FOODBORNE PATHOGENS AND DISEASE Volume 3, Number 1, 2006 © Mary Ann Liebert, Inc.
Molecular Subtyping of Salmonella enterica Serovar Typhi Isolates from Colombia and Argentina ANGELA SALVE,1 MARIANA PICHEL,1 MAGDALENA WIESNER,2 MARYLIN HIDALGO,2 RAQUEL TERRAGNO,1 ADRIANA ÁLVAREZ,2 CLARA INÉS AGUDELO,2 ELIZABETH CASTAÑEDA,2 and NORMA BINSZTEIN1
ABSTRACT Salmonella Typhi is the etiological agent of typhoid fever with 16 million annual cases estimated worldwide. In Colombia and Argentina it is a notifiable disease but many cases have only a clinical diagnosis. Molecular subtyping of S. Typhi is necessary to complement epidemiologic analysis of typhoid fever. The aims of this study were to determine the genetic relationships between the strains circulating in both countries and to evaluate possible variations in the distribution of 12 virulence genes. A total of 136 isolates were analyzed by pulsed-field gel electrophoresis (PFGE) with XbaI following PulseNet protocols and analysis guidelines. Eighty-three different PFGE patterns were identified, showing high diversity among the strains from both countries. Three outbreaks, two in Colombia and one in Argentina, were caused by strains of different PFGE types. In Colombia, two PFGE patterns were found predominantly, which included 36.6% of the isolates from that country. No association was found between the PFGE patterns and the year or place of isolation of the strains, the age of the patients or type of sample. However, several clusters were detected, which included isolates recovered predominantly either from Colombia or Argentina. Most of the strains (97%) exhibited a single virulence profile, suggesting that the pathogenicity markers analyzed are of limited value for strain discrimination and do not correlate with the origin of the isolates (intestinal vs. extra-intestinal). Since the creation of PulseNet Latin America, this was the first international study conducted in South America. The PFGE types identified were incorporated into the Regional S. Typhi PulseNet Database and are now available for comparison with those of strains isolated in other regions. This information will be used for active surveillance, future studies, and outbreak investigations.
INTRODUCTION
S
Typhi is the etiological agent of typhoid fever with a global burden of 16 million illnesses and 600,000 deaths annually (Crump et al., 2004), being a worldwide public health problem, especially in developing countries. S. Typhi is a gram-negative rod-shaped bacterium pathogenic only for humans. Infection occurs when water and food contaminated with S. Typhi is consumed (Katz et al., 2002; Olsen and Kafoa, 2001; WHO, 2004). Epidemiological studies of ALMONELLA ENTERICA SEROVAR
this pathogen, supported by different subtyping approaches, are important because they help determining the source of infection to control the dissemination of the microorganism (Olive and Bean, 1999). Cases and outbreaks of typhoid fever are annually reported worldwide to World Health Organization. In Colombia and Argentina, this disease is notifiable to the National Public Health Surveillance Systems of each of these countries. In Argentina, 3,446 cases of typhoid fever were reported during the period between January 1988 and December 2004 (Ministerio,
1Departamento Bacteriología, Instituto Nacional de Enfermedades Infecciosas (INEI)–ANLIS “Carlos G. Malbrán,” Buenos Aires, Argentina. 2Grupo de Microbiología, Instituto Nacional de Salud, Bogotá, Colombia.
142
MOLECULAR SUBTYPING OF SALMONELLA TYPHI BY PFGE
2004) based on clinical diagnosis; however, in the same period only 88 isolates of S. Typhi were submitted for laboratory confirmation to the National Reference Laboratory (NRL), INEI–ANLIS “Carlos G. Malbrán.” From 2002 to 2004, 2,330 cases of typhoid and paratyphoid fever were reported in Colombia, but only 52 cases were laboratory-confirmed (Ministerio, 2003). In Colombia, a National Surveillance Program to assess the main bacterial pathogens associated with acute diarrheal disease was initiated at the Instituto Nacional de Salud (INS) together with the Public Health Laboratories (PHL), coordinated by the Pan-American Health Organization (PAHO) in 1997. The aim of the program was to identify the serotypes and the antimicrobial resistance patterns of Salmonella spp., Shigella spp., and Vibrio cholerae O1 isolates. S. Typhi made up 75 (7%) of Salmonella isolates submitted from human sources to the different regional PHL during 1997–2003 (Grupo, 2004). Likewise, in Argentina, the surveillance of Salmonella spp. infections is carried out by Public Health Laboratories, as part of the activities of the National Laboratories Network for Surveillance of Diarrhea and Bacterial Gastroenteritis. This Network is coordinated by the NRL at the INEI–ANLIS “Carlos G. Malbrán,” where the isolates are derived for further characterization, including serotyping and molecular subtyping. Besides, the distribution of serovars identified in both countries is annually reported to the WHO Global Salmonella Surveillance Program since 2000. In the period between January 1988 and December 2004, S. Enteritidis and S. Typhimurium were the serovars found predominantly in Argentina. Only 88 (0.6%) were characterized as S. Typhi. The characterization of S. Typhi strains is important not only for each country individually, but also for Latin American region as a whole, in the context of global surveillance to control the dissemination of the disease. This is an important goal of Pulse Net Latin America (LA), as a component of the international PulseNet Network. PulseNet Latin America has begun in 2004 with the Latin America training course and the agreement on regulations of the LA network (www.panalimentos.org).
143
Different methods have been employed for strain subtyping of S. Typhi, which include phage-typing, multilocus enzyme electrophoresis, ribotyping, IS200 fingerprinting, polymerase chain-reaction (PCR), random amplification of polymorphic DNA (RAPD), restriction fragment length polymorphisms (RFLP), multiplex-PCR-based VNTR profiling, amplified fragment length polymorphisms (AFLP), and pulsed field gel electrophoresis (PFGE) (Liu et al., 2003; Nair et al., 2000; Threlfall et al., 1984). PFGE is often considered the “gold standard” of molecular typing methods, and is recommended to be used in Salmonella investigations especially during outbreaks (Olive and Bean, 1999; Thong et al., 1995). Moreover, the PFGE methodology has gained an important role for the subtyping of foodborne pathogens, since the creation of PulseNet (Swaminathan et al., 2001). Another aspect considered in the characterization of Salmonella strains is the presence of virulence factors involved in the pathogenesis of this microorganism. The bacteria employ two type III secretion systems to translocate virulence-associated proteins (effector proteins) directly into the cytosol of target cells of the host (Groisman et al., 1999; Prager et al., 2000). Adhesion to the host epithelial cells is also an important step in pathogenicity, and several fimbrial loci have been described in strains of different serovars of Salmonella (Bäumler and Heffron, 1996, 1997). Earlier studies have showed that changes in the repertoire of translocated effector proteins may contribute to the adaptation of Salmonella strains to new hosts and to the emergence of epidemic strains (Prager et al., 2000). However, few studies have been performed to assess the distribution of virulence genes among strains of different serovars isolated from clinical samples in different geographic areas. While some of the pathogenicity associated genes seem to be conserved and widely distributed among Salmonella spp. isolates, others appear to be found exclusively in certain serovars and in some cases, different alleles have been described for the same gene, suggesting there could be variations which may provide basis for strains characterization (Bakshi and Galyov, 2000; Prager et al., 2000). Apart from the numerous
144
SALVE ET AL.
virulence genes that have been associated to the complex process of Salmonella pathogenicty, other factors from the host and from the bacterium have been found to participate in modulation and regulation of the infection by this pathogen. Thus, the gene avrA, identified in S. Typhimurium encodes an effector molecule that inhibits activation of the key proinflammatory NF-kappaB transcription factors and may limit virulence in vertebrates in a manner analogous to avirulence factors in plants (Collier-Hyams et al., 2002; Hardt and Galán, 1997). To our knowledge, no molecular studies had been made on S. Typhi isolates either in Colombia or in Argentina, so the genetic diversity and relationships of the strains circulating in these countries still remain unknown. The aim of this study was to characterize Colombian and Argentinean S. Typhi isolates obtained during the period between 1988 and 2004 by PFGE to determine their genetic relationships. Additionally, the presence of twelve virulence associated genes were determined in all isolates in order to assess whether or not there is any relation between virulence genes repertoire and the pathogenic potential of the isolates (intestinal vs. extra-intestinal localization).
MATERIALS AND METHODS Bacterial isolates A total of 136 S. Typhi isolates were included in the study: 82 isolates from Colombia (72 spoTABLE 1.
DEMOGRAPHIC DATA
AND
SOURCES
radic and 10 from two outbreaks), recovered since 1997 until 2004, and 54 isolates from Argentina, recovered from 1988 to 2004, including 3 isolates from a typhoid fever outbreak and 51 sporadic isolates. The demographic data and sources of the isolates are detailed in Table 1. All the strains were kept at 70°C in the National Strain Collections in the National Reference Laboratories, in each country. Characterization of the isolates The strains were identified following the biochemical tests described by Edwards and Ewing (Ewing, 1986). The serotype of the isolates were tested by slide agglutination assay (Popoff, 2001) using DIFCO antisera for the Colombian isolates and antisera produced by the Instituto Nacional de Producción de Biológicos ANLIS “Carlos G. Malbrán” for the Argentine ones. Antimicrobial susceptibility testing was performed by KirbyBauer disc diffusion using the following antibiotics: trimethoprim-sulfamethoxazol (SXT; 1:25 g, tetracycline (TE; 30 g), ampicillin (AMP; 10 g), chloramphenicol (C; 30 g), ciprofloxacin (CIP; 5 g), gentamicin (GM; 10 g), nalidixic acid (NA; 30 g), cefotaxime (CTX; 30 g), and amoxicillin/clavulanic acid (AMC; 20:10 g). Interpretive standards were based on the Control Laboratory Standard Institute (2005). PFGE was carried out following the PulseNet standardized protocol for Salmonella (CDC, 2004) using only the primary restriction enzyme, XbaI and the universal standard strain, Salmonella Braenderup H9812 (Hunter et al., 2005). OF
S. TYPHI ISOLATES INCLUDED
IN THE
STUDY
Age, n (%)
Country
14 years old
14 years old
Source, n (%) Gender, n (%) ND
Colombia
28 42 (34.1%) (51.2%)
12
Argentina
14 40 (25.9%) (74.0%)
0
Male
Female
Blood cultures
Stools
56 26 59 17 (68.3%) (31.7%) (72.0%) (20.6%)
ND
ND
18 34 (33.3%) (62.9%)
n (%), number and percentage of isolates; ND, no data available.
Bone marrow
Urine
Articular liquid
Outbreaks (n isolates)
4 (5.0%)
1 (1.2%)
1 (1.2%)
1 (1.8%)
1 (1.8%)
0
Putumayo January 2000 (n 6) Antioquia February 2002 (n 4) Buenos Aires Julio 2004 (n 3)
MOLECULAR SUBTYPING OF SALMONELLA TYPHI BY PFGE
For virulence gene identification, published PCR protocols were followed to search for plasmid encoded spvC (Chiu and Ou, 1996), toxin coding stn (Dinjus et al., 1998), fimbriae coding genes pefA and sefD (Bäumler and Heffron, 1996, 1997) and for the avrA gene (Prager et al., 2003). The following genes: invA, sopE (and variants sopEtt and sopE2), spiC, mgtB and sopB were detected using PCR protocols from the Bacteriology and Enteric Pathogens Division, National Microbiology Laboratory, Winnipeg, Canada (C. Clark, personnal communication). The oligonucleotides used as primers were: for sopB (646 bp), sopB-F TATCCGTCGGGTTACTCAC and sopBR ATCTCCAGGTTACCGCTATTC; for sopE (855 bp), sopE-F GGCGCGGGCGGTAAAAC and sopE-R CCGAGGAAGCGCATCTGAGG; for sopE(tt) (224 bp) sopE(tt)-F ACGGAGTTATAAAAGGATT-GG and sopE(tt)-R TAAAGACCCCGCATACG; for sopE2 (461 bp), sopE2-F CAGCGGCGTAACCTCTTTCATAAC and sopE2-R CAGACATACCGACTACCCATTTTC; for mgtB (892 bp), mgtB-F TTTCGCACTAACAGAGCAG CACAG and mgtB-R GACCTCGCCA AAACGCAGT-ATG and for spiC (250 bp), spiCF GCT-GGCAGTTTTAAAAGGCATTCC and spiC-R CCATCCCCCATCCGCTGTG. Data analysis PFGE patterns were assessed visually and by computerized image analysis using the BioNumerics software version 4.0 (Applied Maths, Sint-Martens-Latem, Belgium). The Dice similarity coefficient was applied to compare the macrorestriction patterns and to establish the genetic relationship between isolates. Clustering was based on the Unweighted Pair Group Method with Arithmetic Averages (UPGMA), with a band position tolerance of 1.5% and optimization of 1.5%. Simpson’s index of diversity (Hunter and Gaston, 1988), which states an average estimate of the probability that unrelated strains will be assigned to different types, was calculated for PFGE for the unrelated isolates (n 123). RESULTS All the isolates from Colombia and Argentina were susceptible to all seven antimi-
145
crobial agents tested. When analyzed by PFGE, 83 different PFGE patterns were recognized among the 136 isolates studied, with DNA bands ranging from 23 to 840 Kb (Fig. 1). Among the 82 S. Typhi isolates from Colombia, 43 different PFGE patterns were identified (Table 2): two patterns predominated (ALJPPX01.0001 and ALJPPX01.0012) and included 15 (18.3%) isolates each. Eleven out of 43 profiles (25.6%) contained two isolates each, while the remaining 30 (69.8%) patterns only contained one isolate. Pattern ALJPPX01.0001 was distributed throughout the country and was present in most of the years included in this study; furthermore this pattern included the 6 isolates of the Putumayo outbreak, as well as nine sporadic isolates. Pattern ALJPPX01.0012 was found in 13 Antioquia isolates (86.7%) where it was predominant during 2002 and 2003 and four of these isolates belonged to the outbreak, which occurred in 2002. Additionally, this pattern was also found in two isolates in two other locations (Table 2). In Argentina, 42 different PFGE patterns were identified among 54 isolates studied (Table 3). In contrast to the results observed in Colombia, none of the profiles was predominant: one pattern, ALJPPX01.0054, included four isolates; two patterns, ALJPPX01.0049 and ALJPPX01.0059, included three isolates; five patterns included two isolates and the remaining 34 strains exhibited single profiles. Pattern ALJPPX01.0049 included the three epidemiologically related isolates: these isolates had been all recovered from blood cultures of patients suffering typhoid fever in Buenos Aires, during a period of 1 week in July 2004. Furthermore, an isolate derived three weeks later from the same area showed a very similar PFGE profile, pattern ALJPPX01.0048 (Fig. 1). This isolate was also considered to be epidemiologically related to the outbreak. In addition, as was observed in Figure 1, two other PFGE profiles, differing in two bands from the outbreak pattern, were identified, that corresponded to one isolate recovered in 2004 and the other one recovered in 1998 in the area of Buenos Aires. Thus, all the isolates grouped in this branch, labeled as branch A (Fig. 1), could derive from a common ancestor, and belong to a single clone that has been circulating for several years in this area.
FIG. 1. Dendrogram obtained by cluster analysis of the 83 S. Typhi pulsed-field gel electrophoresis (PFGE) patterns from Argentina and Colombia. The analysis was performed using BioNumerics software, version 3.5 (Applied Maths), applying Dice coefficient. (A–J) Branches including three or more PFGE patterns that shared over 89% similarity were pointed out.
FIG. 1.
Continued.
148
SALVE ET AL. TABLE 2. DISTRIBUTION OF THE PULSED-FIELD GEL ELECTROPHORESIS (PFGE) PATTERNS FROM COLOMBIA BY PLACE AND YEAR OF COLLECTION
PFGE pattern ALJPPX01.0001
ALJPPX01.0002 ALJPPX01.0007 ALJPPX01.0008 ALJPPX01.0011 ALJPPX01.0012
ALJPPX01.0013 ALJPPX01.0014 ALJPPX01.0020 ALJPPX01.0021 ALJPPX01.0028 ALJPPX01.0045 ALJPPX01.0036 Single PFGE patterns (n 30)
Year
Place of origin
No. of isolates
1997 1999 2000 2000 2002 2002 2003 2001 2002 1998 2000 1999 2000 2000 2002 2003 2003 2004 2004 1998 1999 1999 2002 2003 2002 1999 1997 2000 2004 2002 2003 1997–2004
Antioquia Antioquia Meta Putumayo Antioquia Bogotá Bogotá Bogotá Antioquia Bogotá Santander Bogotá Antioquia Bogotá Antioquia Antioquia Valle del Cauca Bogotá Antioquia Tolima Valle del Cauca Caldas Tolima Risaralda Meta Santander Tolima Huila Valle del Cauca Antioquia Antioquia 9 different places
1 1 1 6.a 2 3 1 1 1 1 1 1 1 2 6.b 5 1 1 2 1 1 2 1 1 1 1 1 1 2 1 1 30
aEpidemiologically bFour
related isolates. epidemiologically related isolates.
When the patterns from Argentina and Colombia were compared, only two patterns were identified in both countries by the analysis using BioNumerics software: patterns ALJPPX01.0002 and ALJPPX01.0013, which included four isolates (two from Argentina, 1998, and two from Colombia, 2001 and 2002) and three isolates (two from Colombia, 1998 and 1999, and one from Argentina, 1995) respectively. However, no epidemiological relation could be established among the isolates. Simpson’s index of diversity for PFGE, calculated with the epidemiologically unrelated isolates, was 0.98, reaffirming that PFGE can be used to differentiate S. Typhi isolates. Despite the high heterogeneity observed, ten groups of related PFGE patterns could be identified (Fig. 1, Table 4). In eight of the ten clus-
ters, the isolates included in each group were predominantly recovered in one of the two countries (Table 4). The isolates belonging to the two Colombian outbreaks were grouped in clusters B (Antioquia, 2002) and C (Putumayo, 2000). There was no relation between the PFGE patterns and the year of isolation for either of the countries; even the isolates from Argentina recovered between 1988 and 1996 appeared distributed in different branches, showing patterns similar and in some cases identical to those of strains isolated in later years (Fig. 1, Table 4). From 136 isolates studied, 97% exhibited a single virulence profile: invA, spiC, stn, sopB, sopE, sopE2, sopE(tt), sefD, spvC, pefA, avrA. Only 4 strains from Argentina (2.9%) differed, lacking sopE(tt) gene (n 3,
149
MOLECULAR SUBTYPING OF SALMONELLA TYPHI BY PFGE TABLE 3. DISTRIBUTION OF THE PULSED-FIELD GEL ELECTROPHORESIS (PFGE) PATTERNS FROM ARGENTINA BY PLACE AND YEAR OF COLLECTION PFGE pattern
Year
Place of origin
No. of isolates
ALJPPX01.0002
1998
ALJPPX01.0049 ALJPPX01.0054
2004 1995 1996 1997 1993 1998 1998 1997 1995 2004 1988 1993 1993 2002 1988–1996 1997–2004
San Luis Capital Federal Buenos Aires Salta Río Negro Salta Neuquén Capital Federal Salta Salta Salta Capital Federal Capital Federal Capital Federal Capital Federal Buenos Aires 5 different places 9 different places
1 1 3.a 1 2 1 1 1 2 1 1 1 1 1 1 1 16 18
ALJPPX01.0055 ALJPPX01.0057 ALJPPX01.0059 ALJPPX01.0061 ALJPPX01.0065 Single PFGE patterns (n 34) aEpidemiologically
related isolates.
2.2%) and sopE (n 1, 0.7%). These results were found in both countries, independently of the year, place of isolation or type of sample.
DISCUSSION Typhoid fever continues to be a major public health problem in developing countries, esTABLE 4. DISTRIBUTION OF S. TYPHI PULSED-FIELD GEL ELECTROPHORESIS (PFGE) PATTERNS IN GENETIC BRANCHES Branch A B C D E F G H I J
Country Argentina Colombia Colombia Argentina Argentina Colombia Colombia Argentina Colombia Argentina Argentina Colombia Argentina Colombia Argentina Colombia Argentina
No. of PFGE patterns (no. of isolates) 6 4 11 5 8 2 4 1 5 2 3 1 6 2 1 4 4
(8) (19) (28) (7) (13) (2) (5) (1) (6) (5) (3) (1) (6) (2) (1) (4) (4)
pecially in areas of poor sanitary conditions. In industrialized nations, cases are usually linked to travelers returning from endemic areas, although there have also been outbreaks caused by consumption of contaminated imported food (Katz et al., 2002). This situation demonstrates the clear need for an active epidemiological surveillance complemented with the differentiation of the isolates at the molecular level (in order to characterize and compare strains, to control and prevent new outbreaks both locally and internationally). For this reason, we examined 136 isolates of S. Typhi from several regions of Colombia and Argentina by PFGE. Although multidrug resistant Salmonella Typhi have been reported worldwide in the last decade (Madhulika et al., 2004; Mirza et al., 2004), this situation was not observed in Colombia or Argentina in the current study. PFGE with enzyme XbaI was shown to be very discriminatory in this study. This indicates that the PulseNet standardized PFGE protocol is useful for routine epidemiological surveillance and outbreak investigations of typhoid fever. Studies employing multilocus enzyme electrophoresis, iron-transport systems, outer membrane proteins, enterotoxin production and restriction patterns of chromosomal DNA
150
with EcoRI and PstI (Faundez et al., 1990; Reeves et al., 1989) suggested that all S. Typhi strains belonged to a single clone worldwide. More recently, a clonal origin for S. Typhi was proposed by Thomson et al. (2004), who found highly conserved phage-elements in its genome. However, by ribotyping, PFGE and multilocus analysis of variable number of tandem repeats (MLVA) isolates from different countries have been found to be very diverse (Franco et al., 1992; Liu et al., 2003; Thong et al., 1995). The present study supports that S. Typhi is a highly diverse serovar. The isolates analyzed included strains recovered in different time periods (1997–2004 for Colombia and 1988–2004 for Argentina), but no relation was found between the PFGE patterns and the time of isolation, of the strains, the age of patients or the sample type. Several clusters of similar PFGE patterns were identified, which included isolates from one of the two countries predominantly. However, no association could be demonstrated between the PFGE types and the geographic origin of the strains, since these clusters as well as single PFGE patterns of Colombia and Argentina appeared interspersed in the dendrogram. The S. Typhi strains from Argentina appeared to be more genetically heterogeneous than the ones from Colombia; however a larger analysis including more isolates from both countries would be necessary to confirm this finding. The isolates from three outbreaks of typhoid fever, two registered in Colombia during 1997–2003 and one in Argentina in 2004 were caused by different strains. The isolates from both Colombian outbreaks belonged to the two common PFGE patterns, ALJPPX01.0001 and ALJPPX01.0012, included in branches B and C, and those from the outbreak in Argentina showed a single PFGE pattern, that was grouped with other two similar profiles from the same country in branch A (Fig. 1). These results suggest that the three outbreaks were caused by strains that were already circulating in the area. Regarding virulence factors, none of the strains carried the plasmid encoded spvC (intracellular replication) or pef fimbrial gene, present in the virulence plasmid of other serovars. The gene avrA has been associated to the at-
SALVE ET AL.
tenuation of Salmonella infections, and it has been found in strains of S. Paratyphi B isolated from feces, but not in those isolated from systemic infections (Prager et al., 2003); however, no such difference was found among the isolates of S. Typhi analyzed, which lacked the avrA gene independently of the source of isolation. All the isolates from this study carried the rest of the genes searched for and therefore virulence typing as used in the present study is of limited value for strain discrimination.
CONCLUSION The present study is the first international study conducted in South America since the creation of PulseNet Latin America. It was undertaken to compare the strains circulating in two distant countries and to create a database of the PFGE subtypes. By the application of PulseNet standardized protocols and analysis software, 83 PFGE patterns were identified and incorporated into the Regional S. Typhi PulseNet Database. This information is now available for comparison of PFGE patterns generated from strains isolated in all the other countries in the PulseNet International network and will be used for the active surveillance of typhoid fever in Colombia and Argentina and as the basis for future studies and outbreak investigations.
ACKNOWLEDGMENTS We would like to thank the Microbiology Group of the INS, especially María Elena Realpe and Maria Victoria Ovalle, for information on isolates, including their antimicrobial sensibility. We wish to thank Dr. Clifford Clark, from the Bacteriology and Enteric Pathogens Division, National Microbiology Laboratory, Winnipeg, Canada, for sharing the PCR protocols for virulence factors detection, and the “Servicio Sueros y Antígenos,” from the Instituto Nacional de Producción de Biológicos, ANLIS “Carlos G. Malbrán” for providing the antisera for the Argentinean strains typing. Also, the collaboration of Maria Inés Caffer, Lorena Aguerre and Ofelia Martinez, from the
MOLECULAR SUBTYPING OF SALMONELLA TYPHI BY PFGE
INEI-ANLIS “Carlos G. Malbrán” is gratefully acknowledged. We especially thank Dr. Swaminathan, from CDC and Dr. Enrique Pérez, from INPPAZ-PAHO/WHO, for their constant support and invaluable help in the implementation of PulseNet Latin America; as well as Dr. Peter Gerner-Smidt, from CDC, for critically reviewing this manuscript. We would like to thank the Public Health Laboratories Networks from Colombia and Argentina for submitting the isolates included in the study. This study was co-financed by Instituto Colombiano para el Desarrollo de la Ciencia y la Tecnología “Francisco José de Caldas,” COLCIENCIAS, project No. 2104-04-12679, and by the Instituto Nacional de Salud de Bogotá, D.C., Colombia. REFERENCES Bakshi, C.S., and E.E. Galyov. 2000. Identification of sop E2, a Salmonella secreted protein which is highly homologous to sopE and involved in bacterial invasion of epithelial cells. J. Bacteriol. 182:2341–2344. Bäumler, A.J., and F. Heffron. 1996. The pef fimbrial operon of Salmonella Typhimurium Mediates adhesion to murine small intestine and is necessary for fluid accumulation in the infant mouse. Infect. Immun. 64:61–68. Bäumler, A.J., F. Heffron. 1997. Contribution of horizontal gene transfer and deletion events to development of distinctive patterns of fimbrial operons during evolution of Salmonella serotypes. J. Bacteriol. 179:371–322. CDC (Centers for Disease Control and Prevention). 2004. Standardized Molecular Subtyping of Foodborne Bacterial Pathogens by Pulsed-Field Gel Electrophoresis. National Molecular Subtyping Network for Foodborne Disease Surveillance. Atlanta. Chiu, C.H., and J.T. Ou. 1996. Rapid identification of Salmonella serovars in feces by specific detection of virulence genes, invA and spvC, by an enrichment broth culturemultiplex PCR combination assay. J. Clin. Microbiol. 34:2619–2622. Collier-Hyams, L.S., H. Zeng, J. Sun, et al. 2002. Cutting edge: Salmonella AvrA effector inhibits the key proinflammatory, anti-apoptotic NF-kappa B pathway. J. Immunol. 169:2846–2850. Control Laboratory Standard Institute. 2005. Disk Difussion. Supplemental Tables M100–S15. Crump, J.A., S.P. Luby, and E.D. Mintz. 2004. The global burden of typhoid fever. Bull. WHO 82:346–353. Dinjus, U., I. Hanel, W. Rabsch, et al. 1998. Studies of the presence of the virulence factors, adhesion, intracellular
151
multiplication and toxin formation in salmonellas of different origin. Zentralbl. Bakteriol. 287:387–398. Ewing, W.H. 1986. Edwards and Ewing’s Identification of Enteriobacteriaceae. 4th ed. Elsevier, New York. Faundez, G., L. Aron, and F. Cabello. 1990. Chromosomal DNA, iron-transport systems, outer membrane proteins, and enterotoxin (heat-labile) production in Salmonella Typhi strains. J. Clin. Microbiol. 28:894–897. Franco, A., C. Gonzalez, O. Levine, et al. 1992. Further consideration of the clonal nature of Salmonella Typhi: Evaluation of molecular and clinical characteristics of strains from Indonesia and Peru. J. Clin. Microbiol. 38:2187–2190. Groisman, E., A.B. Blanc-Potard, and K. Uchiya. 1999. Pathogenicity islands and the evolution of Salmonella virulence. In: Pathogenicity Islands and Other Mobile Virulence Elements. Koper J., and J. Hacker (eds.), ASM Press, Washington DC, pp. 127–150. Grupo de Microbiología Instituto Nacional de Salud. 2004. Distribución de los aislamientos de Salmonella spp., por procedencia y por año 1997–2003. En Vigilancia de los serotipos y patrones de sensibilidad antimicrobiana de los patógenos de importancia en salud pública. Bogotá, Colombia. Available at: www.ins.gov.co/pdf_investiga/ mbi_tabla_1.pdf. Hardt, W.D., and J.E. Galán. 1997. A secreted Salmonella protein with homology to an avirulence determinant of plant pathogenic bacteria. Proc Natl Acad Sci USA 94:9887–9892. Hunter, P., and M. Gaston. 1988. Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J. Clin. Microbiol. 26: 2465–2466. Hunter, S.B., P. Vauterin, M.A. Lambert-Fair, et al. 2005. Establishment of a universal size standard strain for use with the PulseNet standardized pulsed-field gel electrophoresis protocols: converting the national databases to the new size standard. J. Clin. Microbiol. 43:1045–1050. Katz D. J., M.A. Cruz, M.J. Trepka, et al. 2002. An outbreak of typhoid fever in Florida associated with an imported frozen fruit. J. Infect. Dis. 186:234–239. Liu, Y., M. Lee, E. Ooi, et al. 2003. Molecular typing of Salmonella enterica serovar Typhi isolates from various countries in Asia by a multiplex PCR assay on variablenumber tandem repeats. J. Clin. Microbiol. 41:4388–4394. Madhulika U., B.N. Harish, and S.C. Parija. 2004. Current pattern in antimicrobial susceptibility of S Typhi isolates in Pondicherry. Indian J. Med. Res. 120:111–114. Ministerio de la Protección Social e Instituto Nacional de Salud. 2003. Sistema de Vigilancia en Salud Pública. Boletin Epidemiológico Semana 53. Bogotá, Colombia. Available at: www.col.ops-oms.org/sivigila/2003/TABLA53 03.pdf. Ministerio de Salud de la Nación, Sistema Nacional de Vigilancia Epidemiológica (SI.NA.VE.). 2004. Boletín Epidemiológico Nacional. Buenos Aires, Argentina.
152 Mirza, S., S. Kariuki, K.Z. Mamun, et al. 2004. Analysis of plasmid and chromosomal DNA of multidrug-resistant Salmonella enterica serovar Typhi from Asia. J. Clin. Microbiol. 38:1449–1452. Nair, S., E. Schreiber, K. Thong, et al. 2000. Genotypic characterization of Salmonella Typhi by amplified fragment length polymorphism fingerprinting provides increased discrimination as compared to pulsed-field gel electrophoresis and ribotyping. J. Microbiol. Methods 41:35–43. Olive, D., and P. Bean. 1999. Principles and applications of methods for DNA-based typing of microbial organisms. J. Clin. Microbiol. 37:1661–1669. Olsen, S.J., and B. Kafoa, N.S. 2001. Restaurant-associated outbreak of Salmonella Typhi in Nauru: an epidemiological and cost analysis. Epidemiol. Infect. 127:405–412. Popoff, M. Y. 2001. Antigenic Formulas of the Salmonella serovars, 8th ed. WHO Collaborating Centre for Reference and Research on Salmonella, Institut Pasteur, Paris. Prager, R., W. Rabsch, W. Streckel, et al. 2003. Molecular properties of Salmonella enterica serotype Paratyphi B distinguish between its systemic and its enteric pathovars. J Clin Microbiol. 41:4270–4278. Prager, R., S. Mirold, E. Tietze, et al. 2000. Prevalence and polymorphism of genes encoding translocated effector proteins among clinical isolates of Salmonella enterica. Int. J. Med. Microbiol. 290:605–617. Reeves, M., G. Evins, A. Heiba, et al. 1989. Clonal nature of Salmonella Typhi and its genetic relatedness to other Salmonellae as shown by multilocus enzyme electrophoresis, and
SALVE ET AL. proposal of Salmonella bongori comb. J. Clin. Microbiol. 27:313–320. Swaminathan, B., T. Barrett, S. Hunter, and R. Tauxe. 2001. Pulsenet: the molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg. Infect. Dis. 7:382–389. Thomson, N., S. Baker, D. Pickard, et al. 2004. The role of pro-phage-like elements in the diversity of Salmonella enterica serovars. J. Mol. Biol. 339:279–300. Thong, K., S. Puthucheary, R. Yassin, et al. 1995. Analysis of Salmonella Typhi isolates from Southeast Asia by pulsed field gel electrophoresis. J. Clin. Microbiol. 34: 1938–1941. Threlfall, E., E. Torre, L. Ward, et al. 1984. Insertion sequence IS200 fingerprinting of Salmonella Typhi: an assessment of epidemiological applicability. Epidemiol. Infect. 112:253–261. WHO (World Health Organization). 2004. Water related diseases. In: Typhoid and Paratyphoid Enteric Fevers. Available at: www.who.int/water_sanitation_health/diseases/typhoid/en.
Address reprint requests to: Dr. Norma Binsztein Departamento Bacteriología INEI–ANLIS “Carlos G. Malbrán” Av. Velez Sarsfield 563, C1282FF Ciudad Autónoma de Buenos Aires, Argentina E-mail:
[email protected]
