Molecular Trafficking Mechanisms of Multipotent Mesenchymal Stem ...

STEM CELLS AND DEVELOPMENT 17:929–940 (2008) © Mary Ann Liebert, Inc. DOI: 10.1089/scd.2007.0156

Molecular Trafficking Mechanisms of Multipotent Mesenchymal Stem Cells Derived from Human Bone Marrow and Placenta Gary Brooke,1 Hui Tong,1 Jean-Pierre Levesque,1,2 and Kerry Atkinson1,2

We compared potential trafficking mechanisms used by human (h) multipotent mesenchymal stem cells (MSC) derived from bone marrow (bm) or placenta (p). Both hbmMSC and hpMSC expressed a broad range of cell surface adhesion molecules including β1-integrins (CD29) and CD44. Array data showed that both hbmMSC and hpMSC expressed mRNA for the cell adhesion molecules CD54 (ICAM-1), E-cadherin, CD166 (ALCAM), CD56 (NCAM), CD106 (VCAM-1), CD49a, b, c, e and f (integrins α1, 2, 3, 4 and 6), integrin α11, CD51 (integrin αV), and CD29 (integrins β1). Functional binding of hpMSC, but not hbmMSC to VCAM-1 was demonstrated using recombinant chimeric constructs. Neither bone marrow nor placental MSC expressed ligands to endothelial selectins such as PSGL-1 or sialyl Lewis X (sLex) carbohydrates and neither were able to bind functionally to chimeric constructs of the endothelial selectins CD62E (E-selectin) and CD62P (P-selectin). Furthermore, MSC expressed a restricted range of transferases necessary for expression of sLex, with no detectable expression of fucosyl transferases IV or VII. Placental MSC, but not hbmMSC, expressed mRNA for the chemokine receptors CCR1 and CCR3, and both hbmMSC and hpMSC expressed mRNA for CCR7, CCR8, CCR10, CCR11, CXCR4 and CXCR6. Intracellular chemokine receptor protein expression of CCR1, CCR3, CXCR3, CXCR4 and CXCR6 was detected in both hbmMSC and hpMSC. Cell surface expression of chemokine receptors was much more restricted with only CXCR6 displaying a strong signal on hbmMSC and hpMSC. Although cell surface expression of CXCR4 was not detected, MSC migrated in response to its ligand, CXCL12 (SDF-1). Thus, hbmMSC and hpMSC have an almost identical profile for cell surface adhesion and chemokine receptor molecules at the mRNA and protein levels. However, at the functional level, hpMSC likely utilise VLA-4-mediated binding in a superior manner to hbmMSC and thus may have superior engraftment properties to hbmMSC in vivo.

Introduction

M

esenchymal stem cells are cells of mesenchymal lineage that are believed to be located within the stroma of the bone marrow (1, 2) and other organs including placenta (3–5). A population of multipotent mesenchymal stem cells (MSC) can be isolated by plastic adherence from these tissues and expanded ex vivo. These plastic-adherent MSC have been shown to differentiate into cell types of mesenchymal origin including chondrocytes, adipocytes and osteocytes (1–5). It has also been shown that MSC demonstrate a plasticity beyond their traditional mesodermal lineage, in that they have been induced to generate tissues of both ectodermal (neurons) and endodermal (hepatocytes) nature (6, 7), to differentiate into endothelial cells, form capillaries in vitro and secrete growth factors important in angiogenesis including VEGF. MSC have been phenotypically 1 2

characterised using a variety of markers (1–5, 8–10). In their undifferentiated state they express many lineage-specific genes other than those of mesenchymal lineage (11). In addition to their ability to differentiate into both mesodermal and non-mesodermal lineages, their reproducibility of isolation and high expansion potential make them candidates for the repair and regeneration of a large variety of tissues. They have been shown in preclinical studies to improve myocardial function (after myocardial infarction), cerebral function (after cerebral infarction), liver damage and joint damage (12–15). Importantly, MSC appear to have a major advantage over many other cell types for cellular therapy, in that they are immunologically privileged (16), and even in large outbred animals can be transplanted across MHC barriers without the need for immune suppression (17). The mechanism for this is not fully understood

Adult Stem Cell and Haematopoietic Stem Cell Laboratories, Mater Medical Research Institute, Brisbane, Queensland, Australia. University of Queensland, Brisbane, Queensland, Australia.

929

930 at present, but appears to be an active process that leads to suppression of T cell function (16, 18, 19). This has important implications for the therapeutic application of MSC, because MSC derived from healthy unrelated volunteer donors can be cryopreserved, thus making them available in a timely manner for patients in a variety of acute and chronic clinical settings. MHC-identical related, MHC-haploidentical related and MHC-non-identical unrelated MSC have been used successfully in the clinic (20). In adult mammals, leukocytes, as well as various stem cells, traffic from their usual tissue of residence to inflamed and damaged tissues or to specialised organs (such as lymph nodes) that activate them. This trafficking process involves a step of mobilization from the solid tissue of origin into the circulation and homing to a different organ. Homing into a specific organ is a multi-step process involving cell tethering and rolling on the lumen of the organ vasculature, adherence, extravasation through the endothelium and migration through the tissue stroma. The well-documented trafficking and homing of hematopoietic stem cells (HSC) to the bone marrow, and leukocytes into inflamed tissues may form a general paradigm for cellular migration, since other cells such as disseminating cancers use similar mechanisms (21). The initial events in HSC trafficking are rolling and tethering upon bone marrow endothelium due to the weak interactions between E- and P-selectin (CD62E and P) constitutively expressed by bone marrow endothelial cells and selectin receptors expressed at the surface of HSC (21–25). This step is necessary to slow down HSC flowing through the blood stream in order to enable subsequent firm adhesion to the endothelium and extravasation into the bone marrow stroma (23, 24). Selectin-mediated rolling of HSC is followed by arrest and firm adhesion mediated by β1 integrins, particularly α4β1 (CD49d/CD29, VLA-4) (26, 27) and α5β1 (CD49e/CD29, VLA-5). Activation by thechemokine CXCL12 (stromal cell-derived factor-1, SDF-1) and a variety of cytokines present leads to changes in the conformation of β1 integrins and enhanced binding with their cognate ligands such as VCAM-1 and fibronectin. Once firm adhesion has been achieved, a complex series of interactions between the HSC and the endothelium leads to diapedesis of the HSC between endothelial cells via the action of junctional adhesion molecules (JAM), cadherins and platelet-endothelial cell adhesion molecule-1 (PECAM-1, CD31), thus allowing the HSC to move into the extracellular matrix (ECM) of the bone marrow stroma where they adhere to components of the ECM such as hyaluronic acid, laminin, collagen and fibronectin via β1 integrins and CD44. Migratory direction is maintained by the chemokine CXCL12 produced by bone marrow stromal cells. Similarly, leukocytes normally flow freely in the bloodstream as the endothelium, outside of the bone marrow, does not constitutively express P-selectin, E-selectin nor VCAM-1. However, upon activation by pro-inflammatory cytokines, endotoxins or bacterial products, these cell adhesion molecules are rapidly expressed at the surface of inflamed endothelium, initiating leukocyte rolling and tethering. The array of chemokines released during inflammation induces selective chemoattraction of certain leukocyte subtypes depending upon which chemokines and their receptors

BROOKE ET AL. are present (26, 28). Therefore it is likely that extra-cellular matrix-bound chemokines at the site of inflammation is a major factor causing MSC to preferentially migrate to such sites. Chemokines are released after ischaemia and include CXCL12 (or SDF-1), monocyte chemoattractant protein-1 (MCP-1 or CCL2),macrophage inflammatory proteins MIP-1 α and β (CCL3 and CCL4), interleukin (IL)-8 (CXCL8), fractalkine (CX3CL1) and interferon-gamma-inducible 10-kDa protein (IP-10 or CXCL10) (reviewed in (29)). MSC have been reported to express receptors for these chemokines, such as CXCR4, CXCR6, CCR1 and CCR7 (29–31). The bone marrow is the preferred target trafficking organ for MSC injected intravenously in the normal unperturbed animal (32, 33). In contrast, MSC appear to migrate preferentially to sites of inflammation in the injury setting (34, 35). In this study we sought to further defi ne the potential molecular mechanisms utilised by MSC to home to target organs, using as a paradigm the well-documented mechanisms used by hematopoietic stem cells for this purpose (Fig. 1). Normal placenta is an alternative, and more readily accessible, source of human MSC than bone marrow, particularly when large numbers of cells are required, for example for clinical trial purposes. Thus, we compared the potential molecular mechanisms used by each population.

Materials and Methods Isolation and ex vivo expansion of MSC Placentas were obtained with informed consent following elective caesarean section in women with normal term

Endothelium

Capillary Lumen

Tethering

Rolling

PSGL-1/ sLex P-selectin

E-selectin

CD44

VLA4 VCAM-1

Adhesion CXCR4

CXCL12 / Heparan Sulphate

FIG. 1. Schematic illustration of the molecular mechanisms used by hematopoietic stem cells for homing to the bone marrow.

931

MCS TRACKING MECHANISMS pregnancies. Cord was not used. Small pieces of placenta were excised, diced and washed in Hank’s Balanced Salt Solution (HBSS). Excised tissue (approx. 20 g) was then incubated in Dulbecco’s Minimal Essential Medium-low glucose (DMEM-LG, SAFC Biosciences) with collagenase I (Worthington Biochemicals) (140 U/ml) and DNase I (100 μg/ml, Invitrogen) for 1 hour at 37°C. The digested material was passed through a 70 μm cell strainer, washed and centrifuged on a 1.073 g/ml Percoll density gradient (Amersham), the interface collected and placed in culture in DMEM-LG (low glucose) with 20 % foetal calf serum (FCS). After 72 hours, non-adherent cells were removed and the remaining cells cultured in fresh media until 90 % confluent. At this stage the cells were passaged and further cultured in the same media. Medium was changed every 3–4 days. After the third passage, the cells from third passage onwards were used in all subsequent experiments. For hbmMSC isolation, bone marrow was collected from 18–30 year old volunteers after informed consent. Bone marrow aspirate was taken from the iliac crest. The aspirate (3–5 ml) was resuspended in HBSS and centrifuged on a 1.073 g/ml Percoll density gradient. The interface was collected, resuspended in DMEM-LG with 20 % FCS and incubated (5 % CO2, 37°C). After 72 hours cell culture, nonadherent cells were removed and the remaining cells cultured in fresh media until 90 % confluent. At this stage the cells were passaged and further cultured in the same media. Medium was changed every 3–4 days. Cells from third passage onward were used in all subsequent experiments. After a period of 3–6 passages cells from both placenta and bone marrow demonstrated a uniform fibroblast-like morphology.

In vitro differentiation of MSC into mesenchymal lineages To confi rm the mesenchymal nature of these cells, MSC from the above cultures were induced to differentiate along the adipogenic, chondrogenic and osteogenic lineages. For osteogenic differentiation MSC were grown to confluence and cultured for 3 weeks in osteogenic differentiation media (DMEM, 10 % FCS, 0.1 μM dexamethasone 50 μM ascorbate-2-phosphate, 10 mM β-glycerophosphate). Cells were fi xed in 4 % paraformaldehyde and stained with Alizarin red. For adipogenic differentiation MSC were cultured in adipogenic differentiation medium (DMEM, 1 μM dexamethasone, 5 μg/ml insulin, 60 μM indomethancin, 0.5 mM 3-isobutyl-1-methylxanthine (IBMX)) for 1–3 weeks. Adipogenic differentiation was detected on 4 % paraformaldehyde fi xed cells stained with oil red O stain. For chondrogenic differentiation cultured MSC were centrifuged at 150 g to pellet the cells. These were then cultured as a pellet in chondrogenic differentiation medium for 3 weeks (0.1 μM dexamethasone, 1 mM sodium pyruvate, 50 μM ascorbic acid, 35 mM proline, 10 ng/ml TGF-β1 and 50 mg/ml insulin/transferrin/ selenium mix (ITS, Pharmingen). Pellets were frozen in OCT (Tissue-Tek) and cryostat cut sections stained with PAS stain.

Flow cytometry analysis Cells were detached from flasks using either TrypLE Select (Invitrogen), or Cell Dissociation Buffer (Invitrogen), depending upon experiment, and washed in PBS. Cells were incubated with unconjugated primary monoclonal antibodies (mAb) to CD14, CD29, CD31, CD34, CD44, CD45, CD49d, CD49e, CD50, CD54, CD73, CD90, CD102, CD105, CD166, HLA-A,B,C and HLA-DP, DQ, DR, PSGL-1 and sialyl Lewis x (Pharmingen). Isotype matched controls were used as indicated (Pharmingen). For chemokine receptor staining, antibodies used were CCR1Alexa595 (Pharmingen), CCR5PE (Pharmingen), CCR7FITC (Pharmingen), CCR8 (Abcam), CCR10 (R&D), CCR11 (CCRL1) (Abcam), CXCR3FITC (Chemicon), CXCR4PE (Pharmingen) and CXCR6 (Chemicon). Where required, cells were stained with secondary PE-labelled donkey anti-mouse IgG, anti-goat IgG or antirat IgG (Jackson). In some instances 29.6 μm Spheroblank size calibration beads were used (Spherotech, Il, USA). Cells were analysed was on a FACScalibur flow cytometer (Becton Dickinson) and results analysed on FCSExpress (DeNovo Software). For cytoplasmic staining, cells were fixed with 4 % paraformaldehyde for 30 minutes at room temperature, then washed and stained with mAb made up in 0.1 % saponin in PBS, 0.5 % BSA.

Gene expression profiling Oligo arrays for extracellular matrix and adhesion molecules and for chemokines and their receptors were purchased from Bioscience Corporation. SuperArray Oligo GEArray for Extracellular Matrix & Adhesion Molecules and SuperArray Oligo GEArray for Chemokines & Receptors were used. MSC were grown in culture as described above and RNA extracted. Complementary RNA (cRNA) was prepared using biotinylated dUTP and a TrueLabelingAMP Linear RNA amplification kit. cRNA was hybridised on to GEArray oligo chips following the manufacturer’s protocol. Hybridisation was detected by chemiluminescence on a Fujifi lm LAS3000 luminescence reader.

RT-PCR RNA was prepared from MSC using an RNeasy kit (Qiagen). RNA was pre-incubated with DNase I (Invitrogen), and reverse transcription was performed with oligo-dT and Superscript III (Invitrogen) as described in the manufacturer’s instructions. PCR was performed on cDNA using Taq Accuprime Supermix (Invitrogen) according to manufacturer’s instructions for 40 cycles, with 55–60°C annealing temperatures. The primers used for human chemokine receptors are shown in Table 1.

Functional binding of MSC to P-selectin, E-selectin and adhesion molecules Binding ability of human MSC to P-selectin, E-selectin and VCAM-1 was explored using recombinant chimeric constructs of human E- or P-selectin fused with human IgM Fc

932

BROOKE ET AL. Table 1. Primer Sequences Used for RT-PCR of Chemokine Receptors in this Study 5’ CCR1 CCR2 CCR3 CCR4 CCR5 CCR6 CCR7 CCR8 CCR9 CCR10 CCR11 CXCR1 CXCR2 CXCR3 CXCR4 CXCR5 CXCR6 CX3CR1

3’

ATTGACAGGTACCTGGCCAT GTTTGCTTTAAAAGCCAGGAC AGCCCGGACTGTCACTTTTG ACCAAGTACTCTCTCAACTC GTCCATGCTGTGTTTGCTTT TGGGGAATATTCTGGTGGTGA GCCCGCGTCCTTCTCATCAG TTACCAAGTGGCCTCTGAAG ATGGCTTGCTGCTATACCATC CAATCTCACCTTGTTTCTGC CCATCTTGCTGAGCATACC TGCTGGGGACTGTCTATGAAT GCAACAATACAGCAAACTGG CTGTGGCCGAGAAAGCAGG TCTTCCTGCCCACCATCTAC CCGCTAACGCTGGAAATGGAC GGCAATGTCTTTAATCTCGACA TCCTTCTGGTGGTCATCG

(rhuPsel-IgMFc and rhuEsel-IgMFc) or mouse VCAM-1 fused with human IgG1 Fc (rmuVCAM1-IgGFc, R&D systems). rhuPsel-IgMFc and rhuEsel-IgMFc were produced as supernatants from COS-7 cells. Following COS-7 cell transfection with pCDM8 plasmid containing these contructs, medium was replaced by serum-free XVIVO-10 medium and the cells conditioned for 3 days at 37°C. rhuCD62E-huIgM/Cy5-anti-huIgM complexes were prepared by pre-incubation of HBS (20mM Hepes pH 7.4, 150mM NaCl) + 0.2% BSA + 4mM CaCl2 with Cy5-donkey F(ab)2 anti-human IgM. Cells were detached using Cell Dissociation Fluid (Invitrogen) and stained with recombinant protein complexes for 40 min on ice. Cells were analysed by flow cytometry. For VCAM-1 binding studies, MSC were harvested non-enzymatically (Cell Dissociation Fluid, Gibco) and incubated in DMEM/1% BSA in the presence of 10 μg/ml purified rmuVCAM1-IgGFc or human IgG together with PE-labelled anti-human IgG Fcγ at 5 μg/ml (eBioscience) for 30 minutes at room temperature. Cells were washed once prior to analysis by flow cytometry. Binding of VCAM-1 was also assessed using magnetic protein G-coupled Dynal beads that were pre-incubated with either rmuVCAM1-IgG Fcγ or negative control human IgG. The constructs were incubated with MSC at room temperature for 30 minutes and washed with DMEM. Negative controls were incubated in the presence of EDTA as both selectin-mediated and integrin-mediated interactions are strictly calcium- or magnesium-dependent. KG1a, a human promyelocytic cell line expressing high levels of VLA-4 and functional selectin receptors was used as a positive control for the binding of P-selectin, E-selectin and VCAM-1 chimeras.

CTCATGGGTGAACAGGAAGT CAAGAGTCTCTGTCACCTGC AGATGCTTGCTCCGCTCACAG CATGGAGATCATGATCCATG CAAAGAATTCCTGGAAGGTG TCGCTGCCTTGGGTGTTGTAT CCAGGACCACCCCATTGTAG CACGTTGAATGGGACCCAG CAGAGGGAGAGTGCTCCTGAG CTCTCCAAGGTCATTCATGC TCTGTGACTTGGATGGCGA GCCCGGCCGATGTTGTTG ACTTAGGCAGGAGGTCTTAG TCACAAGCCCGAGTAGGAGG GGCCCTTGGAGTGTGACAGC GCAAAGGGCAAGATGAAGACC GAAAGCTGGTCATGGCATAGTA TGTGCATTGGGTCCATCA

After washing, cells were resuspended in DMEM/1% FCS at 2 × 106/ml and 100 μl added in the upper chamber of transwells (8 μm pore size). Recombinant CXCL12 (SDF-1α) (R&D) was added to the lower chamber wells in DMEM/1% FCS at 50 ng/ml. Cells that transmigrated into the lower chamber were counted using a phase contrast microscope.

Expression of glycosyl transferase enzymes using RT-PCR The primers used were as follows: Core 2 glucosaminyl transferase 1 (beta-1,6-N-acetylglucosaminyltransferase, C2GnT): (5’) – GACCTCAACTGCATGAGGA, (3’) – CACATCCAAACACTGGATGG. Beta 1,4- galactosyl transferase 1 (B4GalT): (5’) – GCACCTTGGCGTCACCCTCG, (3’) – ATGATGGCCACCTTGTGAG. Fucosyl transferase 4 (FuT4): (5’) -GAGAGGCTCAGGCCGTGCTT, (3’) – AGGAGCCCAATTTCGGGCAC, Fucosyl transferase 7 (FuT7): (5’) – TCCGAGGCATCTTCAACTGG, (3’) GGTATCGGCTCTCATTCATG.

Institutional review board approval All experiments described here were approved by the Human Research Ethics Committee of Mater Health Services, Brisbane.

Results

Chemotaxis assay

Comparison of bone marrow-derived and placenta-derived human MSC using light microscopy, mesodermal differentiation capacity, and cell surface phenotype

Placental or bone marrow derived MSC were detached from flasks using Cell Dissociation Buffer (Invitrogen).

MSC derived from bone marrow or placenta had a similar light microscopic appearance and a similar capacity

933

MCS TRACKING MECHANISMS for differentiation into osteogenic and chondrogenic lineages. Adipogenic differentiation was less marked in hpMSC compared to hbmMSC (Barlow et al). hbmMSC and hpMSC were of similar size, ranging from approximately 30 microns in diameter to over 100 microns (Barlow et al., 2008, In press), and expressed a similar cell surface phenotype - (positive for CD73, CD90, CD105 and MHC I and negative for CD14, CD34, CD45 and MHC class II (Barlow et al., 2008, In press). These results are in general typical of those described previously for human MSC.

Molecular trafficking mechanisms MSC express some, but not all, molecules known to be involved in adhesion to endothelium Both hbmMSC and hpMSC at passage 3 (staining was equivalent at passages 4 and 5, data not shown), showed staining of equivalent intensity for CD29 (integrin-β1), CD44 (hyaluronic acid receptor) and CD166 (ALCAM) (Fig. 2). hpMSC showed more intense expression of CD49d (integrin- α4) and less intense expression of CD54 (ICAM-1) than hbmMSC. Both hbmMSC and hpMSC were negative for cell surface expression of CD11a/18 (LFA-1), CD31 (PECAM-1), CD50 (ICAM-3), CD102 (ICAM-2), and CD106 (VCAM-1). Messenger (m) RNA for the following adhesion molecules was detected in both hbmMSC and hpMSC by microarray (Table 2): CD54 (ICAM-1), CD324 (E-Cadherin), CD166 (ALCAM), CD56 (NCAM), CD106 (VCAM-1), CD49a (integrin α1), CD49b (integrin α2), CD49c (integrin α3), CD49e (integrin α5), CD49f (integrin α6), integrin α11, CD51 (integrin αV), and CD29 (integrin- β1), CD18 (integrin β2) , CD104 (integrin β4) , integrin β5, integrin β7, and integrin β8. It was noted that VCAM-1, and CD18 were detectable by GEarray, but not flow cytometry. The reasons for this are unclear to us, but could be due to regulation at the mRNA level preventing protein expression, or regulation of protein access to the outer membrane. For instance, LFA-1 is a heterodimer of both CD11a and CD18 and both would be required for surface expression (CD11a was not detectable at the mRNA level).

MSC demonstrate functional binding to VCAM-1 Using recombinant rmuVCAM1-IgG Fcγ which binds to human integrin α4, we showed that hpMSC but not hmbMSC were able to functionally bind VCAM-1 (Fig. 3A), which is

CD11a/ CD18 CD49e

CD166

CD29

CD31

CD50

CD54

PSGL1

sLex

00 101 102 103 104 00 101 102 103 104 00 101 102 103

CD44

CD102

104

consistent with the fact that hpMSC express a much higher level of the VCAM-1 ligand VLA-4 (CD49d) (Fig 2). Binding of VCAM-1 was also only detected on hpMSC using a highavidity system of protein G-coupled Dynal beads bound to rmuVCAM1-IgG Fc (Fig. 3B-D).

MSC do not display molecules involved in selectin-mediated tethering to endothelium Neither hbmMSC nor hpMSC expressed the selectin receptor PSGL-1 (CD162). Staining for the carbohydrate epitope sLeX which is required for selectin binding was also negative (Fig. 2). Accordingly, both hbmMSC and hpMSC were unable to bind to the P- and E-selectin-IgM chimeras, unlike KG1a cells which express both PSGL-1 and sLex (Fig. 3 – see below). Additionally, neither hbmMSC nor hpMSC expressed mRNA for E-selectin, P-selectin, or L-selectin (Table 2). Interestingly, MSC expressed high levels of CD44 (Fig. 2), a transmembrane protein which, once fucosylated by α(1,3)fucosyl transferases, can serve as E-selectin receptor (36). However, we found that neither human hpMSC nor hbmMSC express FuT IV or FuT VII transferases required to confer selectin binding to PSGL-1 and/or CD44 (see below - Fig. 4).

MSC express a restricted range of fucosylation enzymes In order to determine if the lack of expression of sLex was due to lack of glycosyltransferases necessary to the formation of this carbohydrate, we analysed MSC for expression of core 2 glucosaminyltransferase 1 (C2GnT), β1,4-galactosyltransferase 1 (B4GALT), fucosyl transferase 4 (FuT4) and fucosyl transferase 7 (FuT7) (Fig. 4). While both hbmMSC and hpMSC expressed detectable levels of C2GnT and B4GALT mRNA, no signal was detected in either MSC type for FuT4 or FuT7 mRNA.

MSC express a restricted range of chemokine receptors mRNA MSC cDNA was initially screened on GEarrays for chemokine receptors (Table 3) and subsequently evaluated by RT-PCR (Fig. 5). Both hbmMSC and hpMSC expressed mRNA for CCR7, CCR8, CCR10, CCR11, CXCR4 and CXCR6. We could not detect mRNA for CCR2, CCR4, CCR5, CCR6,

CD49d

CD106

Placenta BM Isotype Control

FIG. 2. Cell surface expression of adhesion molecules by human hbmMSC and hpMSC at third passage. CD11a/CD18 (leukocyte function molecule-1; LFA-1), CD29 (integrin- β1), CD31 (PECAM), CD44 (hyaluronic acid receptor), CD49d (integrin- α4); CD50 (ICAM-3), CD54 (ICAM-1), CD102 (ICAM-2) CD106 (VCAM-1), CD166 (ALCAM); PSGL-1 (Pselectin glycoprotein ligand-1); sLex (sialyl Lewis x, CD15).

934

BROOKE ET AL.

Table 2. Adhesion Molecule Expression by Human bmMSC and pMSC as Determined by Microarray Adhesion molecule ICAM-1 E-selectin P-selectin L-selectin integrin αL LFA-3 E-Cadherin VE-Cadherin PECAM-1 ALCAM NCAM VCAM integrin α1 integrin α2 integrin α3 integrin α4 integrin α5 integrin α6 integrin α11 integrin αM integrin αV integrin αX integrin β1 integrin β2 integrin β3 integrin β4 integrin β5 integrin β6 integrin β7 integrin β8

CD54 CD62E CD62P CD62L CD11a CD58 CD324 CD144 CD31 CD166 CD56 CD106 CD34 CD44 CD49a CD49b CD49c CD49d CD49e CD49f CD11b CD51 CD11c CD29 CD18 CD61 CD104

hbmMSC

hpMSC

+ − − − − − + − − + + + − + + + + − + + + − + + + + − + + − + +

+ − − − − − + − − + + + − + + + + + + + + − + + + + − + + − + +

CCR9, CXCR1, CXCR2, CXCR3, CXCR5 or CX3CR1 in either hpMSC nor hbmMSC. Thus, the chemokine receptor expression profile at the mRNA level was similar for hpMSC and hbmMSC.

A rhuEsel-lgMFc rhuPsel-lgMFc rhuVCAM1-lgGFc KG1a

hpMSC

hbmMSC

B

C

D

FIG. 3. Functional binding of human MSC to recombinant chimeric constructs. (A) Flow cytometry analysis of functional binding by recombinant chimeric constructs to human hpMSC and hbmMSC (at 4th passage) and a positive control cell line (KG1a) with E-selectin (rhuEsel-IgMFc), P-selectin (rhuPsel-IgMFc) and of VCAM-1 (rmuVCAM1-IgGFc). Black histograms represent chimeric protein binding, grey histograms represent chimeric protein binding in the presence of EDTA (E- and P-selectin) or control IgG (VCAM1). (B–D) Photomicrographs of MSC incubated with protein G Dynal beads coated with rmuVCAM1-IgGFc on hpMSC (B), hbmMSC (C) or control IgG (D). Size bar represents 50 μm.

is the fact that we could detect no cell surface expression of CXCR4. We were unable to detect a differential display of chemokine receptors on the basis of size of human hbmMSC or hpMSC (data not shown). Data on chemokine receptor mRNA expression, intracellular protein expression and cell surface protein expression are summarised in Table 4.

MSC migrate in response to CXCL12 (SDF-1) Intracellular chemokine receptor expression Both hbmMSC and hpMSC demonstrated intracellular expression of CCR1, CCR3, CXCR3, CXCR4 and CXCR6 when analysed by flow cytometry (Figs. 6A and 6B), and by immunofluorescence (Figs 7A and 7B). Thus, the chemokine receptor expression profile at the intracellular protein level was similar for hpMSC and hbmMSC.

In order to determine whether intracellular CXCR4 could be transiently expressed at the cell surface and signal in the presence of its ligand CXCL12, we measured MSC migration in response to CXCL12. We found that, in spite of lack of detectable cell surface CXCR4 expression, MSC were responsive to the chemotactic effect of CXCL12 (Fig. 9) suggesting that in the presence of its ligand, a proportion of intracellular CXCR4 can be exported to the cell surface and signal.

Cell surface expression of chemokine receptors In contrast to intracellular chemokine receptor expression, expression on the cell surface was relatively restricted for both hbmMSC and hpMSC (Figs. 8 A and 8B). hbmMSC and hpMSC showed weak expression of CCR1, CCR8 and CCR11, with only CXCR6 displaying a strong signal. Of note

Discussion MSC are key candidates for the repair and regeneration of a variety of organs and tissues. Although bone marrow has been the traditional source, MSC can be isolated from a wide range of tissue sources including placenta (1–5). In order to

935

MCS TRACKING MECHANISMS C2GnT p bm – + – +

B4GalT

FuT4

FuT7 bm +ve p bm +ve p bm +ve p – + – + – + – + – + – +

FIG. 4. Glycosyl transferase gene expression on hbmMSC and hpMSC. C2GnT: core-2 glucose aminyl (N-acetyl) transferase transferase-1; B4GALT: beta 1,4-galactosyl transferase, +ve indicates positive control (human peripheral blood mononuclear cells), −/+ refers to presence or absence of reverse transcriptase in preparation of cDNA.

contribute to tissue repair, these cells must have the ability to home to damaged tissue, persist and interact. To gain insight into homing mechanisms used by human hbmMSC and to see if MSC isolated from an alternative source (placenta) are equivalent, we have explored and compared the repertoire of cell adhesion molecules, chemokine and chemokine receptors expressed by these cells. We have shown that at least in the instance of VLA-4 – VCAM-1 binding, hpMSC are superior to hbMSC. This may have important implications for the migratory properties of these cells in vivo. In normal animals, intravenously injected MSC of bone marrow origin may home to the bone marrow (32, 33). Additionally, MSC appear to home preferentially to sites of inflammation (34, 35). The molecular homing signals used by mesenchymal stem cells have not yet been completely defined, but initial studies indicate that a range of chemokine receptors and their ligands may be involved (29–31). A full understanding of these molecular mechanisms might give clues on how to improve homing efficiency and engraftment, or conversely (by analogy with HSC which are easily mobilized) pave the way to therapeutic strategies to mobilise MSC into the blood. We used the well-described homing paradigm of HSC as a model (Fig.1). Chemotaxis in response to chemokines such as CXCL12, and β1-integrin-mediated firm adhesion to VCAM-1 and ECM components are two of the three essential steps involved in HSC homing.

CCR1 bm – +

CCR3

p – +

bm p – + – +

CXCR4 bm – +

CCR7

p – +

bm p – + – +

Table 3. Expression of Chemokine Receptor mRNAs by Human bmMSC and pMSC as Determined by Microarray Chemokine receptor

hbmMSC

hpMSC

− − − − + − − + − +

+ − + − − − − + − +

+ − − − − − − −

+ − − − − − − −

CCR1 CCR2 CCR3 CCR4 CCR5 CCR6 CCR7 CCR8 CCR9 CCR10 CCRL1 (CCR11) CXCR1 CXCR2 CXCR3 CXCR4 CXCR5 CXCR6 CX3CR1

In preliminary studies we found that hbmMSC and hpMSC are comparable with regard to light microscopic appearance, size, cell surface phenotype and mesodermal differentiation potential (Barlow et al., 2008, In press). Additionally, they seem to exhibit an equivalent degree of immune suppressive capacity (36, 37). These MSC were not uniform in terms of size. The diameter of hbmMSC and hpMSC determined by cytospin was 20–40 μm indicating that MSC have a diameter at least four times that of a lymphocyte. Adherent cells are generally 50–150 μm across (Fig. 3B–D). The initial rolling and tethering of HSC and leucocytes to marrow endothelium and inflamed vasculature is mediated by interactions between carbohydrate epitopes on glycoproteins expressed on the HSC/leukocyte surface and selectins

CCR8 bm – +

CCR10 p

–

+

bm – +

p – +

CCR11 –

bm +

p – +

CXCR6 bm – +

p – +

FIG. 5. Expression of chemokine receptor mRNA by hbmMSC and hpMSC. −/+ refers to presence or absence of reverse transcriptase in preparation of cDNA.

936

BROOKE ET AL. A

CCR1

CXCR3

CCR3

CCR5

CXCR4

CXCR6

CCR8

CCR10

CCR11

CCR10

CCR11

B

CCR1

CXCR3

CCR3

CCR5

CXCR4

CXCR6

CCR8

FIG. 6. Intracellular expression of chemokine receptors by (A) hpMSC and (B) hbmMSC as determined by flow cytometry of fixed permeabilised cells.

expressed on marrow endothelium (22). Physiological selectin receptors are mucin-type glycoproteins decorated with sialylated, fucosylated, core-2 O-glucosaminoglycan chains which are presumed to interact with the C-type lectin domain of the selectins (for example PSGL-1, CD34, CD44, GlyCAM-1 (25, 38). PSGL-1 (CD162) is a well characterised receptor for L-, E- and P-selectin, expressed on HSC, mature myeloid cells and discrete populations of T cells. Although most haematopoietic cells express PSGL-1, they cannot adhere to selectins without the co-expression of five different types of glycosyl-transferases required to generate the sialyl Lewisx (sLex) core-2 O-glycans. These include core 2 β1–6-N-glucosaminyl-transferase I (C2GlcNAcT-I), β-1,4galactosyltransferase I (β-1,4-GalT-I), α(1,3) fucosyltransferase (FuT) -VII and -IV and 6 different β-galactoside α(2–3) sialyltransferase (ST3Gal). In particular, FuT-VII is absolutely essential to generate functional selectin receptors as homozygous deletions in this fucosyltransferase inactivate most P- and E-selectin receptors, resulting in neutrophilia, as well as increased leukocyte velocity on tumour necrosis factor (TNF)- α-activated endothelium (39) even though they express PSGL-1. Moreover the expression of these enzymes is tightly regulated. For instance, naïve T cells do not express FuT-VII, and consequently do not bind selectins despite the expression of PSGL-1 (40). However upon activation, the ability to bind selectins is acquired by inducing FuT-VII expression (38). Therefore we felt that an analysis of glycosyl-transferase expression by MSC was important in assessing their binding specificities. Neither hbmMSC nor hpMSC expressed PSGL-1 nor the carbohydrate determinant sLex (Fig. 2). This resulted in their inability to functionally bind E-selectin or

P-selectin using recombinant constructs of these molecules (Fig. 3). Furthermore, MSC did not express the transferases necessary for sLex, with no detectable expression of fucosyl transferases IV or VII (Fig. 4). Thus, MSC do not utilise E- or P-selectins as a tethering mechanism. If they use a tethering mechanism, its nature remains to be determined. It is possible that, as with metastasis by tumour cells, high expression of CD44 and VLA-4 is sufficient (41). It should also be remembered that human hbmMSC and hpMSC are large cells and this may cause the cells to be held up in capillary beds, especially those of the lungs and liver (42). This, in combination with high CD44 and VLA-4 levels, may be enough to allow MSC sufficient arrest at sites of inflammation. Moreover, tissue damage due to ischaemia can also lead to loss of endothelial cell integrity and subsequent exposure of the underlying ECM. It is therefore possible that MSC can adhere directly to components of the ECM, such as collagen, fibronectin and laminin using β1 integrins. Since previous studies in FuT-VII−/− mice (39), and mice knocked-out for both P-selectin and E-selectin (23, 24) have shown that the lack of selectin-mediated interactions severely impaired the efficiency of HSC homing to the bone marrow and leukocyte migration into inflamed tissue, MSC homing might be limited by their inability to interact with selectins. It should be noted, however, that a recent study (43) concluded that human MSC adhere to human umbilical vein endothelial cells by a mechanism that appeared to be selectin-dependent, although, like our study, this study also found lack of expression of PSGL-1 by MSC. While MSC did not express receptors for, and were unable to bind, selectins, they did express an array of other

937

MCS TRACKING MECHANISMS

FIG. 7. Cytoplasmic localisation of chemokine receptors by (A) hpMSC and (B) hbmMSC (immunofluorescence).

adhesion molecules, including α and β integrin chains (CD29, integrin-β1; CD49d, integrin- α4), CD44 (hyaluronic acid receptor), CD54 (ICAM-1) and CD166 (ALCAM), in agreement with previous studies (2). In contrast to the lack of binding to selectins, we demonstrated functional binding of hpMSC to CD106 (VCAM-1) (using both recombinant contructs and Protein G-coated beads), presumably through integrin α4β1 (VLA-4). This therefore constitutes at least one potential mechanism by which MSC adhere to endothelium. Both hbmMSC and hpMSC failed to show cell surface expression of integrin αLβ2 (CD11a/18 or LFA-1), CD31 (PECAM-1), CD49e (integrin-α5), CD50 (ICAM-3) and CD102 (ICAM-2). Thus, hbmMSC and hpMSC had an almost identical profile for cell surface adhesion molecules at the mRNA and protein levels. Of note, the lack of CD31 expression confirmed the lack of endothelial cells in our MSC preparations. The next step in HSC homing after tethering to, rolling along, and adhering to the marrow endothelial surface is migration through the endothelium, and this is mediated via chemokine receptor expression and migration along a chemokine gradient through the endothelium and into the marrow extracellular matrix. Cell surface expression of CXCR4 has been described on a minority of human hbmMSC (29, 30) and MSC have been shown to migrate in vitro in response to a gradient of CXCL12, the ligand for

CXCR4 by some (29, 30), but not others (44). Presumably this occurred because of at least transient (and by us undetectable) cell surface expression of CXCR4. We could, however, detect mRNA by RT-PCR for this receptor in both hbmMSC and hpMSC (Fig. 5), and while we were unable to detect cell surface expression of the protein, we did detect the intracellular presence of CXCR4 (Figs. 6 and 7). Furthermore, we confirmed the migration of human MSC in response to a CXCL12 gradient (Fig. 9). Wynn et al (29) were able to detect cell surface CXCR4 in less than 1% of the majority of ex vivo expanded human hbmMSC examined, although they did find it in a majority of cells intracellularly. In contrast, Sordi et al (30) described CXCR4 expression on up to 25% of ex vivo expanded human hbmMSC. Despite this disparity, all three studies demonstrated chemotaxis by human MSC in response to CXCL12. We also detected mRNA (using RT-PCR) for CCR1 and CCR3 on hpMSC, but not hbmMSC, and CCR7, CCR8, CCR10, CCR11, and CXCR6 on both hbmMSC and hpMSC (Fig. 5). We could not detect mRNA for CCR2, CCR4, CCR5, CCR6, CCR9, CXCR1, CXCR2, CXCR3, CXCR5 or CX3CR1. Sordi et al (30) also described multiplicity in human bone marrow-derived chemokine receptor repertoire display, with a minority (2–25%) expressing CCR1, CCR7, CXCR4, CXCR6 (as in our study), as well as CX3CR1 (unlike our study). Others have shown expression of CCR1, CCR4, CCR7,

938

BROOKE ET AL. A

CCR1

CCR3

CCR5

CXCR3

CXCR4

CXCR6

CCR3

CCR5

CXCR4

CXCR6

CCR8

CCR10

CCR11

CCR10

CCR11

B

CCR1

CXCR3

CCR8

FIG. 8. Cell surface expression of chemokine receptors by (A) hpMSC and (B) hbmMSC.

CCR10 and CXCR5 (44). The reason for these disparities may relate to differences in PCR technology (e.g. cycle number) or differences in passage number: we examined MSC at passages 3–6. The exact passage number at which the cells were analysed was not stated in Sordi’s study (30). Honczarenko and colleagues (31) found second passage human marrowderived MSC to express CCR1, CCR7, CXCR4, CXCR6 (as in our and Sordi’s studies), as well as CCR9 and CXCR5. Interestingly, this group also found decreased chemokine receptor expression and decreased chemotactic response to chemokines with later (12–16) passage cells.

Furthermore, different chemokine receptor display may be utilised by different organs and in different clinical settings. The pattern of chemokine expression by acutely inflamed or infarcted organs, and thus subsequent interaction with MSC chemokine receptors, may be quite different from that of non-inflamed tissue.

Summary and Conclusions In summary, hpMSC and hbmMSC showed a similar pattern of adhesion molecule and chemokine receptor display,

Table 4. Expression of Chemokine Receptor mRNA, Intracellular Protein, and Cell Surface Protein by hbmMSC and hpMSC mRNA Chemokine receptor CCR1 CCR3 CCR5 CCR7 CCR8 CCR10 CCR11 CXCR3 CXCR4 CXCR6

Intracellular protein

Cell surface protein

hbmMSC

hpMSC

hbmMSC

hpMSC

hbmMSC

hpMSC

− − +/− + + + + ND + +

+ + − + + + + ND + +

+/− + − ND − − − + + +

+ + − ND − +/− − + + +

+/− − − ND +/− − +/− − − +

+/− +/− − ND +/− − + +/− − +

−, not detected; +/−, detected; +, strong expression; ND, not done.

939

MCS TRACKING MECHANISMS 70

No. Cells Migrated to Lower Well

60 50 40 30 20 10 0

BSA

Vn

Fn

FIG. 9. Migration of hpMSC in response to CXCL12 (black bar) or saline (white bar). Wells were coated with either bovine serum albumin (BSA), vitronectin (Vn), or fibronectin (Fn).

the major difference being much weaker expression of VLA-4 on hbmMSC. They expressed a similar intracellular chemokine receptor expression pattern, although the intensity of expression for CCR1 and CXCR6 was lower in hpMSC than hbmMSC. Both hbmMSC and hpMSC showed little cell surface expression of chemokine receptors and we could not detect significant differences in chemokine receptor expression on the basis of MSC size (data not shown). The protein data were corroborated by the RT-PCR findings. This is the first study comparing potential molecular homing mechanisms of human bone marrow with human placental MSC. We found human hbmMSC and hpMSC to be similar in most respects examined, including absence of selectin expression, absence of fucosyltransferase expression, adhesion molecule expression, lack of functional binding to E-and P-selectins, chemokine receptor expression and chemokine-mediated chemotaxis. The only major difference seen was in ability to bind to VCAM-1, which hbmMSC lacked. Therefore, hpMSC may represent a suitable, more readily accessible and possibly preferential alternative to bone marrow as a source of MSC for clinical trials.

Acknowledgments Supported by grants from the Mater Foundation and the Australian Stem Cell Centre. We would like to thank Rebecca Pelekanos for assistance in preparation of this manuscript.

References 1. Pittenger MF, AM Mackay, SC Beck, RK Jaiswal, R Douglas, JD Mosca, MA Moorman, DW Simonetti, S Craig and DR Marshak. (1999). Multilineage potential of adult human mesenchymal stem cells. Science 284:143–147. 2. Deans RJ and AB Moseley. (2000). Mesenchymal stem cells: biology and potential clinical uses. Exp Hematol 28:875–884. 3. In ‘t Anker PS, SA Scherjon, C Kleijburg-van der Keur, GM de Groot-Swings, FH Claas, WE Fibbe and HH Kanhai. (2004). Isolation of mesenchymal stem cells of fetal or maternal origin from human placenta. Stem Cells 22:1338–1345.

4. Katz AJ, A Tholpady, SS Tholpady, H Shang and RC Ogle. (2005). Cell surface and transcriptional characterization of human adipose-derived adherent stromal (hADAS) cells. Stem Cells 23:412–423. 5. Yen BL, HI Huang, CC Chien, HY Jui, BS Ko, M Yao, CT Shun, ML Yen, MC Lee and YC Chen. (2005). Isolation of multipotent cells from human term placenta. Stem Cells 23:3–9. 6. Lee OK, TK Kuo, WM Chen, KD Lee, SL Hsieh and TH Chen. (2004). Isolation of multipotent mesenchymal stem cells from umbilical cord blood. Blood 103:1669–1675. 7. Jiang Y, BN Jahagirdar, RL Reinhardt, RE Schwartz, CD Keene, XR Ortiz-Gonzalez, M Reyes, T Lenvik, T Lund, M Blackstad, J Du, S Aldrich, A Lisberg, WC Low, DA Largaespada and CM Verfaillie. (2002). Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418:41–49. 8. Noort WA, AB Kruisselbrink, PS in’t Anker, M Kruger, RL van Bezooijen, RA de Paus, MHM Heemskerk, CWGM Löwik, JHF Falkenburg, R Willemze and WE Fibbe. (2002). Mesenchymal stem cells promote engraftment of human umbilical cord blood–derived CD34+ cells in NOD/SCID mice. Experimental Hematology 30:870–878. 9. Javazon E, J Tebbets, K Beggs, M Sena-Esteves, C Campagnoli, A Radu and A Flake. (2003). Isolation, expansion and characterisation of murine adult bone marrow derived mesenchymal stem cells. Blood 102:180B–181B. 10. Peister A, JA Mellad, BL Larson, BM Hall, LF Gibson and DJ Prockop. (2004). Adult stem cells from bone marrow (MSCs) isolated from different strains of inbred mice vary in surface epitopes, rates of proliferation, and differentiation potential. Blood 103:1662–1668. 11. Woodbury D, K Reynolds and IB Black. (2002). Adult bone marrow stromal stem cells express germline, ectodermal, endodermal, and mesodermal genes prior to neurogenesis. J Neurosci Res 69:908–917. 12. Zhao L-R, W-M Duan, M Reyes, CD Keene, CM Verfaillie and WC Low. (2002). Human Bone Marrow Stem Cells Exhibit Neural Phenotypes and Ameliorate Neurological Deficits after Grafting into the Ischemic Brain of Rats. Experimental Neurology 174:11–20. 13. Orlic D, J Kajstura, S Chimenti, F Limana, I Jakoniuk, F Quaini, B Nadal-Ginard, DM Bodine, A Leri and P Anversa. (2001). Mobilized bone marrow cells repair the infarcted heart, improving function and survival. Proceedings of the National Academy of Sciences of the United States of America 98:10344–10349. 14. Fang B, M Shi, L Liao, S Yang, Y Liu and RC Zhao. (2004). Systemic infusion of FLK1(+) mesenchymal stem cells ameliorate carbon tetrachloride-induced liver fibrosis in mice. Transplantation 78:83–88. 15. Murphy JM, DJ Fink, EB Hunziker and FP Barry. (2003). Stem cell therapy in a caprine model of osteoarthritis. Arthritis Rheum 48:3464–3474. 16. Le Blanc K. (2003). Immunomodulatory effects of fetal and adult mesenchymal stemcells. Cytotherapy 5:485–489. 17. Devine SM, C Cobbs, M Jennings, A Bartholomew and R Hoffman. (2003). Mesenchymal stem cells distribute to a wide range of tissues following systemic infusion into nonhuman primates. Blood 101:2999–3001. 18. Meisel R, A Zibert, M Laryea, U Gobel, W Daubener and D Dilloo. (2004). Human bone marrow stromal cells inhibit allogeneic T-cell responses by indoleamine 2,3-dioxygenasemediated tryptophan degradation. Blood 103:4619–4621. 19. Aggarwal S and MF Pittenger. (2005). Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 105:1815–1822. 20. Ringden O, M Uzunel, I Rasmusson, M Remberger, B Sundberg, H Lonnies, HU Marschall, A Dlugosz, A Szakos, Z Hassan,

940

21.

22.

23.

24.

25. 26.

27.

28.

29.

30.

31.

32.

33.

B Omazic, J Aschan, L Barkholt and K Le Blanc. (2006). Mesenchymal stem cells for treatment of therapy-resistant graft-versus-host disease. Transplantation 81:1390–1397. Papayannopoulou T. (2003). Bone marrow homing: the players, the playfield, and their evolving roles. Current opinion in hematology 10:214–219. Schweitzer KM, AM Drager, P van der Valk, SF Thijsen, A Zevenbergen, AP Theijsmeijer, CE van der Schoot and MM Langenhuijsen. (1996). Constitutive expression of E-selectin and vascular cell adhesion molecule-1 on endothelial cells of hematopoietic tissues. The American journal of pathology 148:165–175. Frenette PS, S Subbarao, IB Mazo, UH von Andrian and DD Wagner. (1998). Endothelial selectins and vascular cell adhesion molecule-1 promote hematopoietic progenitor homing to bone marrow. Proc Natl Acad Sci U S A 95:14423–14428. Mazo IB, JC Gutierrez-Ramos, PS Frenette, RO Hynes, DD Wagner and UH von Andrian. (1998). Hematopoietic progenitor cell rolling in bone marrow microvessels: parallel contributions by endothelial selectins and vascular cell adhesion molecule 1. The Journal of experimental medicine 188:465–474. Kansas GS. (1996). Selectins and their ligands: current concepts and controversies. Blood 88:3259–3287. Middleton J, AM Patterson, L Gardner, C Schmutz and BA Ashton. (2002). Leukocyte extravasation: chemokine transport and presentation by the endothelium. Blood 100:3853–3860. Peled A, O Kollet, T Ponomaryov, I Petit, S Franitza, V Grabovsky, MM Slav, A Nagler, O Lider, R Alon, D Zipori and T Lapidot. (2000). The chemokine SDF-1 activates the integrins LFA-1, VLA-4, and VLA-5 on immature human CD34(+) cells: role in transendothelial/stromal migration and engraftment of NOD/ SCID mice. Blood 95:3289–3296. Campbell DJ, CH Kim and EC Butcher. (2003). Chemokines in the systemic organization of immunity. Immunological reviews 195:58–71. Wynn RF, CA Hart, C Corradi-Perini, L O’Neill, CA Evans, JE Wraith, LJ Fairbairn and I Bellantuono. (2004). A small proportion of mesenchymal stem cells strongly express functionally active CXCR4 receptor capable of promoting migration to bone marrow. Blood. Sordi V, ML Malosio, F Marchesi, A Mercalli, R Melzi, T Giordano, N Belmonte, G Ferrari, BE Leone, F Bertuzzi, G Zerbini, P Allavena, E Bonifacio and L Piemonti. (2005). Bone marrow mesenchymal stem cells express a restricted set of functionally active chemokine receptors capable of promoting migration to pancreatic islets. Blood 106:419–427. Honczarenko M, Y Le, M Swierkowski, I Ghiran, AM Glodek and LE Silberstein. (2006). Human bone marrow stromal cells express a distinct set of biologically functional chemokine receptors. Stem Cells 24:1030–1041. Devine SM, AM Bartholomew, N Mahmud, M Nelson, S Patil, W Hardy, C Sturgeon, T Hewett, T Chung, W Stock, D Sher, S Weissman, K Ferrer, J Mosca, R Deans, A Moseley and R Hoffman. (2001). Mesenchymal stem cells are capable of homing to the bone marrow of non-human primates following systemic infusion. Exp Hematol 29:244–255. Bensidhoum M, A Chapel, S Francois, C Demarquay, C Mazurier, L Fouillard, S Bouchet, JM Bertho, P Gourmelon, J Aigueperse, P Charbord, NC Gorin, D Thierry and M Lopez. (2004). Homing of in vitro expanded Stro-1- or Stro-1+ human mesenchymal stem cells into the NOD/SCID mouse and their role in supporting human CD34 cell engraftment. Blood 103:3313–3319.

BROOKE ET AL. 34. Chapel A, JM Bertho, M Bensidhoum, L Fouillard, RG Young, J Frick, C Demarquay, F Cuvelier, E Mathieu, F Trompier, N Dudoignon, C Germain, C Mazurier, J Aigueperse, J Borneman, NC Gorin, P Gourmelon and D Thierry. (2003). Mesenchymal stem cells home to injured tissues when co-infused with hematopoietic cells to treat a radiation-induced multiorgan failure syndrome. J Gene Med 5:1028–1038. 35. Ortiz LA, F Gambelli, C McBride, D Gaupp, M Baddoo, N Kaminski and DG Phinney. (2003). Mesenchymal stem cell engraftment in lung is enhanced in response to bleomycin exposure and ameliorates its fibrotic effects. Proc Natl Acad Sci U S A 100:8407–8411. 36. Chang CJ, ML Yen, YC Chen, CC Chien, HI Huang, CH Bai and BL Yen. (2006). Placenta-derived multipotent cells exhibit immunosuppressive properties that are enhanced in the presence of interferon-gamma. Stem Cells 24:2466–2477. 37. Jones BL, G Brooke, K Atkinson and SJ McTaggart. (2007). Immunosuppression by placental indoleamine 2,3-dioxygenase: a role for mesenchymal stem cells. Placenta in press. 38. Lowe JB. (2002). Glycosyltransferases and glycan structures contributing to the adhesive activities of L-, E- and P-selectin counter-receptors. Biochemical Society symposium:33–45. 39. Maly P, A Thall, B Petryniak, CE Rogers, PL Smith, RM Marks, RJ Kelly, KM Gersten, G Cheng, TL Saunders, SA Camper, RT Camphausen, FX Sullivan, Y Isogai, O Hindsgaul, UH von Andrian and JB Lowe. (1996). The alpha(1,3)fucosyltransferase Fuc-TVII controls leukocyte trafficking through an essential role in L-, E-, and P-selectin ligand biosynthesis. Cell 86:643–653. 40. Borges E, G Pendl, R Eytner, M Steegmaier, O Zollner and D Vestweber. (1997). The binding of T cell-expressed P-selectin glycoprotein ligand-1 to E- and P-selectin is differentially regulated. J Biol Chem 272:28786–28792. 41. Weber GF, RT Bronson, J Ilagan, H Cantor, R Schmits and TW Mak. (2002). Absence of the CD44 gene prevents sarcoma metastasis. Cancer Res 62:2281–2286. 42. Allers C, WD Sierralta, S Neubauer, F Rivera, JJ Minguell and PA Conget. (2004). Dynamic of distribution of human bone marrow-derived mesenchymal stem cells after transplantation into adult unconditioned mice. Transplantation 78:503–508. 43. Ruster B, S Gottig, RJ Ludwig, R Bistrian, S Muller, E Seifried, J Gille and R Henschler. (2006). Mesenchymal stem cells display coordinated rolling and adhesion behavior on endothelial cells. Blood 108:3938–3944. 44. Von Luttichau I, M Notohamiprodjo, A Wechselberger, C Peters, A Henger, C Seliger, R Djafarzadeh, R Huss and PJ Nelson. (2005). Human adult CD34- progenitor cells functionally express the chemokine receptors CCR1, CCR4, CCR7, CXCR5, and CCR10 but not CXCR4. Stem cells and development 14:329–336.

Address reprint requests to: Kerry Atkinson, M.D. Mater Medical Research Institute, Level 3 Aubigny Place, Raymond Terrace South Brisbane QLD 4101 Australia Email: [email protected] Received for publication August 7, 2007; accepted after revision December 18, 2007.