita, S. and Satake, M. 2000. Intraspecific variation in Cannabis sativa L. based on intergenic spacer region of chloroplast DNA. Biol. Pharm. Bull. 23:727-730. Kuhn, D.N., Heath, M., Wisser, R.W., Brown, J.S., Meerow, A.M., Lopez, U. and Schnell, R. J. 2003. Resistance Gene Homologues in Theobroma cacao as useful genetic markers. Theor. Appl. Genet. 107:191-202. Kwok, P.-Y., Deng, Q., Zakeri, H., Taylor, S.L., Nickerson, D.A. (1996). Increasing the information content of STS-based genome maps: identifying polymorphisms in mapped STSs. Genomics 31:123-126. Litt, M. and Luty, J.A. 1989. A hypervariable microsatellite revealed by in vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene. Am. J. Hum. Genet. 44:397-401. Liu, J., Liu, D., Tao, W., Li, W., Wang, S., Chen, P., Cheng, S. and Gao, D. 2000. Molecular marker-facilitated pyramiding of different genes for powdery mildew resistance in wheat. Pl. Breeding 119:21-24. Maroof, M.A.S., Zhang., Q. and Biyashev, R.M. 1994. Molecular marker analysis of powdery mildew resistance in barley. Theor. Appl. Genet. 88:733-740. McGregor, C.E., Lambert, C.A., Greyling, M.M., Louw, J.H. and Warnich, L. 2000. A comparative assessment of DNA fingerprinting techniques (RAPD, ISSR, AFLP and SSR) in tetraploid potato (Solanum tuberosum L.) germplasm. Euphytica 113:135144. Meerow, A.W., Schoellhorn, R.J. and Kartuz, M. In press. Four cultivars of Iochroma. HortScience. Milbourne, D., Meyer, R., Bradshaw, J.E., Baird, E., Bonar, N., Provan, J., Powell, W. and Waugh, R. 1997. Comparison of PCR-based marker systems for the analysis of genetic relationships in cultivated potato. Mol. Breeding 3:127-136. Moreau, L., Lemarié, S., Charcosset, A. and Gallais, A. 2000. Economic Efficiency of one cycle of marker-assisted selection. Crop Sci. 40:329-337. Morgante, M. and Olivieri, A.M. 1993. PCR-amplified microsatellites as markers in plant genetics. Pl. Jour. 3:175-182. Morgante, M., Hanafey, M. and Powell, W. 2002. Microsatellites are preferentially associated with nonrepetitive DNA in plant genomes. Nature Genetics 30:194-200. O'Leary, M.C. and Boyle, T.H. 1998. Inheritance and linkage relationships of isozymes in Easter cactus. J. Am. Soc. Hort. Sci.123:98-103. O'Leary, M.C. and Boyle, T.H. 1999. Cultivar identification and genetic diversity within a Hatiora (Cactaceae) clonal germplasm collection using isozymes. J. Amer. Soc. Hort. Sci. 124:373-376. Palmer, J.D. 1985. Chloroplast DNA and phylogenetic relationships. Pp. 63-80 in S.K. Dutta (ed.). DNA systematics, vol. 2. CRC Press, Boca Raton. Palmer, J. and Zamir, D. 1982. Chloroplast DNA evolution and phylogenetic relationships in Lycopersicon. Proc. Natl. Acad. Sci. 79:5006-5010. Palmer, J.D., Jansen, R.K., Michaels, H.J., Chase, M.W. and Manhart, J.R. 1988. Chloroplast DNA variation and plant phylogeny. Ann. Missouri Bot. Gard. 75:11801206. Pflieger, S., Lefebvre, V. and Causse, M. 2001. The candidate gene approach in plant genetics: a review. Molecular Breeding 7:275-291. Powell, W., Machray, G.C. and Provan, J.A. 1996. Polymorphism revealed by simple sequence repeats. Trends Pl. Sci. 1:215-222.
53
Powell, W., Morgante, M., Andre, C., Hanafey, M., Vogel, J., Tingey, S. and Rafalski, A. 1996b. The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis. Mol. Breed. 2:225-238. Richmond, T. and Somerville, S. 2000. Chasing the dream: plant EST microarrays. Curr. Op. Plant Biol. 3:108-116. Ronin, Y.I., Kizhner, V.M. and Korol, A.B. 1995. Linkage between loci of quantitative traits and marker loci: multi-trait analysis with single marker. Theor. Appl. Genet. 90:776-786. Russell, J.R., Fuller, J.D., Macaulay, M., Hatz, B.G., Jahoor, A., Powell,W. and Waugh R. 1997. Direct comparison of levels of genetic variation among barely accessions detected by RFLPs, AFLPs, SSRs and RAPDs. Theor. Appl. Genet. 95:714-722. Saiki, R.K., Gelfand, D.H., Stoffels, S., Scharf, S., Higuch, R.H., Horn, G.T., Mullis, K.B. and Erlich, H.A. 1988. Primer-directed enzymatic amplification of DNA with thermostable DNA polymerase. Science 239:487-491. Schaffer, R., Landgraf, J., Perez-Amador, M. and Wisman, E. 2000. Monitoring genomewide expression in plants. Curr. Op. Biotech. 11:162-167. Scandalios, J.G. 1969. Genetic control of multiple forms of enzymes in plants: a review. Biochem. Genet. 3:37-79. Schneider, K., Borchardt, D.C., Schafer-Pregl, R., Nagl, N., Glass, C., Jeppsson, A., Gebhardt, C. and Salamini, F. 1999. PCR-based cloning and segregation analysis of functional gene homologues in Beta vulgaris. Mol. Gen. Genet. 262:515-524. Schnell, R.J., Olano, C.T. and Kuhn, D.N. 2001. Detection of avocado sunblotch viroid variants using fluorescent single-strand conformational polymorphism analysis. Electrophoresis 22:427-432. Scovel, G., Ben Meir, H., Ovadis, M., Itzhaki, H. and Vainstein, A. 1998. RAPD and RFLP markers tightly linked to the locus controlling carnation (Dianthus caryophyllus) flower type. Theor. Appl. Genet. 96:117-122. Smith J. 1986. Biochemical fingerprints of cultivars using reversed-phase highperformance liquid-chromatography and isozyme electrophoresis - a review. Seed Sci. Tech. 14:753-768. Solomon-Blackburn, R.M. and Barker, H. 2001. Breeding virus resistant potatoes (Solanum tuberosum): a review of traditional and molecular approaches. Heredity 86:17-35. Soltis, D.E. and Soltis, P.A. (eds.). 1990. Isozymes in plant biology (Advances in plant sciences series, vol 4). Timber Press, Portland, OR. Strommer, J., Gerats, A.G.M., Sanago, M. and Molnar, S.J. 2000. A gene-based RFLP map of petunia. Theor. Appl. Genet. 100:899-905. Strommer, J., Peters, J., Zethof, J., de Keukeleire, P. and Gerats, T. 2002. AFLP maps of Petunia hybrida: building maps when markers cluster. Theor. Appl. Genet. 105:10001009. Sytsma, K.J. and Schaal, B.A. 1985. Phylogenetics of the Lisianthius skinneri (Gentianaceae) species complex in Panama utilizing DNA restriction fragment analysis. Evolution 39:594-608. Sytsma, K.J. and Gottlieb, L.D. 1986. Chloroplast DNA evolution and phylogenetic Relationships in Clarkia sect. Peripetasma (Onagraceae). Evolution 40:1248-1261. Tanksley, S.D. and Orton, T.J. (eds.). 1983. Isozymes in plant genetics and breeding. Parts A and B. Elsevier Science Publ. B.V., Amsterdam. Tautz, D. 1989. Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucl. Acids Res. 17:6463-6471. Tautz, D. and Renz, M. 1984. Simple sequences are ubiquitous repetitive components of eukaryotic genomes. Nucl. Acids Res. 12:4127-4138. Tautz, D., Trick, M. and Dover, G.A. 1986. Cryptic simplicity in DNA is a major source of genetic variation. Nature 322:652-656.
54
Tomkins, J.P., Wood, T.C., Barnes, L.S., Westman, A. and Wing, R.A. 2001. Evaluation of genetic variation in daylily (Hemerocallis spp.) using AFLP markers. Theor. Appl. Genet. 102:489-496. Vos, P., Hogers, R., Bleeker, M., Reijans, M., van de Lee, T., Hornes, M., Frijters, A., Pot, J., Peleman, J., Kuiper, M., Zabeau, M. 1995. AFLP: a new technique for DNA fingerprinting. Nucl. Acids Res. 23:4407-4414. Wang, Z., Weber, J.L., Zhong, G., Tanksley, S.D. 1994. Survey of plant short tandem DNA repeats. Theor. Appl. Genet. 88:1-6. Wang, D.G., Fan, J.-B., Siao, C.-J., Berno, A., Young, P., Sapolsky, R., Ghandour, G., Perkins, N., Winchester, E., Spencer, J., Kruglyak, L., Stein, L., Hsie, L., Topaloglou, T., Hubbell, E., Robinson, E., Mittmann, M., Morris, M.S., Shen, N., Kilbum, D., Rioux, J., Nusbaum, C., Rozen, S., Hudson, T.J., Lipshutz, R., Chee, M., Lander, E.S. (1998). Large-scale identification, mapping, and genotyping of singlenucleotide polymorphisms in the human genome. Science 280:1077-1082. Wassom, J.J., Mei, C., Rocheford, T.R. and Widholm, J.M. 2000. Allelic variation in candidate genes associated with QTL for the maize anther culture response. Maydica 45:267-276. Watson, J.D. 1970. The molecular biology of the gene, 2nd ed. Benjamin, New York. Weber, J.L. and May, P.E. 1989. Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. Am. J. Hum. Genet. 44:388-396. Williams, J.G.K., Kubelik, A., Livak, K.J., Raflski, J.A. and Tingey, S.V. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18:6531-6535. Zhang, J.H., Mcdonald, M.B. and Sweeney, P.M. 1997. Testing for genetic purity in petunia and cyclamen seed using random amplified polymorphic DNA markers. Hortsci. 32:246-247. Zietkiewicz, E., Rafalski, A. and Labuda, D. 1994. Genome fingerprinting by simple sequence repeat (SSR)-anchored Polymerase Chain Reaction Amplification. Genomics. 20:176-183. Zurawski, G. and Clegg, M.T. 1987. Evolution of higher-plant chloroplast DNA-encoded genes: implications for structure, function and phylogenetic studies. Ann. Rev. Plant Physiol. 38:391-418.
55
Tables Table 1. Characteristics and relative cost of various marker systems. Feature Origin Maximum theoretical number of possible loci in analysis
Dominance Null alleles
Transferability Reproducibility Amount of sample required per sample Ease of development Ease of assay Automation / multiplexing Genome and QTL mapping potential Comparative mapping potential
56
Isozymes Genic Limited by the number of enzyme genes and histochemical enzyme assays available (30-50) Codominant Rare
RFLP Anonymous/ Genic Limited by the restriction site (nucleotide) polymorphism (tens of thousands)
RAPD Anonymous Limited by the size of genome, and by nucleotide polymorphism (tens of thousands)
AFLP Anonymous Limited by the restriction site (nucleotide) polymorphism (tens of thousands)
SSR Anonymous Limited by the size of genome and number of simple repeats in a genome (tens of thousands)
EST Genic Limited by the number of expressed genes (10,000-30,000)
SNP Genic Limited by the size of genome and number of functional genes
Codominant Rare to extremely rare
Dominant Not applicable (presence/ absence type of detection) Within species
Codominant Occasional to common
Codominant Rare
Codominant Rare
Across related species High 10-20 ng DNA
unknown High 10-20 ng DNA
Across families and genera Very high Several mg of tissue
Across genera
Dominant Not applicable (presence/ absence type of detection) Within species
High to very high 2-10 mg DNA
Low to medium 2-10 ng DNA
Medium to high 0.2-1 µg DNA
Within genus or species Medium to high 10-20 ng DNA
Moderate
Difficult
Easy
Moderate
Difficult
Moderate
Difficult
Easy to moderate
Difficult
Easy to moderate
Easy to moderate
Difficult
Possible
Possible
Easy to moderate Possible
Moderate
Difficult
Moderate to difficult Possible
Limited
Good
Very good
Very good
Good
Good
Good
Excellent
Good
Very limited
Very limited
Limited
Good to very good
Limited
Possible
Table 1. continued. Feature Candidate gene mapping potential Potential for studying adaptive genetic variation Development Assay Equipment
Isozymes Limited
RFLP Limited
RAPD Useless
AFLP Useless
SSR Useless
EST Excellent
SNP Excellent
Good
Limited
Limited
Limited
Limited
Excellent
Excellent
Inexpensive Inexpensive Inexpensive
Moderate Moderate Moderate
Expensive Moderate Moderate to expensive
Expensive Moderate Moderate to expensive
Expensive Moderate Moderate to Expensive
Inexpensive Moderate Inexpensive Moderate to expensive Moderate Moderate to expensive
Table 2. Comparative utility of various marker systems. Application Breeding. Bulk segregant analysis. Comparative and framework maps Diversity studies. F1 identification. Fingerprinting. Gene tagging. Genetic maps. High-resolution mapping. Map-based gene cloning. Marker-assisted selection. Novel allele detection Quality trait mapping Region-specific marker saturation. Seed testing Varietal/line identification. Very fast mapping
Isozymes
RFLP
RAPD
AFLP
SSR
EST
SNP
comparative only if homologous
multiplexing necessary
multiplexing necessary
multiplexing necessary
multiplexing necessary but easy
57
58
Figures (See following pages) Fig. 1. Three RFLP profiles visualized in an electrophoretic gel. A. A plant with a 13, 8, 6, 5 and 2 kb RFLP fragments. B. A mutation in this individual (a new restriction site in the 13 kb fragment of individual A) has resulted in a 9 and a 4 kb fragments. C. A mutation in individual C has resulted in the loss of a restriction site causing the appearance of an 11 kb fragment and the loss of the 6 and 5 kb fragments of A. Fig. 2. RAPDs. A. Primers anneal to sites 1, 2, and 3 on the top strand of the DNA template and to sites 4, 5, and 6 on the bottom strand of the DNA template forming 2 RAPD PCR products. B. In a second DNA template, a change in sequence at site #2 prevents the primer from annealing, thus the PCR product A is not produced. C. Visualization of the RAPD products produced by reactions A and B in an agarose gel. Fig. 3. Typical AFLP “fingerprint” visualized in an acrylamide gel. Fig. 4. Electropherogram of AFLP fragments produced by one pair of primers, generated on an automatic capillary sequencer. Each labeled peak (the number is the number of base pairs) represents a putative amplified DNA restriction fragment. Fig. 5. A dinucleotide (GA) repeat locus isolated from Iris hexagona. Fig. 6. Chromatogram of an amplified SSR locus in three individuals of an Iris hexagona population produced on an automatic capillary sequencer. Alleles A and B differ by one dinucleotide repeat unit. A homozygote for each of the two alleles and an heterozygote are shown. “Plus A” and “stutter” peaks are artifacts of the amplification reaction. Fig. 7. Using single strand conformational polymorphism (SSCP) to identify single nucleotide polymorphisms (SNPs) in gene sequences.
Fig. 1.
59
Fig. 2.
60
Fig. 3.
Fig. 4.
61
Fig. 5.
Fig. 6. 62
Fig. 7.
63
