Appl Microbiol Biotechnol (2007) 75:441–449 DOI 10.1007/s00253-006-0813-8
ENVIRONMENTAL BIOTECHNOLOGY
Molecular techniques for the early warning of toxic cyanobacteria blooms in freshwater lakes and rivers Martin L. Saker & Micaela Vale & Dan Kramer & Vitor M. Vasconcelos
Received: 17 October 2006 / Revised: 14 December 2006 / Accepted: 15 December 2006 / Published online: 13 January 2007 # Springer-Verlag 2007
Abstract The aim of this work was to test the efficacy of molecular techniques for detecting toxigenic cyanobacteria in environmental water samples collected from freshwater lakes, rivers and reservoirs in Portugal. Of 26 environmental samples tested, 21 were found to contain Microcystis using a genus-specific polymerase chain reaction (PCR). Another primer pair was applied to the same DNA template to test for the presence of microcystin synthetase genes. This primer pair resulted in the formation of a PCR product in 15 of the samples containing Microcystis and one sample that did not give a positive result in the Microcystis genus-specific PCR. A restriction assay using the enzyme EcoRV was then applied to show that in most cases, the gene fragment was from toxigenic strains of Microcystis and, in one above-mentioned case, from a microcystin-producing strain of Planktothrix. All environmental samples were examined microscopically to confirm the presence of cyanobacteria species. Samples were also tested for the presence of microcystins using the ELISA plate assay. There was good agreement between
M. L. Saker (*) : M. Vale : V. M. Vasconcelos Centro Interdisciplinar de Investigação Marinha e Ambiental, Rua dos Bragas 289, 4050 Porto, Portugal e-mail:
[email protected] D. Kramer Cyano Biotech GmbH, Chausseestraße 117, 10115 Berlin, Germany V. M. Vasconcelos Departamento de Zoologia e Antropologia, Faculdade de Ciências, Universidade do Porto, Porto, Portugal
the results obtained with molecular techniques and those obtained from microscopy and chemical methods. The PCR techniques applied in this paper were found to be useful, particularly when the concentration of the target organism was very low compared with other organisms. This technique can be used to detect inocula for cyanobacterial populations and therefore provide a useful tool for assessing under which conditions particular species can grow into bloom populations. Keywords Cyanobacteria . Environmental monitoring . PCR . Microcystin . Microginin
Introduction Cyanobacterial blooms have a range of social, environmental and economic impacts. The production of toxic substances by a relatively small number of species that commonly occur in freshwater lakes and rivers can have a direct effect on human health. These “cyanotoxins” are usually either hepatotoxic or neurotoxic in pathology and have been linked to cases of human sickness and death, as well as various incidents of animal mortality (Falconer 2005; Kuiper-Goodman et al. 1999). There are significant costs associated with water-cleansing procedures that are needed to remove cyanotoxins and produce water of an acceptable standard for human consumption. In addition, cyanobacterial blooms lead to a reduction in the biodiversity of natural systems, and the decomposition of cyanobacterial populations can cause fish kills and the death of other aquatic flora through deoxygenation of the water column. Lost fishery, costs related to human illness, stock deaths, lost tourism and reduced recreation-
442
al value are also important considerations when evaluating the impacts of cyanobacterial blooms. In Portugal, surveys have shown that the freshwater cyanobacterium Microcystis is present in more than 70% of lakes, rivers and reservoirs and that in 60% of samples where this species occurs, hepatotoxic cyanotoxins known as microcystins are also present (Vasconcelos 2001; Saker et al. 2005a). More than 60 different chemical forms of microcystin have been reported worldwide, and the ability of Microcystis (and some other genera of cyanobacteria including Anabaena and Planktothrix) to produce these compounds can vary between morphologically identical strains of a single species. Despite the shortcomings of morphology in providing reliable information on the microcystin-production capability of individual strains, microscopy continues to be widely used in most water quality monitoring programmes and is the basis for most cyanobacterial “alert system” frameworks (Falconer 2005; WHO 2003). The identification of genes responsible for biosynthesis of microcystins by Microcystis (Dittmann et al. 1997; Tillett et al. 2001) and some other genera of cyanobacteria including Anabaena and Planktothrix (Rouhiainen et al. 2004; Christiansen et al. 2003) has opened the possibility of applying molecular methods to monitoring programmes aimed at detecting the presence of potentially problematic cyanobacterial species and the genes encoding for the biosynthesis of important cyanotoxins (Burns et al. 2004). Several studies have demonstrated the relationship between microcystin synthetase genes and the presence of microcystin in cyanobacterial cells (Bittencourt-Oliveira 2003; Saker et al. 2005a; ViaOrdorika et al. 2004). However, there are few studies comparing the efficacy of molecular techniques for detecting cyanobacterial toxigenicity with other chemical techniques such as ELISA and high-performance liquid chromatography (HPLC). Considering that Microcystis is a key species and is widespread in many Portuguese water bodies and that microcystins represent a clear risk in terms of public health, we have tested the application of polymerase chain reaction (PCR) techniques that can be used routinely on environmental samples to identify the presence of Microcystis as well as genes linked to microcystin biosynthesis found in microcystin-producing strains of Microcystis, Anabaena and Planktothrix. Samples were also tested using another primer pair for the detection of genes linked to the production of a group of bioactive peptides known as microginins that are produced by some strains of Microcystis (Ishida et al. 2000; Kramer et al. 2000). In this paper, we report some of the results obtained from water quality monitoring programs carried out in freshwater lakes, rivers and reservoirs in Portugal.
Appl Microbiol Biotechnol (2007) 75:441–449
Materials and methods Sample collection, cyanobacteria quantification and microcystin determination Water samples were collected from several lakes, rivers and reservoirs in the north of Portugal (Fig. 1) between July 2005 and July 2006 and transported to the laboratory on ice. A 100-ml subsample was treated with Lugol’s solution, and 10 ml was added to a settling chamber. After 24 h, the cyanobacteria in the samples were identified to the genus level using a Leica inverted microscope and with reference to standard taxonomic guides (Baker 1991, 1992; Bourelly 1970). The concentration of cyanobacteria in each of the samples was recorded as cells ml−1. For the analysis of microcystins, 5-ml water samples were sonicated on ice for 5 min at 50 W and then frozen and thawed to facilitate cell lysis. The resulting solutions were then applied to the EnviroGard® Microcystin Plate Kit (Strategic Diagnostic, Newark, NJ, USA) following the
Fig. 1 Map of Portugal showing location of study sites from which water samples were obtained. Sites as follows: 1 Amarante, 2 Torrão Reservoir, 3 Parque do Cidade, 4 Serralves, 5 Mira Lake, 6 Santa Comba Dão, 7 Carregal, 8 Mortágua and 9 Tabua
Appl Microbiol Biotechnol (2007) 75:441–449
manufacturer’s instructions. In most cases, the concentration of microcystin in the sample was not measured, and instead, the results were expressed as presence/absence. DNA extraction, PCR and RFLP analyses Subsamples were also passed through a plankton net (5 μm) to obtain a small pellet of concentrated phytoplankton. Genomic DNA was extracted from the pellets using a commercial DNA extraction kit (AquaPure kit, Bio-Rad, Hercules, USA) following the manufacturer’s instructions for gram-negative bacteria. The volume passed through the net was in the range from 1 ml to 2 l, depending on the concentration of phytoplankton in the sample. Preliminary experiments, comparing the results obtained by passing through plankton net with those retained on a GF/C filter paper (with a much smaller pore size), showed that the plankton net retains most colonial and filamentous cyanobacteria. The purity and concentration of DNA was tested by gel electrophoresis using a 1.5% gel and following standard gel electrophoresis protocols (Sambrook et al. 1989). The DNA extracts were then tested using the primers shown in Table 1. The Micr184F/Micr431R primer pair was used to amplify a 220-bp Microcystis-specific fragment of the 16s rRNA gene, confirming the presence of Microcystis within the template sample. This primer pair has been shown to be useful for detecting a diverse range of Microcystis species (Neilan et al. 1997). The mcyA-Cd1F/ mcyA-Cd1R primer pair was used to amplify a 297-bp fragment of the mcyA gene, which has been shown to be present in microcystin-producing species belonging to the genera Anabaena, Microcystis and Planktothrix (Hisbergues et al. 2003). Samples giving positive results in this assay have been shown to produce microcystins with high probability (Hisbergues et al. 2003; Saker et al. 2005b, 2006a). The MgnDan_EF/MgnDan_AR primer pair was used to amplify a 621-bp gene fragment linked to the biosynthesis of another cyanobacterial peptide known as microginin. The fourth set of primers (PCβF/ PCαR) was used as a positive control to confirm the
443
presence of cyanobacterial DNA (Neilan et al. 1995) and produced a 650-bp gene fragment from the phycocyanin operon, shared by all cyanobacteria. All PCR reactions were carried out in a volume of 20 μl containing 1×PCR buffer, 2.5 mM MgCl2, 250 M of each deoxynucleotide triphosphate, 10 pmol of each of the primers, 0.5 U of Taq DNA polymerase and 5–10 ng of DNA. Thermal cycling was carried out using a Bio-Rad MyCycler (Bio-Rad) with an initial denaturation at 95°C for 2 min followed by 35 cycles of 95°C for 90 s, annealing temperature as specified in Table 1 for 30 s, 72°C for 50 s and a final extension step at 72°C for 7 min. A volume of 4 μl of PCR reaction mixture was run on a 1.5% agarose gel in 1×TAE buffer. The gels were stained with ethidium bromide and photographed under UV transillumination. Restriction fragment length polymorphism (RFLP) analysis was carried out on all PCR products resulting from the mcyA-Cd1F/mcyA-Cd1R primer pair. Firstly, 18 μl of PCR products was purified to remove unincorporated deoxynucleotide triphosphates and other reaction components by combining with 36 μl of 95% ethanol and 1.8 μl of 3-M sodium acetate. The solution was then vortexed and centrifuged at 13,200 rpm for 20 min The PCR product was then resuspended in 18 μl of sterile ultrapure water and digested with EcoRV according to the manufacturer’s protocol. Digested PCR products were analysed with a 2% agarose gel using standard electrophoresis protocols. Cyanobacteria isolation and culture The sample collected from Carregal on the 14th of June 2005 was characterized by a high concentration of Aphanizomenon flos-aquae and relatively low concentration of Microcystis aeruginosa. Representative strains of the two dominant cyanobacteria species in the sample were isolated into pure culture by micromanipulation using a drawn-out pipette to select individual colonies of Microcystis and single filaments of Aphanizomenon. Colonies/ filaments were washed three times with sterile Z8 media (Kotai 1972) and placed in 10-ml plastic centrifuge tubes
Table 1 PCR primers used in this study Primer
Sequence (5′–3′)
AT (°C)
Size (bp)
Reference
Micr184F Micr431R mcyA-Cd1F mcyA-Cd1R MgnDan_EF MgnDan_AR PCβF PCαR
GCCGCRAGGTGAAAMCTAA AATCCAAARACCTTCCTCCC AAAATTAAAAGCCGTATCAAA AAAAGTGTTTTATTAGCGGCTCAT Patent no. EP 05 026 396 Patent no. EP 05 026 396 GGCTGCTTGTTTACGCGACA CCAGTACCACCAGCAACTAA
50
220
Neilan et al. (1997)
59
297
Hisbergues et al. (2003)
57
621
Kramer, unpublished
52
650
Neilan et al. (1995)
AT Annealing temperature
444
Appl Microbiol Biotechnol (2007) 75:441–449
containing 5 ml of fresh media. After a period of 3 to 4 weeks, the cultures were observed microscopically for the presence of contaminating organisms. Those that did not contain any obvious contaminants were cultured in 1l flasks, which were then used to inoculate 6-l flasks containing 4 l of media. At the end of the exponential growth stage, cellular material was harvested by settlement in a separation flask. Cells were then frozen and lyophilized for toxicological and PCR analyses described above.
Results Figure 2 shows representative results obtained from the PCR analysis carried out on isolated strains and natural bloom samples collected from freshwater lakes and rivers in Portugal. The complete data set including the results for PCR, microscopic analyses and the ELISA assay for microcystins is shown in Table 2.
a
A gene fragment from the phycocyanin operon, with a size of 650 bp, was produced for all of the DNA extracts, confirming the presence of cyanobacterial DNA in the isolated cyanobacterial strains and in all of the environmental samples. In contrast, when the mcyA-Cd1F/mcyA-Cd1R, Micr184F/Micr431R and MgnDan_EF/MgnDan_AR primer pairs were used in the PCR reaction, only some of the DNA templates resulted in the formation of PCR products. Of 26 environmental samples collected from a range of different water bodies and at different times of the year, 21 gave positive results for the presence of Microcystis as indicated by the formation of a 220-bp PCR product (Fig. 2) The results obtained in this PCR analysis were found to be in good agreement with those obtained from microscopy as shown in Table 2. This was the case even when the concentration of Microcystis (most commonly M. aeruginosa) was low compared to other cyanobacteria. For example, in the sample collected from Carregal on the 14th of June 2005, Microcystis constituted less than 0.01% of the
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16 17 18 19
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16 17 18 19
1000bp
200bp
b 1000bp
200bp
Fig. 2 Representative results obtained from PCR analyses using the PCβF/PCαR, Micr184F/Micr431R and mcyA-Cd1F/mcyA-Cd1R primer pairs (a) and the MgnDan_EF/MgnDan_AR primer pair (b). Samples as follows: Lane 1, Msep7; Lane 2, Msep20; Lane 3, Cya126; Lane 4, Msep29; Lane 5, MicCarregal; Lane 6, AphCarregal; Lane 7, Carregal 14/6/05; Lane 8, Carregal 10/8/05; Lane 9, Mortágua 10/8/05; Lane 10, Mortágua 18/10/05; Lane 11, Amarante 18/10/05;
Lane 12, Torrão Reservoir 18/10/05; Lane 13, Torrão Reservoir 19/7/ 05; Lane 14, Parque do Cidade (Pond 1) 2/3/06; Lane 15, Parque Cidade (Pond 4) 2/3/06; Lane 16, Santa Comba Dão 10/8/05; Lane 17, Santa Comba Dão 19/9/05; Lane 18, Mira 1/8/01; Lane 19, Mira 1/9/ 01. Samples shown in a are the result of PCR reactions carried out using a single primer pairs, loaded onto the same gel lane
Appl Microbiol Biotechnol (2007) 75:441–449
445
Table 2 Summary of the results obtained by microscopic analysis of natural water samples, analysis of microcystins by ELISA and the presence or absence of target genes in DNA extracts Sample source
Datea
Cyanobacteriab (×103 cells ml−1)
ELISA
PCc
mcyAc
Micrc
Mgnc
Amarante
20/09/05
ND
+
−
+
−
Amarante Carregal
18/10/05 14/06/05
ND ✓
+ +
+ +
+ +
− −
Carregal Torrão Reservoir (Site 1) Torrão Reservoir (Site 1) Torrão Reservoir (Site 1) Torrão Reservoir (Site 1) Torrão Reservoir (Site 2) Mortágua
10/08/05 19/07/05
ND ND
+ +
− −
− +
− +
20/09/05
Chr(10.12), Osc(0.17), Pse(0.05), Oth(0.09) Pla(0.11), Pse(0.06), Oth(0.03) Aph(445200), Mic(43.88), Pse(1.40) Ana (7.51) Pse(20.80), Mic(16.35), Ana(1.49), Aph(0.74) NA
✓
+
+
+
−
M
06/09/05
Pse(11.53), Mic(5.67), Chr(0.84)
✓
+
+
+
−
M
18/10/05
Mic(2.99), Pse(0.10)
✓
+
+
+
+
M
18/10/05
Mic(385.33), Pse(28.65), Oth(1.72)
✓
+
+
+
+
M
18/10/05
✓
+
+
+
−
M
Mortágua
10/08/05
ND
+
−
+
−
Mortágua Parque do cidade (Pond 1) Parque do cidade (Pond 2) Parque do cidade (Pond 3) Parque do cidade (Pond 4) Santa Comba Dão
15/11/05 2/3/06
Mic(9.59), Pse(0.85), Gom(0.46), Osc(0.21), Aph(0.11) Mic(2.46), Aph(1.48), Ana(0.07), Dac(0.02) Mic(0.49), Pse(0.01) Ply(343.9), Mic(7.6), Aph(3.5), Pla(1.3) Ply(56.2), Pla(18.3), Pse(1.3)
ND ND
+ +
+ −
+ +
− +
ND
+
−
−
−
ND
+
−
−
−
ND
+
−
+
−
✓
+
+
+
−
M
Santa Comba Dão
19/09/05
✓
+
+
+
−
M
Santa Comba Dão Santa Comba Dão Tabua Tabua Mira Mira Serralves Aquaculture Pond JCU Msep7 Msep20 Msep29 Amar31 MicCarregal M6 McyOsc Cya126 AphCarregal
18/10/05 15/11/05 15/11/05 23/09/05 1/8/01 1/9/01 09/08/05 10/8/97
Ply(53.2), Pla(33.8), Aph(12.9), Chr(1.6) Pla(51.4), Ply(13.8), Aph(3.6), Chr(1.2), Mic(0.2) Aph(167), Mic(2.77), Pse(1.15), Ana(0.02) Aph(216), Mic(16.67), Pse(1.97), Ana(0.21) Mic(36.48), Pse(7.00), Aph(4.60) Mic(2.67), Pse(0.39), Osc(0.07) Pse(0.40), Gom(0.17), Aph(0.11) Aph(36.0), Mic(0.20) Mic(105), Aph (4.3), Ana(0.1) Mic(88), Oth(0.2), Aph(0.1) Mic (110.5), Pla (0.4) Cyl(325)
✓ ND ✓ ✓ ✓ ✓ ND ND
+ + + + + + + +
+ − + + + + − −
+ + − + + + + −
− − − − − + − −
M
5/9/99 5/9/99 5/9/99 5/8/99 14/06/05 UK UK UK 14/06/05
Microcystis, pure culture Microcystis, pure culture Microcystis, pure culture Microcystis, pure culture Microcystis, pure culture Microcystis, pure culture Planktothrix, pure culture Planktothrix, pure culture Aphanizomenon, pure culture
ND ND ✓ ✓ ✓ ✓ ✓ ✓ ND
+ + + + + + + + +
− − + + + + + + −
+ + + + + + − − −
+ + − − − − − − −
2/3/06 2/3/06 2/3/06 10/08/05
Restrictd
M M
M
P M M M
M M M M P P
NA not analysed, ND not detected, UK unknown a Sample collection date b Concentrations of cyanobacterial genera expressed as cells ml−1 . The following abbreviations are used: Ana (Anabaena), Aph (Aphanizomenon), Chr (Chroococales), Cyl (Cylindrospermopsis), Mic (Microcystis), Oscillatoria (Osc), Pla (Planktothrix), Ply (Planktolyngbia), Pse (Pseudoanabaena), Oth (Other). c Presence/absence of bands on the electrophoretic gel for each of the three primer pairs indicated in Table 1. Primers abbreviated as follows: PC (PCβF/PCαR), mcyA (mcyA-Cd1F/mcyA-Cd1R), Micr (Micr184F/Micr431R), Mgn (MgnDan_EF/ MgnDan_AR). d Results of restriction assay using EcoRV. M indicates an RFLP pattern similar to that obtained for pure strains of Microcystis. P indicates an RFLP pattern similar to that obtained for Planktothrix (see Fig. 3).
446
Appl Microbiol Biotechnol (2007) 75:441–449
cyanobacteria in the sample (as expressed on a cell basis). Microcystis was nevertheless detected by PCR indicating a very high level of specificity between the primers and the DNA template. Similar results were found for samples collected from Parque do Cidade (lakes 1 and 4) on the 2nd of March 2006. Both of these lakes contained very low concentrations of Microcystis compared to the dominant cyanobacterial species (Planktolyngbya). For both of the samples collected from Amarante (Table 2), Microcystis was detected in the DNA template despite an absence in the microscopic analysis. When DNA templates were tested using the mcyA-Cd1F/ mcyA-Cd1R primer pair, 15 samples gave positive results, with the production of a 297-bp gene fragment (Table 2, Fig. 2). This gene is present in microcystin-producing strains of Microcystis, Planktothrix and Anabaena. A restriction assay was therefore applied in an attempt to resolve the species responsible for the production of microcystins in the environmental samples. Typical results obtained in this analysis are shown in Fig. 3. After a 3h digest at 37°C, there were clear differences in the RFLP patterns obtained for microcystin-producing strains of Microcystis (M6, Msep29, MicCarregal) and Planktothrix (Cya126, McyOsc). Lanes 1–4 show the RFLP pattern obtained for strains of Microcystis and show a single product with a size of about 220 bp. In contrast, the two strains of microcystin-producing Planktothrix (lanes 5 and 6) gave a product of about 300 bp. When DNA extracts from Microcystis and Planktothrix were mixed together and used as a template in the PCR reaction, the resultant banding pattern after the restriction digest clearly showed the two products of different sizes (lanes 7 and 8). Lanes 9– 19 show the results obtained for a range of natural bloom samples. The results obtained for all environmental samples are shown in Table 2. In most cases, the profiles obtained from the restriction assay appeared to be similar to those
1
2
3
4
5
6
7
8
obtained for pure strains of Microcystis, indicating that Microcystis was the most likely microcystin-producer within the environmental samples. For the sample collected from Tabua on the 15th of November 2005, the RFLP profile showed a pattern similar to that obtained for the pure strains of Planktothrix. Microscopic analysis of this sample showed an absence of Microcystis; however, no Planktothrix cells were observed in the sample. The analysis of samples with the ELISA assay showed that only those samples containing microcystin synthetase genes contained detectable amounts of microcystin. There were only two cases where samples containing microcystin synthetase genes did not contain detectable concentrations of microcystin. In contrast, none of the samples lacking microcystin synthetase genes were found to contain microcystins. For the sample collected from Carregal on the 14th of June 2005, PCR analysis confirmed that both Microcystis and the genes responsible for microcystin synthetase biosynthesis were present in the natural sample dominated by Aphanizonmenon. Whereas the isolate of Aphanizomenon gave negative results with both the mcyA-Cd1F/mcyACd1R and Micr184F/Micr431R primer pairs, the isolate of M. aeruginosa taken from the same sample produced positive results with both of these primer pairs. Microcystins were detected in both the natural sample and in the isolated strain of M. aeruginosa. The fourth primer pair applied in this study was used to detect genes linked to the production of microginin. Five of the environmental samples produced positive results in this assay, evident as a 621-bp gene fragment (Fig. 2b). Two of the non-microcystin-producing strains of Microcystis (Msep7 and Msep20) contained the genes linked to the production of microginin. None of the microcystin-producing strains of Microcystis contained microginin synthetase genes.
9 10 11 12 13 14 15 16 17 18 19
1000bp
200bp
Fig. 3 RFLP analysis of mcyA-CD1 PCR products digested with EcoRV. Samples were as follows: Lane 1, Msep29; Line 2, Amar31; Line 3, M6; Line 4, MicCarregal; Lane 5, Cya126; Lane 6, McyOsc; Lane 7, mixture Msep29/Cya126; Lane 8, mixture M6/McyOsc, Lane 9, Mira 1/8/01; Lane 10, Mira 1/9/01; Lane 11, Torrão Reservoir (Site
1) 18/10/05; Lane 12, Torrão Reservoir (Site 2) 18/10/05; Lane 13, Torrão Reservoir 20/9/05; Lane 14, Tabua 15/11/05; Lane 15, Amarante 18/10/05; Lane 16, Carregal 14/6/05; Lane 17, Mortágua 18/10/05; Lane 18, Santa Comba Dão10/8/05; and Lane 19, Carregal 14/6/05
Appl Microbiol Biotechnol (2007) 75:441–449
Discussion The results of this study confirm that Microcystis is very widespread in Portuguese freshwaters, being detected in 81% of the environmental samples tested. Although this cyanobacterium commonly forms conspicuous blooms during the summer months, it can also be found at low concentrations throughout the year. Interestingly, the molecular techniques applied in this study detected Microcystis in some of the environmental samples that did not appear to contain this cyanobacterium on microscopic examination (Table 2). This might be related to limitations in the microscopic technique used in this study, where 10-ml samples of Lugol’s-treated water sample was added to a settling chamber. In some cases, when Microcystis is at very low cell concentrations, this method might not be appropriate for detecting all cyanobacteria present in a sample. In contrast, with the DNA extraction technique used here, up to 2 l of water was passed through the plankton net, and the genomic DNA was extracted from the concentrated sample. Clearly, this would result in a much greater likelihood of encountering a Microcystis colony that would give a positive result in the PCR analysis. Alternatively, a positive PCR result might arise from the presence of non-cell-bound genomic DNA in the water sample, as cyanobacterial bloom decline is accompanied with cell lysis, which may result in the liberation of genomic DNA into the surrounding water. Microcystin synthetase genes were detected in 15 of the 21 samples that gave positive results in the Microcystis genus-specific PCR assay, indicating that 71% of the samples contained potentially microcystin-producing cyanobacteria. This is in good agreement with other studies that have reported relative proportions of toxic and nontoxic forms of Microcystis. Kurmayer et al. (2002) analyzed single colonies of Microcystis spp. isolated from Lake Wannsee, Berlin and found that the proportion of colonies containing microcystin synthetase genes varied with colony size and species. That study reported that 73% of M. aeruginosa colonies contained the genes for microcystin production in contrast to only 16% of Microcystis ichthyoblabe and no colonies of Microcystis wesenbergii. Similar findings have been reported by Via-Ordorika et al. (2004) where a much higher incidence of toxicity was reported for M. aeruginosa and Microcystis botrys in comparison to other Microcystis species. In this study, M. aeruginosa was the most common species of Microcystis; however, other species were also present in some samples. The sample collected from Serralves on the 9th of August 2005 (Table 2) was dominated by Microcystis panniformis, which gave negative results in the ELISA assay and for the presence of microcystin synthetase genes. Via-Ordorika
447
et al. (2004) reported a low incidence of microcystin production for this species. It is relevant to note that the presence of microcystin synthetase genes in a sample does not necessarily indicate the presence of microcystin. This requires additional information on regulation at the gene, mRNA and protein levels. However, in this study, most of the samples giving positive results for the presence of the mcyA gene fragment also produced positive results in the ELISA assay. Negative ELISA results were found for only two of the samples. Both of these samples contained very low concentrations of Microcystis relative to other cyanobacteria, suggesting that microcystin concentrations might have been below detection. The results obtained in this study also indicate that Microcystis is not the only microcystin-producing cyanobacterium in Portuguese freshwater lakes and rivers. The restriction assay using EcoRV resulted in RFLP profiles that showed consistent differences between microcystin-producing strains of Microcystis and those of Planktothrix. In one of the environmental samples, the RFLP pattern was similar to that obtained for pure strains of microcystin-producing Planktothrix. However, neither Microcystis nor Planktothrix were observed in this sample on microscopic examination. This suggests that either the concentration of Planktothrix in the sample was too low to register using the microscopic technique, Planktothrix genomic DNA in the sample was not cell bound, or that another microcystinproducing cyanobacterium was present in the sample and produced the same RFLP profile to that of Planktothrix. Microcystin is known to be produced by a range of cyanobacterial species including Anabaena, Anabaenopsis, Hapalosiphon, Microcystis, Nostoc and Planktothrix (Sivonen and Jones 1999); however, at the time that this study was carried out, only microcystin-producing strains of Microcystis and Planktothrix where available for analysis. Studies of natural bloom populations dominated by M. aeruginosa have shown a variation of microcystin content of bloom samples from below detection up to about 0.73% of the dry weight (Sivonen and Jones 1999). Samples taken from different locations during a bloom may also show wide divergence in cyanobacterial content and can vary significantly from year to year (Kotak et al. 1995; Vezie et al. 1998). Furthermore, microcystin content may not be correlated to the biomass of microcystin-producing Microcystis blooms (Kurmayer et al. 2002). Whilst the PCR techniques applied in this paper are not quantitative, their high sensitivity suggests that they might be useful for detecting the presence of toxin-producing cyanobacteria in natural samples before they reach concentrations that can represent a public health problem. A sample sourced from Carregal (14th of July 2005) was used to demonstrate the high level of specificity between the PCR primers and the
448
DNA template whereby Microcystis could be detected by PCR despite it representing less than 0.01% of the cyanobacteria expressed on a cell basis. Baker et al. (2002) reported that as few as 10 cells ml−1 are sufficient for PCR. Via-Ordorika et al. (2004), in a study of Microcystis isolated from several European countries, found that 4.7% of microcystin-producing colonies (6 out of 128) did not result in the formation of a PCR product using the same primers targeting the mcyA gene as were used in this study. It is generally agreed that small gene fragments such as the 297-bp fragment analysed in this paper give higher amplification efficiency than the larger fragments investigated in some other studies (e.g. Baker et al. 2001, 2002; Saker et al. 2005a); however, natural mutations including insertions and deletions can affect gene detection by PCR (Christiansen et al. 2006). In this study, for the first time, we report the molecular detection of genes linked to the production of microginin in environmental samples. Whilst the production of hepatotoxic microcystins are the primary interest in freshwater cyanobacteria such as Microcystis and Planktothrix, it is important to note that many of these organisms are also a source of a wide range of other peptide-like compounds including aeruginosins, microginins, anabaenopeptins, cyanopettilins and microviridins (Welker and von Döhren 2006). Very little is known about the biosynthesis of these metabolites or their biological activities. Several studies have shown that microginins, for example, show promise as angiotensin-converting enzyme (ACE) inhibitors and may be useful for reducing blood pressure in heart failure patients. Leucin aminopeptidase (LAP) inhibition and aminopeptidase (APM) inhibition have also been demonstrated (Ishida et al. 1997, 1998, 2000; Neumann et al. 1997). Interestingly, the pure strains of M. aeruginosa analysed in this study that were found to contain the genes for microginin synthesis did not produce microcystins. This is in agreement with the results obtained from the analysis of 26 strains of M. aeruginosa isolated from a Portuguese lake and analysed using matrix-assisted laser desorption/ ionization time-of-flight mass spectrometry (Saker et al. 2005a). The genes encoding for the biosynthesis of microginin were found in only 5 of the 26 environmental samples (19%), a relatively small proportion in comparison to the incidence of mcyA genes. This study has shown that molecular methods, targeting nuisance and toxin-producing cyanobacteria, could be used, in some cases, to replace laborious and time-consuming microscopic techniques. The early detection of potentially toxic species allows water quality workers to implement appropriate measures for preventing the growth of these organisms, such as artificial destratification or the application of water-cleansing procedures. Similar molecular
Appl Microbiol Biotechnol (2007) 75:441–449
techniques have also been applied to the detection of microcystin-producing contaminants in food supplements produced for human consumption (Saker et al. 2005b, 2006b). Preliminary studies have also shown that different primer combinations, including some of those used in this study, can be combined in a multiplex reaction that could increase detection speed and reduce analysis costs (Saker et al. 2006a). Other techniques, such as the direct use of cyanobacterial cells as PCR templates (Pan et al. 2002), would also improve speed in the detection of toxic cyanobacteria and their toxins. PCR is a very useful tool for detecting gene clusters encoding for enzyme complexes related to the synthesis of a range of bioactive compounds. Compared to other natural product producers, cyanobacteria are known to produce a wide range of structural variants of some compounds such as microcystins and microginins. Detection of gene clusters with PCR is a fast way of identifying structural variants of metabolites such as microcystin and microginin. These techniques can also be used for screening strains and environmental samples for the presence of other genes encoding for metabolites with a wide range of pharmaceutical applications. Acknowledgment This study was funded by a postdoctoral scholarship to M.L. Saker provided by the Fundação para a Ciência e a Tecnologia (SFRH/BPD/8059/2002). Planktothrix strain Cya126 was kindly provided by Elke Dittmann, Technical University of Berlin, Germany. We would like to thank anonymous reviewers for helpful comments on the manuscript.
References Baker P (1991) Identification of common noxious cyanobacteria. Part I—Nostocales. Research Report No. 29, Australian centre for Water Treatment and Water Qual Res Baker P (1992) Identification of common noxious cyanobacteria. Part II—Chroococcales, Oscillatoriales. Research Report No. 46, Australian centre for Water Treatment and Water Quality Research Baker JA, Neilan BA, Entsch B, McKay DB (2001) Identification of cyanobacteria and their toxigenicity in environmental samples by rapid molecular analysis. Environ Toxicol 16:472–482 Baker JA, Entsch B, Neilan BA, McKay DB (2002) Monitoring changing toxigenicity of a cyanobacterial bloom by molecular techniques. Appl Environ Microbiol 68:6070–6076 Bittencourt-Oliveira MC (2003) Detection of potential microcystinproducing cyanobacteria in Brazilian reservoirs with a mcyB molecular marker. Harmful Algae 2:51–60 Bourelly P (1970) Les algues déau douce. Initiation à la systematique. Les algues bleues ou cyanophycées. Editions N. Boubée & Cie Burns BP, Saker ML, Moffitt MC, Neilan BA (2004) Molecular detection of the genes responsible for cyanobacterial toxin production in the genera Microcystis, Nodularia and Cylindrospermopsis. Methods in microbiology, vol. 268. In: Spencer JFT, Ragout de Spencer AL (eds) Public health microbiology: methods and protocols. Humana Press, Totowa, NJ Christiansen G, Fastner J, Erhard M, Börner T, Dittmann E (2003) Microcystin biosynthesis in Planktothrix: genes, evolution, and manipulation. J Bacteriol 185:564–572
Appl Microbiol Biotechnol (2007) 75:441–449 Christiansen G, Kurmayer R, Liu Q, Börner, T (2006) Transposons inactivate biosynthesis of the nonribosomal peptide microcystin in naturally occurring Planktothrix spp. Appl Environ Microbiol 72(1):117–123 Dittmann E, Neilan BA, Erhard M, von Döhren H, Börner T (1997) Insertional mutagenesis of a peptide synthetase that is responsible for hepatotoxin production in the cyanobacterium Microcystis aeruginosa PCC 7806. Mol Microbiol 26:779–787 Falconer IR (2005) Cyanobacterial toxins in drinking water. CRC Press, New York Hisbergues M, Christiansen G, Rouhiainen L, Sivonen K, Börner T (2003) PCR-based identification of microcystin-producing genotypes of different cyanobacterial genera. Arch Microbiol 180:402– 410 Ishida K, Matsuda H, Murakami M, Yamaguchi K (1997) Microginins 299-A and -B, leucine aminopeptidase inhibitors from the cyanobacterium Microcystis aeruginosa (NIES-299). Tetrahedron 53:10281–10288 Ishida K, Matsuda H, Murakami M (1998) Four new microginins, linear peptides from the cyanobacterium Microcystis aeruginosa. Tetrahedron 54:13475–13484 Ishida K, Kato T, Murakami M, Watanabe M, Watanabe MF (2000) Microginins, zinc metalloproteases inhibitors from the cyanobacterium Microcystis aeruginosa. Tetrahedron 56:8643–8656 Kotai J (1972) Instructions for preparation of modified nutrient solution for algae, vol 5. Norwegiean Institute for Water Research, Oslo, Norway, pp 11–69 Kotak BG, Lam AKY, Prepas EE, Kenefick SL, Hrudy SE (1995) Variability of the hepatotoxin microcystin-LR in hypereutrophic drinking water lakes. J Phycol 32:248–263 Kramer D, Dittman E, Börner T (2000) Characterisation of the microginin synthetase gene cluster in the cyanobacterium Microcystis aeruginosa HUB 5.3. In: International symposium on phototrophic prokaryotes, Barcelona, Spain Kuiper-Goodman T, Falconer I, Fitzgerald J (1999) Human health aspects. In: Chorus I, Bartram J (eds) Toxic cyanobacteria in water. E & FN Spon, London, UK, pp 113–153 Kurmayer R, Dittmann E, Fastner J, Chorus I (2002) Diversity of microcystin genes within a population of the toxic cyanobacterium Microcystis spp. in Lake Wannsee (Berlin, Germany). Microb Ecol 43:107–118 Neilan BA, Jacobs D, Goodman AE (1995) Genetic diversity and phylogeny of toxic cyanobacteria determined by DNA polymorphisms within the phycocyanin locus. Appl Environ Microbiol 61:3875–3883 Neilan BA, Jacobs D, Deldot T, Blackall LL, Hawkins PR, Cox PT, Goodman AE (1997) rRNA sequences and evolutionary relationships among toxic and nontoxic cyanobacteria of the genus Microcystis. Int J Syst Bacteriol 47:693–697 Neumann U, Forchert A, Flury T, Weckesser J (1997) Microginin FR1, a linear peptide from a water bloom of Microcystis aeruginosa. FEMS Microbiol Lett 153:475–478
449 Pan H, Song L, Liu Y, Börner T (2002) Detection of hepatotoxic Microcystis strains by PCR with intact cells from both culture and environmental samples. Arch Microbiol 178:421–427 Rouhiainen L, Vakkilainen T, Siemer BL, Buikema W, Haselkorn R, Sivonen K (2004) Genes coding for hepatotoxic heptapeptides (microcystins) in the cyanobacterium Anabaena strain 90. Appl Environ Microbiol 79(2):686–692 Saker ML, Fastner J, Dittmann E, Christiansen G, Vasconcelos VM (2005a) Variation between strains of the cyanobacterium Microcystis aeruginosa isolated from a Portuguese river. J Appl Microbiol 99:749–757 Saker ML, Jungblut A-D, Neilan BA, Rawn DFK, Vasconcelos VM (2005b) Detection of microcystin synthetase genes in health food supplements containing the freshwater cyanobacterium Aphanizomenon flos-aquae. Toxicon 46:555–562 Saker ML, Vale M, Vasconcelos VM (2006a) Molecular techniques for the early warning of cyanobacteria. SETAC Globe 7(1):31–32 Saker ML, Welker M, Vasconcelos VM (2006b) Multiplex PCR for the detection of toxigenic cyanobacteria in dietary supplements produced for human consumption. Appl Microbiol Biotechnol (in press) Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual, 2nd edn. Cold Springs Harbour Laboratory, Cold Springs Harbour, NY Sivonen K, Jones G (1999) Cyanobacterial toxins. In: Chorus I, Bartram J (eds) Toxic cyanobacteria in water. E & FN Spon, London, UK, pp 113–153 Tillett D, Parker DL, Neilan BA (2001) Detection of toxigenicity by a probe for the microcystin synthetase A gene (mcyA) of the cyanobacterial genus Microcystis: comparison of toxicities with 16s rRNA and phycocyanin operon (phycocyanin intergenic spacer) phylogenies. Appl Environ Microbiol 67:2810– 2818 Vasconcelos VM (2001) Freshwater cyanobacteria and their toxins in Portugal. In: Chorus I (ed) Cyanotoxins—occurrence, causes, consequences. Springer, Berlin Heidelberg New York, pp 62–67 Vezie C, Brient L, Sivonen K, Bertru G, Lefeuvre JC, SalkinojaSalonen M (1998) Variation of microcystin content of cyanobacterial blooms and isolated strains in Grand-lieu lake (France). Microb Ecol 35:126–135 Via-Ordorika L, Fastner J, Kurmayer R, Hisbergues M, Dittmann E, Komarek J, Erhard M, Chorus I (2004) Distribution of microcystin-producing and non-microcystin-producing Microcystis spp. in European freshwater bodies: detection of microcystins and microcystin genes in individual colonies. Syst Appl Microbiol 27:592–602 Welker M, von Döhren H (2006) Cyanobacterial peptides—nature’s own combinatorial biosynthesis. FEMS Microbiol Rev 30:530–563 WHO (2003) Algae and cyanobacteria in fresh water. In: Guidelines for safe recreational water environments, vol 1. Coastal and fresh waters. World Health Organization, Geneva, Switzerland
