Molecular mechanism of inhibitory effects of bovine lactoferrin ... - PLOS

RESEARCH ARTICLE

Molecular mechanism of inhibitory effects of bovine lactoferrin on the growth of oral squamous cell carcinoma Chanbora Chea1, Mutsumi Miyauchi1*, Toshihiro Inubushi2, Nurina Febriyanti Ayuningtyas1, Ajiravudh Subarnbhesaj3, Phuong Thao Nguyen4, Madhu Shrestha1, Sivmeng Haing1, Kouji Ohta5, Takashi Takata1*

a1111111111 a1111111111 a1111111111 a1111111111 a1111111111

1 Department of Oral & Maxillofacial Pathobiology, Graduate School of Biomedical and Health Sciences, Hiroshima University, Hiroshima, Japan, 2 Sanford Burnham Prebys Medical Research Institute, San Diego California, United States of America, 3 Department of Oral Diagnostic Science, Faculty of Dentistry, Khon Kaen University, Khon Kaen, Thailand, 4 Department of Global Dental Medicine & Molecular Oncology, Graduate School of Biomedical and Health Sciences, Hiroshima University, Hiroshima, Japan, 5 Department of Oral and Maxillofacial Surgery, Division of Cervico-Gnathostomatology, Graduate School of Biomedical and Health Sciences, Hiroshima University, Hiroshima, Japan * [email protected] (TT); [email protected] (MM)

OPEN ACCESS Citation: Chea C, Miyauchi M, Inubushi T, Febriyanti Ayuningtyas N, Subarnbhesaj A, Nguyen PT, et al. (2018) Molecular mechanism of inhibitory effects of bovine lactoferrin on the growth of oral squamous cell carcinoma. PLoS ONE 13(1): e0191683. https://doi.org/10.1371/journal. pone.0191683 Editor: Sakamuri V. Reddy, Charles P. Darby Children’s Research Institute, 173 Ashley Avenue, Charleston, SC 29425, USA, UNITED STATES

Abstract Background Lactoferrin (LF), a member of the transferrin family, recently has been demonstrated to have anticancer effects on various cancers including oral squamous cell carcinoma (OSCC). However, little is known about the underlying mechanisms of its effects on OSCC. Therefore, we aimed to investigate the mechanism of the suppressive effects of bovine LF (bLF) on the growth of OSCC cells.

Received: May 25, 2017 Accepted: January 9, 2018 Published: January 30, 2018 Copyright: © 2018 Chea et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Data Availability Statement: All relevant data are within the paper and its Supporting Information files. Funding: This work was supported by JSPS KAKENHI for Prof. Takashi Takata, Grants-in-Aid for Scientific Research (B), project number: 25293373. Competing interests: The authors have declared that no competing interests exist.

Methods In the current study, HSC2, HSC3, HSC4 and normal human oral keratinocytes (RT7) cell lines were tested with bLF 1, 10, and 100 μg/ml. The effects and detail mechanisms of bLF on proliferation and apoptosis of cells were investigated using flow cytometry and western blotting.

Results We found that bLF (1, 10, and 100 μg/ml) induced activation of p53, a tumor suppressor gene, is associated with the induction of cell cycle arrest in G1/S phase and apoptosis in OSCC. Moreover, bLF downregulated the phosphorylation of Akt and activated suppressor of cytokine signaling 3 (SOCS3), thereby attenuating multiple signaling pathways including mTOR/S6K and JAK/STAT3. Interestingly, we revealed that bLF exerted its effect selectively against HSC3 but not on RT7 via different effects on the phosphorylation status of NFκB and Akt.

PLOS ONE | https://doi.org/10.1371/journal.pone.0191683 January 30, 2018

1 / 19

Bovine lactoferrin inhibits growth of oral squamous cell carcinoma

Abbreviations: bLF, bovine lactoferrin; OSCC, oral squamous cell carcinoma.

Conclusion This is the first report showing that bLF selectively suppresses proliferation through mTOR/ S6K and JAK/STAT3 pathways and induction of apoptosis in OSCC. This study provides important new findings, which might be useful in the prevention and treatment of OSCC.

Introduction Anti-cancer drugs derived from natural compounds are highly safe for the treatment of cancers. Lactoferrin (LF), an 80-kDa member of the transferrin family of iron binding glycoproteins [1], is naturally produced by epithelial cells [2] and found in external secretions mainly in milk [3]. Diverse biological functions of LF such as anti-inflammatory [4], anti-viral [5], antibacterial [6], and anti-tumor [7–10] have been reported. Interestingly, for many years, LF and its derivatives have been proposed for cancer therapy due to their multiple tumor-targeting and high cytological effects on cancer cells [11–13]. Inhibition of cell cycle progression in cancer cells is one of the main mechanisms by which LF may inhibit cancer growth. Recent studies have shown that LF directly arrested cell cycle in G1/S transition in breast and head and neck cancers both in vitro and in vivo via regulation of cell cycle-associated proteins including Akt, p21, p19, p27, Cdk2, cyclin E, Cdk4, and cyclin D1 [10,14–16]. In addition, LF and its derivative peptides were also reported to induce apoptosis in stomach cancer by the activation of caspase 9 [17]; in breast cancer via increase in DNA fragmentation accompanied by chromatin condensation and nuclear fragmentation [18]; and in leukemia through activation of caspase 2, 9, and 3 [19–21]. The mammalian target of rapamycin (mTOR), a serine/threonine kinase, is activated by Akt signaling pathway and sequentially phosphorylates S6 kinase (S6K) [22] to modulate cellular growth. mTOR has recently been considered as an attractive target in cancer therapy [23,24]. Suppressor of cytokine signaling 3 (SOCS3) is a negative feedback regulator of growth signaling [25]. Recently, SOCS3 has been shown to deregulate Janus kinase and signal transducer and activator of transcription (JAK2/STAT3) signaling [26] via its interaction with receptor JAK2 through the SH2 domain [27]. In addition, restoration of SOCS3 expression attenuated STAT3 activation, induced apoptosis, and suppressed tumor cell growth in lung cancer [28]. LF and its derivatives are shown to reduce cancer cell growth; however, there is a limited understanding about the mechanisms involved in LF-mediated growth inhibition in oral squamous cell carcinoma (OSCC). Hence, investigating the effects of LF on cell proliferation pathways such as mTOR and JAK2/STAT3/SOCS3 can provide new insights of its action. Therefore, we comprehensively investigated the biological effects and detail mechanisms of bLF on growth of OSCC.

Methods Reagents Bovine lactoferrin (bLF) was procured from Sunstar Inc. (Osaka, Japan). Propidium Iodide (PI), LY294002, S3I-201, PF-4708671, and Caffeic acid (CAPE) were purchased from SigmaAldrich (MO, USA). PE Annexin V Apoptosis Detection Kit was obtained from BD Biosciences (CA, USA). Rapamycin was purchased from Santa Cruz Biotechnology (CA, USA).


2 / 19


Bovine lactoferrin preparation bLF was reconstituted in sterilized-distilled water at a concentration of 10 mg/ml. Reconstituted bLF was mixed homogenously by vortexing, filtered through 0.2 μm pore size filter, and stored at -20˚C.

Cell culture The immortalized human oral keratinocyte cell line RT7 was maintained in Keratinocyte-SFM (Gibco BRL, Gaithersburg, MD, USA) supplemented with 25 μg/ml of bovine pituitary extract, 0.5 ng/ml of epidermal growth factor, 100 U/ml of penicillin, and 100 μg/ml of streptomycin. Human epithelial OSCC cell lines; HSC2, HSC3, and HSC4 were provided by Japanese Collection of Research Bioresources Cell Bank. These cell lines were cultured in RPMI-1640 (Nacalai Tesque, Inc., Tokyo, Japan) supplemented with 10% heat inactivated FBS (Biowest, France) and 100 U/ml of penicillin-streptomycin (Sigma-Aldrich, MO, USA). All cell lines were maintained in a humidified incubator at 37˚C with 5% CO2.

Proliferation assay HSC2, HSC3, HSC4, and RT7 cells were plated in 24-well plate at a density of 3,000 cells per well. After 24 h of incubation, medium was replaced with bLF containing medium. Cells were then trypsinised and counted on days 1, 2, 4, and 6 using a cell counter (Coulter Electronic, UK). Each experiment was repeated at least 3 times in triplicate wells.

Flow cytometry analysis HSC3 cells (1 x 105) were seeded in 10 cm dishes with or without bLF (1 μg/ml, 10 μg/ml, and 100 μg/ml) for 48 h at 37˚C. Cells were then harvested and centrifuged at 3,000 rpm for 3 min. The pellets were washed three times with ice-cold phosphate buffered saline (PBS) (Nacalai Tesque Inc), re-suspended in 2 ml of ice-cold 70% ethanol and stored overnight at -20˚C. After ethanol fixation, cells were washed twice with ice-cold PBS and centrifuged at 3,000 rpm. For cell cycle analysis, PI solution (10 μg/ml of PI and 100 μg/ml of RNase A in PBS) was added and samples were incubated at room temperature for 15 min prior to analysis. For apoptosis, cell pellets were suspended in 5 μl of PE-Annexin V and 5 μl of 7-AAD viability staining solution. Suspensions were gently mixed and incubated for 15 min at room temperature in the dark. After incubation, 400 μl of 1x Binding Buffer was added to each sample. Both cell cycle and apoptosis were measured using FACS Caliber flow cytometer (Becton-Dickinson, San Jose, CA).

RT-PCR analysis Total RNA was extracted from fresh HSC3 cells treated with and without bLF (1, 10, and 100 μg/ml) using RNeasy Mini Kit (Quiagen, K.K., Tokyo, Japan) according to manufacturer’s instructions. cDNA was reverse transcribed from 1μg of total RNA with ReverTra Dash Kit (Toyobo, Osaka, Japan). Total cDNA was amplified using Go Taq Green Master Mix (Promega, Madison, WI, USA), revolved using 1.5% agarose/TAE gels (Nacalai Tesque, Inc., Kyoto, Japan), and visualized by ethidium bromide staining. The following primer pair sequences were used: Forward, 5’-TGGCCACTCTTCAGCATCTC-3’, Reverse, 5’-AGCTGG GTGACTTTCTCATAGG-3’ for human SOCS3; Forward, 5’-AGCAAACGAGGCCTAAGTCA3’, Reverse, 5’–GCTGCTTGTGCTGATGGTAA-3’ for human LRP1; Forward, 5’- GCATCC TGGGCTACACTGAG -3’, Reverse, 5’- TCCACCACCCTGTTGCTGTA -3’ for GAPDH.


3 / 19


Western blotting Cells were washed with ice-cold PBS and lysed in buffer containing 0.1% Triton X-100 (Roche, Castle Hill, Australia), 10 μg/ml L-1 chlor-3-(4-tosylamido)-4-Phenyl-2-butanon (TPCK), 1 mM DTT, 0.1 mM Na3VO4, 10 μg/ml L-1 chlor-3-(4-tosylamido)-7-amino-2-heptanon hydrochloride (TLCK), 0.1 mM leupeptin, and 50 μg/ml phenylmethylsulfonyl fluoride (PMSF) for 30 min. The lysates were centrifuged at 13,200 rpm for 20 min at 4˚C. Supernatants were collected and protein concentration was determined by Bradford Protein Assay (Bio-Rad, Richmond, CA). The samples were then heated in 4 x Laemmli buffer at 100˚C for 3 min. The proteins were resolved on 10% polyacrylamide gel (PAGE), and transferred to nitrocellulose membrane (Schleicher & Schuell, Dasse, Germany). The membranes were then blocked with 3% milk for 1 h at room temperature, and incubated with primary antibodies overnight at 4˚C. The following antibodies were used: p-Akt (9271; 1:1,000; Cell Signaling Technology), panAkt (4691; 1:1,000; Cell Signaling Technology), p-NF-κB p65 (3033; 1:1,000; Cell Signaling Technology), NF-κB p65 (sc-109; 1:1,000; Santa Cruz Biotechnology), p-p53 (9281; 1:1,000; Cell Signaling Technology), p53 (9282; 1:1000; Cell Signaling Technology), p-mTOR (2971; 1:1,000; Cell Signaling Technology), mTOR (2983; 1:1,000; Cell Signaling Technology), p-S6K (9204; 1:1,000; Cell Signaling Technology), S6K (2708; 1:1,000; Cell Signaling Technology), SOCS3 (M20; 1:1,000), p-JAK2 (3771; 1:1,000; Cell Signaling Technology), JAK2 (3230; 1:1,000; Cell Signaling Technology), p-STAT3 (9133; 1:1,000; Cell Signaling Technology), STAT3 (9132; 1:1,000; Cell Signaling Technology), p-Bad (5284; 1:1,000; Cell Signaling Technology), p-Bcl2 (2827; 1:1,000; Cell Signaling Technology), cleaved caspase 9 (9505; 1:1,000; Cell Signaling Technology), cleaved caspase 3 (9664; 1:1,000; Cell Signaling Technology), cleaved caspase 6 (9761; 1:1,000; Cell Signaling Technology), cleaved caspase 7 (8438; 1:1,000; Cell Signaling Technology), BAD (695502; 1.0 μg/ml; Biolegend), Bcl2 (M0887; 1:1,000; Dako), LRP1 (2703–1; 1:7,000; Epitomics), p21 (sc-817; 1:1,000; Santa Cruz Biotechnology), cyclin D1 (M3642; 1:1,000; Dako), β-actin (A2228; 1:10,000; Sigma-Aldrich). Membranes were then incubated with appropriate secondary antibodies (1:1000) for 1 h at room temperature. The ECL western blotting detection system (GE Healthcare, UK) (Amersham, Piscataway, NJ, USA) was used for visualization of western blots.

Statistical analysis All numerical values reported represent mean values ± S.D. Statistical significance among groups was calculated using one-way ANOVA followed by Tukey’s post-hoc test. A value of p < 0.05 and p