Molecular Typing of Yersinia pestis - Springer Link

ISSN 08914168, Molecular Genetics, Microbiology and Virology, 2013, Vol. 28, No. 2, pp. 41–51. © Allerton Press, Inc., 2013. Original Russian Text © M.E. Platonov, V.V. Evseeva, S.V. Dentovskaya, A.P. Anisimov, 2013, published in Molekulyarnaya Genetika, Mikrobiologiya i Virusologiya, 2013, No. 2, pp. 3–12.

REVIEW

Molecular Typing of Yersinia pestis M. E. Platonov, V. V. Evseeva, S. V. Dentovskaya, and A. P. Anisimov State Research Center of Applied Microbiology and Biotechnology, Obolensk, Russia email: [email protected] Abstract—The present review is focused on methods of Yersinia pestis genotyping that are reproducible in dif ferent laboratories and allow for differentiation of individual bacterial isolates into intraspecies groups corre sponding to subspecies, biovars, and natural foci. A variant of the intraspecies classification of Y. pestis com pliant with the rules of the International Code of Nomenclature of Bacteria is presented. Keywords: molecular typing of Yersinia pestis DOI: 10.3103/S0891416813020067

methods for the study of Y. pestis phylogenesis and epidemiological research.

INTRODUCTION Plague is an extremely dangerous natural focal dis ease transmitted through various pathways. The microbe causing plague, Yersinia pestis, was isolated and described for the first time by A. Yersin in 1894, at the beginning of the third plague pandemic, in Hong Kong [105]. That plague is transmitted through flea bites in rat populations was shown by Ogata in 1897 [82] and by Simond in 1898 [92]. Two other human pathogens of the genus Yersinia—Y. pseudotuberculo sis and Y. enterocolitica—cause diseases of the alimen tary tract accompanied by prolonged excretion of the pathogen with feces and subsequent alimentary infec tion of new hosts [42, 44]. One of these pathogens— Y. pseudotuberculosis—is considered the ancestor of Y. pestis. These bacterial species diverged 15–20 thou sand years ago [35, 36]. Emergence of a new species and subsequent intraspecies variability led to the for mation of a wide range of intraspecies groups of Y. pes tis (biovars, subspecies, ecotypes, proteinovars, plasmi dovars, genotypes, etc.) differing in virulence and in the range of mammals sensitive to them [38, 47, 74, 109]. The plague microbe circulates in populations of more than 200 species of rodents and lagomorphs in natural plague foci and is transmitted by more than 120 spe cies of fleas [38, 52, 84, 96]. The use of a wide range of hosts and vectors by the pathogen ensures the selection of genetic diversity in the genomes of Y. pestis strains circulating in ecosystems of geographically isolated natural plague foci. The highest intraspecies variety of the plaguecausing pathogen was detected in the most ancient Eurasian natural foci of infection character ized by a large diversity of rodent species that are the main (enzootic) hosts of Y. pestis [1, 2, 4, 27, 28, 33, 38, 47, 52, 80, 108–110]. The relative novelty of the plaguecausing microbe, combined with the con finedness of certain intraspecies populations to spe cific natural foci, creates the necessary prerequisites for an assessment of the adequacy of molecular typing

CURRENT STATE OF THE PROBLEM OF PLAGUECAUSING MICROBE TAXONOMY A. Yersin, who was the first to discover the plague causing microbe [105], named it Bacterium pestis. Var ious synonyms—“Bacterium pestis” [73]; “Bacillus pestis” [73]; Migula, 1900, “Pasteurella pestis” [73]; Bergey et al., 1923, nom. cons., Pestisella pestis, Pas teurella pestis, Bacterium pestis, Bacillus pestis, “Pes tisella pestis” [73]; Dorofeev, 1947, Yersinia pseudotu berculosis subsp. pestis, Yersinia pestis [73]; van Loghem, 1944 (Approved Lists 1980); and Yersinia pseudotuberculosis subsp. pestis [73] Bercovier et al. 1981 (http://mousecyc.jax.org/META/NEWIMAGE? type=ORGANISM&object=TAX623&detaillevel =2)—were subsequently used for this microorganism. The taxonomic name Yersinia pestis [73] van Loghem 1944 is universally accepted today (http://zipcodezoo. com/Key/Bacteria/Yersinia_Genus.asp); the genus name Yersinia was suggested by van Loghem [103] to commemorate the name of the researcher who was first to discover the plague microbe [73, 93, 94, 103]. The genus Yersinia of the family Enterobacteriaceae currently includes 17 species [62, 81]. The typical spe cies of the genus Yersinia is Y. pestis [5]. The typical strain of the genus is Y. pestis ATCC 19428 = CIP 80.26 = NCTC 5923 [65]. Devignat [49] and Tumanskii [32] divided Y. pestis into three intraspecies groups according to the ability of the bacteria to ferment glycerol, nitrify, and deni trify. Devignat termed them antiqua, medievalis, and orientalis biovars, since they presumably caused “Jus tinian plague,” “Black Death,” and the third plague pandemia, respectively. Tumanskii used an ecological approach instead of a historicogeographical one and named the same Y. pestis varieties marmot (var. mar 41

42

PLATONOV et al.

motae), ground squirrel (var. citelli), and rat (var. ratti) varieties, respectively. Devignat’s classification is cur rently widely used for intraspecies distinction of the plague microbe, notwithstanding the existence of Y. pestis isolates which cannot be assigned to any of the biovars suggested [37, 38]. It should be noted that bio var characteristics are unstable. Some strains can undergo spontaneous phenotypic variation and there fore be referred to other biovars [10, 11]. Moreover, strains considered identical after most laboratory tests but belonging to different biovars can circulate within one rodent population [11, 22, 26, 38]. As new natural foci of plague were identified in Eurasia, it became clear that Y. pestis strains circulat ing in these sites can differ from the three ecogeo graphic varieties described above with regard to a range of additional phenotypic features. Differentiating characteristics for these intraspecies groups include nitrate reduction and ammonium oxidation, fermenta tion of certain sugars (rhamnose, arabinose, melibiose, melecytose, maltose, mannose, and trehalose), pesti cin–fibrinolysin–plasmocoagulase activity, a need for additional growth factors, sensitivity to pesticin, and varying virulence for mice and guinea pigs [1, 38, 109]. The virulence of the members of different phyloge netic groups of Y. pestis for various hosts, including human beings, is the main differentiating criterion [16–18, 21, 30]. Martinevskii [17] concluded that strains isolated from common voles in the mountainous regions of the Caucasus or from Mongolian pikas in the Altai Moun tains and the Transbaikal region belong to a different species, Y. pestoides, and can be divided into three groups—parvocaucasica, altaica, and transbaicalica, respectively. Thirty years later, the name Y. pestoides was used by American researchers for strains of plague microbes exported from the Former Soviet Union [37, 66, 80, 88]. In order to standardize the system of Y. pestis strain classification, a division of all variants of plaguecaus ing pathogen isolated in the Soviet Union and Mongo lia into five subspecies was recommended by the con ference of experts of the AntiPlague Establishments of the Soviet Union (Saratov, 1985); the classification was based on quantitative assessment of 60 phenotypic features, and the subspecies received the names pestis (main subspecies), altaica, caucasica, hissarica, and ulegeica [1]. Sludskii suggested the existence of an additional intraspecies group—the talassica subspe cies—in 1998 [28]. The latter five subspecies are termed additional (nonmain, nonpestis). The classification of Y. pestis strains by subspecies accepted in 1985 is currently used by antiplague orga nizations in the former Soviet Union. China, which has natural foci of all three classical Devignat biovars on its territory, uses its own national intraspecies clas sification, according to which different intraspecies groups are termed ecotypes, and some of the “rham

nosepositive” ecotypes are referred to the new micro tus biovar [34, 97, 106, 110]. Historical aspects of the issue are addressed by review articles [1, 38]. The intraspecies taxonomy of the plague microbe used in practical work and most thoroughly described in paper by Li et al. [74], does not comply with the rules of the International Code of Bacterial Nomen clature (ICBN). Thus, the main subspecies, Y. pestis, includes four biovars—antiqua, medievalis, orientalis, and intermedium, while all additional subspecies— altaica, angola, caucasica, hissarica, qinghaiensis, talassica, ulegeica, and xilingolensis—are, on the con trary, considered one biovar, namely, microtus. For the taxonomy of the plague microbe to be in compliance with the ICBN rules, the microtus biovar should be considered a subspecies and the phylogenetic groups included in this biovar should be considered biovars; importantly, this new intraspecies classification is already used by researchers in Germany, Mongolia, and France [64]. The bv. caucasica strain Pestoides F (GenBank IDs: chromosome–NC_009381.1, plas mids CD–NC_009377 and MT–NC_009378) can be considered a typical strain of the microtus subspecies. This new classification will be used in the present review (see table and figure). THE USE OF MOLECULAR AND GENETIC APPROACHES FOR THE TYPING OF Y. pestis The relatively recent emergence of Y. pestis [36] accounts for low intraspecies variability and compli cates quick and reliable phenotypic differentiation of individual pathogen strains, which is necessary both for molecular epidemiology and for a better under standing of the mechanisms of plague pathogen emer gence and the spreading of plague. The dependence of the phenotype on the degree of expression of individ ual genes under different cultivation conditions [87] complicates the comparative analysis of the results obtained. Peculiarities of Y. pestis lipopolysaccharide structure [67] prevent the use of sero and phagotyp ing, which are widely used for other gramnegative bacteria [90]. Comparison of protein electrophoretic profiles suggested by Yan et al. [34] allowed for classi fication of 80 strains isolated in Russia and China into eight proteinovars corresponding to subspecies; how ever, this method is rather laborintense. All genotyping methods are based on analysis of nucleicacid fragments varying between closely related strains. Introduction of genotyping and genomotyping into practical healthcare enables obtaining reproducible results that allow for discrimi nating between intraspecies groups, individual strains of Y. pestis, and even lines maintained in different lab oratories [23]. Previous review articles on genotyping of the plague microbe [15, 25, 29, 31, 33, 41, 76] mostly addressed the discriminative ability of molecu lar typing methods used for the plague microbe; the typing methods were classified according to the proce

MOLECULAR GENETICS, MICROBIOLOGY AND VIROLOGY

Vol. 28

No. 2

2013


Vol. 28

No. 2

2013

+

altaica/0.PE1

angola/0.PE3 xilingolensis/ 0.PE4 qinghaiensis/ 0.PE4 talassica/?

? + + + – + + – + + – +

+ +

+ – +

+ – +

+ +

+

+ + +

+

hissarica/0.PE9

+ + +

+

caucasica#/ 0.PE2 ulegeica/0.PE8

–

–

? ?

±

?

?

–

Urease activity + +

?

–

–

– + +

– – +

– ? ? – – +

– ± +

– – +

–

?

? +

±

+

tyrosine

cysteine

thiamine

arginine

methionine

leucine

Region of circulation Main hosts

–

?

+

+ + ± + – – ± ± + – + Central Asia

Citellus (Spermophi lus) spp., Meriones spp., Rhombomys spp. + ± + – – ± ± + – + Southwest Asia, Rattus spp., Cynomys southern regions spp., Spermophilus of Africa, spp., Cavia spp., America Peromyscus spp., etc. ? – + – ? + ± ± ? + Northern Tian Marmota baibacina, Shan, China Spermophilus undu latus – ± + + + ± + + ? – North and South Microtus arvalis Caucasus regions + – – – – + + ? ? – Northeast Microtus gregalis, Mongolia, Alticola strelzovi, Gobi Desert Ochotona pallasi pricei + + – + – + + ? ? – Altai Mountains, Microtus gregalis, Mongolia Alticola strelzovi, Ochotona pallasi pricei + + + – – + + – – – Hissar Moun Microtus carruthersi tains ? ? ? ? ? ? ? ? ? – Angola ? ? – – – ? – – ? ? – Xilin Gol plains, Microtus brandti China Microtus fuscus ? – – – ? – – ? ? – QinghaiTibet uplands, China + + ? + ? + + ? + – Talas mountain Microtus gregalis, range Marmota caudata

+ + ± + – – ± ± + – + Central Asia and Marmota spp. Central Africa

Fibrinolytic activity +

?

? ?

+

+

– – + +/–## +

+ – –

?

+ ± +

– – +

Sensitivity to pesticin –

Virulence for guinea pigs

0

0

0 0

0

0

0

0

0

>20

>20

>20

Frequency of mutation from Pgm+ to Pgm– phenotype in ten genera tions, %

Note: *—SNP type is shown according to [79]. The number before the dot indicates one of the major branches of the phylogenetic tree; **+—the feature is present; –—the feature is absent; ±—the feature is present in part of the strains;***?—no data available;# strains of the caucasica subspecies lack the pPst plasmid; ##+/– —sensitive to pesticin from the strains of pestis and altaica subspecies and insensitive to pesticin of own subspecies.

micro tus (pes toides)

Pesticin production

+ – +

Denitrification

+ + + ?*** +

+

intermedium/?

– + –

–

–

–

± + +

–

–** – + +

rhamnose

glycerol

–

antiqua/0.ANT, 3.ANT, 1.ANT, 2.ANT medievalis/2. MED

pestis

melibiose arabinose

melecytose

orientalis/l.OKl

Biovar/SNP type*

Sub species phenylalanine

Dependence on a source of

threonine

Fermentation of Coagulase activity

Major taxonomic features of strains characteristic of Y. pestis intraspecies groups (adapted from [74])

MOLECULAR TYPING OF Yersinia pestis 43

44

PLATONOV et al. Yersinia pestis

bv. orientalis

bv. medievalis

bv. antiqua

bv. intermedium

bv. ulegeica

bv. hissarica

subsp. pestis

bv. altaica

bv. xilingolensis

bv. qinghaiensis

bv. talassica

bv. angola

bv. caucasica

subsp. microtus

Proposed intraspecies taxonomy of Y. pestis.

dures used to detect genetic variation (electrophoresis, PCR, DNA hybridization, etc.). The present review analyses the discriminative ability of molecular typing methods for Y. pestis according to the targets used (plasmids, ISelements, the complete genome, etc.) CLASSICAL GENOTYPING METHODS Plasmid Profiling The presence and size of three classical plasmids (pPst, pLcr, and pFra), as well as those of cryptic plas mids, allow for the identification of 20 or more Y. pes tis plasmidovars. One of them includes virtually all strains of the orientalis biovar; others are characteristic of certain natural foci, while some plasmidovars are represented by unique individual strains [2, 9, 33, 38]. Detection of Ribosomal RNA Polymorphisms 16S rDNA (rRNA) sequences of Y. pestis and Y. pseudotuberculosis are completely identical [46]; a single nucleotide difference between 23S rDNA sequences was detected. Ribotyping This method is based on RFLPtyping of DNA fragments containing rRNA operons, since the operon copy numbers are different in different Y. pestis bio vars. Strains Antiqua and Nepal516 (bv. antiqua), as well as strain KIM (bv. medievalis), carry seven copies of the 16S23S5S rRNA [46, 48], while the strain CO92 belonging to the “younger” orientalis biovar carries six copies of rRNA genes [59], this being indic ative of a loss of one copy during microevolution. Ribotyping of 70 strains of the main subspecies of Y. pestis resulted in the detection of 16 ribotypes. Two of the ribotypes (B and O) included 66% of the isolates studied, while each of the remaining 14 included three or fewer strains [59]. Two ribotypes were detected

upon analysis of 27 “vole” strains of the plaguecaus ing pathogen (four to seven strains of each of the five additional biovars caucasica, ulegeica, altaica, hissarica, and talassica), with 26 strains belonging to one ribotype. Ribotypes of the “vole” Y. pestis strains differed from those of the strains of the main subspe cies and Y. pseudotuberculosis [8]. DNA Fragment Profiling with PulseField Gel Electrophoresis (PFGE) The PFGE procedure, in combination with cleav age by rarecutting restrictases, allows for structural analysis of the complete genome by comparing RFLP profiles of individual strains. The discriminative ability of PFGE of Y. pestis chromosomal DNA treated by the ICeuI enzyme was comparable to that of ribotyping [89]. The use of SpeI restrictase allowed for an increase of the discriminative ability of the method [61, 77]. Guiyoule et al. [59] showed that NotI pulso types of strains of the new ribotypes isolated in Mada gascar after 1982 differ from those of the strains previ ously isolated in the same region. The PFGE typing procedure can be conveniently used in epidemiologi cal research for detection of closely related clones, but is only of limited use if distantly related strains are to be compared, as illustrated by the case of the investiga tion of a human plague case in New Mexico [61]. IS Typing The most widely used version of IS typing involves probing of the chromosome and plasmids with a DNA fragment of the IS element in order to detect differ ences in the localization of this mobile genetic ele ment in the genome. This approach is a variant of RFLP typing. The genomes of Y. pestis and Y. pseudo tuberculosis contain four IS elements each [3, 45, 83]. IS100 has the largest copy number—namely, 75 cop ies in the Y. pestis Antiqua strain and 30–44 copies in


Vol. 28

No. 2

2013

MOLECULAR TYPING OF Yersinia pestis

strains CO92, KIM, Nepal516, and 91001 [46, 49, 83, 95]. The Y. pestis genome also contains 47–67 copies of IS1541, 19–25 copies of IS285, and 8–10 copies of IS1661. Y. pseudotuberculosis, the ancestor of Y. pestis, carries five copies of each IS100 and IS1541, seven copies of IS285, and three copies of IS1661 [45]. The large number of IS sequences in the Y. pestis genome accounts for the variability of RFLP profiles, PFGE fingerprinting, and ribotypes—in other words, the results of all genotyping methods based on the analysis of the relative location of specific chromosome and plasmid fragments are variable. Most of the DNA transpositions detected in the genome of Y. pestis KIM can be attributed to ISmediated recombination [48]. ISRFLP genotyping of 61 Y. pestis isolates with IS100, IS285, and IS1541 as probes yielded satisfac tory results with regard to strain clustering if each of the IS elements was used individually. Combination of all three sets increased the resolving capacity of the method to the individual strain level and enabled clus tering corresponding to biovars and natural foci even in the case of the relatively young orientalis biovar [100]. Another method of IS typing is based on PCR with two primers, of which one is complementary to the IS element sequence and the other of which is specific for a sequence flanking the IS sequence in the DNA. Motin et al. [80] used this approach for IS100 typing with sitespecific primers designed according to the genome of the CO92 Y. pestis strain. Sixteen IS types were detected when 77 Y. pestis strains, and two Y. pseudotuberculosis strains were analyzed. This method demonstrated the close relationship between Y. pseudotuberculosis strains and “vole” Y. pestis strains; the latter occupied an intermediate position between the ancestor of the plague microbe and Y. pes tis strains of the main subspecies. Unexpectedly, some strains of the medievalis and antiqua biovars were classes in one genetic group. MULTILOCUS SEQUENCING (MLST) MLST is a molecular typing method allowing for simultaneous variability assessment of several gene sequences [78]. Precise sequencing of the genes stud ied is essential for MLST analysis; therefore, one has to use highquality enzymes and sequencing in two directions to verify the results obtained, this signifi cantly increasing the cost of the study. Highquality sequencing is a prerequisite for data reproducibility and the possibility of exchange of digitized results between different laboratories. “Housekeeping” genes are the most suitable targets for this method, because they are not subject to strong selection pressure that could cause rapid changing of their sequences. Still, the housekeeping genes are suf ficiently variable and can be present in different strains as different alleles [78]. MLST databases for a range of

45

bacterial pathogens can be found on the Internet (www.mlst.net); however, data for Y. pestis are not available. Nucleotide polymorphismbased typing of 58 strains representing all the known species of the genus Yers inia, which involved the analysis of 16S rRNA, glnA, gyrB, recA, and hsp60 genes [68], showed the applica bility of this method to species differentiation of the plague microbe; however, analysis of the gene set used did not have sufficient discriminative capacity for determining the subtype of Y. pestis strains. Sequence polymorphisms have been reported for Y. pestis rhalocus genes [12, 13], as well as genes araC [6, 14], aspA [7], napA [14, 19], inv [20], and glpD [14] in Y. pestis strains belonging to the main subspecies and five biovars (caucasica, ulegeica, altaica, hissarica, and talassica) of the microtus subspecies (different papers report the results obtained for 15–70 strains). A polymorphism important for diagnostics was detected in the sequences of rhalocus genes and the genes aspA and nap [13]. SINGLE NUCLEOTIDE POLYMORPHISM (SNP) TYPING SNP analysis involves the assessment of single nucleotide variability in a certain locus of the bacterial genome. If the nucleotide substitution causes a replacement of an encoded amino acid residue, the mutation is termed nonsynonymous; if the newly formed triplet codes for the same amino acid, the mutation is termed synonymous. Many substitutions (especially the synonymous ones) do not affect the viability of the bacteria and remain conserved in the genome, thus allowing for their use in the assessment of closely related isolate microevolution, especially upon simultaneous assessment of nucleotide polymor phisms in several loci. In contrast to MLST, which involves analysis of the variability of rather wellcon served housekeeping genes, SNP typing involves anal ysis of highly polymorphic genetic loci [51]. Sequencing of target genes is essential for MLST, while the detection of single nucleotide polymor phisms in certain genetic loci can be accomplished using a range of procedures. In addition to conven tional sequencing or pyrosequencing, one can use mass spectrometry [73], realtime PCR with probes allowing for the detection of single nucleotide substi tutions based on hybridizationefficiency changes [102], microarray technologies [107], RFLP typing, flow cytometry, etc. [104]. Synonymous SNP (sSNP) does not cause any changes in the protein structure and is usually evolu tionarily neutral (or nearly neutral) [91]. Functional neutrality and ease of detection make sSNP a suitable target for largescale molecular studies in population genetics aimed at determining the degree of evolution ary divergence of bacterial strains, especially in bacte


Vol. 28

No. 2

2013

46

PLATONOV et al.

rial species which, similarly to Y. pestis, demonstrate pronounced clonality [36]. Moreover, special software designed for research in population genetics enables convenient analysis of sSNP genotypes. In the postge nomic era, SNPs provide a possibility for simple and quick fullgenome comparison of multiple bacterial strains. Achtman et al. [35] detected 76 conserved sSNPs in 3250 orthologous coding sequences from the com pletely sequenced genomes of three Y. pestis strains (CO92, 91001, and KIM [48, 83, 95]), using the genome of Y. pseudotuberculosis strain IP32953 as the starting point. Most of these conserved sSNPs are spe cific for the intraspecies groups 1.ORI, 0.PE4, and 2.MED, to which the three abovenamed strains belong. One can assume that the analysis of other sequenced genomes of Y. pestis will increase the num ber of sSNPs that are potentially useful for typing and increase the discriminative ability of the method. Indeed, the comparison of genomes of two closely related strains of the orientalis biovar isolated in North America—FV1 [39] and CA884125 [101]—and the genome of the CO92 strain [83] prototypic for this biovar yielded 23 novel SNPs, while comparison of complete genome sequences of 17 Y. pestis strains allowed for the detection of 933 sSNPs, which were used for typing of 286 isolates of the plague microbe [79]. The analysis performed allowed for the detection of sSNPs specific for certain geographic regions and a more precise assessment of the location of certain branches of the dendrogram: namely, bv. caucasica strains turned out to be the most ancient in the micro tus subspecies. CRISPR ANALYSIS Repeated CRISPR (clustered regularly interspaced short palindromic repeat) elements are found in the genomes of all archebacteria and hyperthermophilic bacteria studied to date, as well as in those of certain eubacteria, as one or several chromosomal loci. Their structure is highly conserved and includes 27–47 bp long direct repeat (DR) sequences separated by spac ers of comparable size. Direct repeats contain sequences characteristic of target fragments of DNA binding proteins. DR and spacer clusters are usually flanked by several conserved CRISPRassociated genes (casgenes) [63], which can take part in DNA replication and reparation. CRISPR loci, Cas pro teins, and leader sequences (noncoding sequences sit uated on one of the ends of the CRISPR locus and functioning as promoters) [63] are components of the prokaryotic immune system that protects cells from bacteriophages. Intraspecies divergence is characteris tic of the spacers of CRISPR loci. Some spacer sequences have been found to be homologous to their putative precursors—bacteriophages and conjugative plasmids [109]. CRISPR loci are transcribed, and the transcription product is subsequently processed to

form a set of micro RNAs [98]. New spacers are not synthesized de novo, but are rather copied from exist ing DNA sequences. The majority of the presently known spacers have no homologues in DNA sequences contained in databases; if homology is detected, spacers are usually similar to short fragments of mobile ele ments, such as phages. This observation provided grounds for the suggestion that CRISPRs are required for protection from “genetic aggression” [86]. CRISPR typing is possible due to the high degree of intraspecies polymorphism of the spacers. The vari ability of sequences in CRISPR loci was first used for molecular typing of Mycobacterium tuberculosis strains [53]. A database including more than 2000 CRISPR variants obtained upon the analysis of almost 40 thou sand strains is available online [43]. Both Y. pestis and Y. pseudotuberculosis contain three CRISPR loci—YPa, YPb, and YPc (previously referred to as YP1, YP2, and YP3, respectively) [47, 86]. The position of these loci in genomes of differ ent strains varies due to chromosomal DNA rearrange ments. The direct repeats in these three loci are conser vative; their nucleotide sequence is 5'TTTCTAAGCT GCCTGTGCGGCAGTGAAC3', while the nucleotide sequences of the truncated direct repeats on the ends of each locus are 5'TGCCTGTGCGGCAGTGAAC3', 5'TAAGCTGCCTGTGCGGCAGTGAAC3', and 5'GCTGCCTGTGCGGCAGTGAAC3', for YPa, YPb, and YPc, respectively. Direct repeat sequences (including the first truncated direct repeats) are iden tical in all the strains studied, this being indicative of the importance of these conserved sequences for the survival of Y. pestis. Notably, YPb and YPc of the Angola strains contain only truncated direct repeats and a leader sequence. According to the model put forward by Grissa et al. [55–57], the loci YPb and YPc are derivatives of the original YPa locus, which con tains all the “tools” necessary for their emergence and evolution. The leader sequences of YPa and YPb are similar, while that of YPc is less conserved. We have performed a detailed analysis of three CRISPR loci in 125 Y. pestis strains from natural foci of China, the Former Soviet Union (FSU), and Mongolia in order to assess the efficiency of CRISPR genotyping and achieve a better understanding of adaptive microevo lution of Y. pestis [47]. The distribution of individual spacers and/or spacer combinations was found to be connected to certain natural foci and applicable for efficient typing of Y. pestis. A model of Y. pestis micro evolution based on the data obtained was put forward. The online resources for CRISPR genotyping [53, 54, 56] make possible comparison of data obtained in dif ferent laboratories. The necessity of CRISPR locus sequencing for the detection of small variations in the nucleotide sequences of individual spacers is a draw back of the method [47].


Vol. 28

No. 2

2013


VNTR/MLVA TYPING The specific VNTR (variable number tandem repeat) locus includes the variable central fragment and flanking fragments. The variable fragment consists of several DNA repeats connected “head to tail.” The number of repeats may vary, this leading to variation in DNA fragment length, while flanking site sequences are conserved. VNTR/MLVA typing (multiple locus VNTR analysis) makes use of the occurrence of a large number of errors upon the replication of tandem DNA repeats. This method involves the use of a set of prim ers homologous to DNA fragments flanking the direct repeat sequences and analysis of amplicon size differ ences corresponding to the repeat number differences in the genomes of Y. pestis strains under investigation. Adair et al. detected nine alleles of a locus containing CAAA repeats in a study performed in 2000 that involved 35 Y. pestis strains [37]. Numerous VNTR loci were detected in the sequenced genomes of vari ous Y. pestis strains, and multilocus VNTR analysis enabled increasing the discriminative capacity of the method [66, 71]. Databases listing tandem sequences in several completely sequenced genomes are available at http://minisatellites.upsud.fr. These databases can be used for searching for VNTR loci in sequenced genomes of microorganisms, comparing VNTR loci in different strains or species, and detecting regions that are similar but not identical. In addition, the website provides a tool for designing primer pairs using the full genome sequence or a partial sequence associated with VNTR loci. Results of MLVA typing are assessed using electro phoresis (25 VNTR markers) [71] or capillary electro phoresis (42 VNTR markers) [66]; only six VNTR loci are common for two marker sets. PCR products differ ing by one repeat unit can be distinguished using elec trophoresis. The method described is low in cost and easy to use, but is time consuming and has low resolu tion if the VNTR loci under investigation contain a small number of repeats (in this case, capillary electro phoresis is used for discriminating between different sequences). MLVAbased clustering of the plague microbe is in good correspondence with classification based on the results of biochemical tests, IS analysis, and other methods, but shows higher discriminative ability inde pendent of the set of VNTR loci used. Typing can be carried out quickly and at a low cost [66, 71, 85]. MLVA data are placed online for use by the research commu nity (http://bacterialgenotyping.igmors.upsud.fr [70] and http://www.mlva.umcutrecht.nl [99]), and there fore results obtained in different laboratories can be compared. More than 430 MLVA25 types of Y. pestis have been detected to date [23]. More than 352 MLVA25 types have been shown to be circulating in the FSU coun tries and Mongolia, and the distribution of MLVA25 types of Y. pestis in individual natural foci of plague has

47

been characterized. MLVA25 clusters/subclusters containing similar genotypes correspond to specific natural foci. The main branches of dendrograms obtained by analyzing MLVA profiles are similar to those obtained by SNP typing [35] DFR ANALYSIS Analysis of the currently available full genome sequences of Y. pestis shows that the genome of the pathogen is constantly transforming and expanding due to horizontal gene transfer occurring with both plasmids and chromosomal genes [39, 48, 83, 95, 101]. Since the expansion of bacterial genomes is limited, acquisition of foreign genes is necessarily accompa nied by the loss of the bacterium’s own genes. Certain genes are only conserved in the genome if they provide advantages for the microorganism; otherwise, genes are lost [50]. All these changes are a consequence of Y. pestis adaptation to new ecological niches providing a unique opportunity for tracing the species formation and microevolution of this pathogen [74]. Twentythree DFRs (different regions) specific for individual strains of Y. pestis have been detected in the genome of this species by comparative analysis of full genome sequences in silico, comparative genome hybrid ization using microarrays, and subtractive hybridization; a genotyping procedure based on DFR detection has been developed for Y. pestis. Strains circulating in China have been shown to belong to 32 “genomovars” (DFR types), with a specific major DFR type being charac teristic for each focus [75]. Biovarspecific DFR pro files were shown to exist for strains belonging to orien talis, medievalis, xilingolensis, and qinghaiensis bio vars, with each biovar forming a separate cluster. Strains of different “genomovars” of the antiqua bio var were distributed among all three clusters. Since strains of specific genomovars circulate in specific plague foci, it is possible to use DFR typing for prelim inary assignment of a strain to a focus. Genomovars based on DFR profiles are in good agreement with the Y. pestis ecotypes traditionally used in China [34, 97, 106]. In silico analysis of fullgenome DFR profiles enables comparison of these profiles with the DFR profiles of Chinese strains. For instance, comparison of DFR profiles of strains of the orientalis biovar shows that the Chinese strains are the most ancient parent strains of this group [75]. DFR typing [75] of a set of 275 Y. pestis strains, most of which were isolated in natural plague foci of the FSU countries, resulted in the determination of genomovars (DFR types) characteristic of 27 plague foci of this region [24]; 64 novel DFR types of Y. pestis (of 96 currently described) have been detected, and the circulation of not less than 56 “genomovars” in the FSU and Mongolia has been shown. Clustering of all strains classified by DFR typing was shown to be in good correspondence with the phylogenetic scheme based on the combined results from SNP typing and


Vol. 28

No. 2

2013

48

PLATONOV et al.

IS100 typing [35] and allow for the differentiation of subspecies, populations, and even strains circulating within specific natural foci. MICROARRAY TYPING Microarray technology is used for the detection of specific genes in different strains belonging to the Y. pestis species and comparison of these genes to the gene set of Y. pseudotuberculosis. A study of 22 Y. pestis strains and 10 Y. pseudotuberculosis strains by Hinch liffe et al. [60] resulted in the detection of 11 genomic regions either present in Y. pestis genome, but not in Y. pseudotuberculosis genome, or differing signifi cantly between the two genomes. Four differences were due to bacteriophage incorporation into the genome of Y. pestis. Only 1 of the 11 proteins detected, YPO2277, was similar to a previously detected patho genicity factor of E. coli encoded by the puvA gene; a 21 DNA fragment was present only in part of the genomes of Y. pestis strains analyzed; the prophage CUS2 (YPO22712281) was present only in the genome of Y. pestis bv. orientalis strains. Comparison of gene profiles allowed the conclusion to be drawn that some strains of the antiqua biovar are genetically similar to isolates belonging to the medievalis biovar and differ significantly from the strains belonging to bv. orientalis. Y. pestis strains from all 13 natural plague foci of China were analyzed by a microarray genotyping pro cedure based on the detection of acquisition or loss of individual genes and compared to seven Y. pseudotu berculosis strains by Yang et al. [108]. Twentytwo genomic regions lacking at least one of the 36 Y. pestis strains studied were detected and subsequently ampli fied from 260 Y. pestis isolates by PCR in order to determine the genomovars of the plaguecausing pathogen characteristic of each natural reservate and the phylogenetic relationships of the strains circulat ing within a single reservate. The orientalis biovar was shown to be more closely related to the antiqua biovar than to the medievalis biovar. The data obtained prove that the spreading of Y. pestis in China was directed from the northwest regions to the southern regions; therefore, the genomovars of the northwestern natural foci are the most ancient. “Vole” strains of the microtus subspecies with selective virulence are evolutionarily older than Y. pestis strains with universal virulence. The method has several drawbacks: it is poorly adapted to the detection of single nucleotide polymor phisms, is incapable of detecting genes that are absent in previously studied genomes of a certain bacterial species, and will become obsolete in 3–4 years [40], even before it is introduced into Russian laboratories. TYPING WITH FULLGENOME SEQUENCING The availability of fullgenome sequences led to decisive changes in the methods of epidemiology, bac

teriology, and infectiousdisease treatment. In addi tion to the comparison of individual genes, full genome sequencing enables the comparison of IS ele ment location in the genome, as well as the compari son of gene localization in the genomes of different representatives of a species, genus, and/or family. Fullgenome sequencing of bacterial pathogens cur rently allows characterization of the genome structure, analysis of specific features of metabolism, and com parison of multiple isolates for detection of genes responsible for the differences in individual strain vir ulence [40]. Comparative assessment is especially important for analysis of strains with unusually high virulence and contagiousness and/or multidrug resis tance; these strains can cause epidemic outbreaks and represent a serious hazard if used by bioterrorists. Quick detection of novel gene acquisition, loss, or modification of the bacteria‘s own genes provides an explanation for changes in strain virulence and/or drug resistance, while the detection of strainspecific nucleotide sequences allows reliable tracing of all stages of the epidemic process starting from the infec tion source. Fullgenome sequencing is also used in the search for targets that can be employed for in silico typing and genotyping. The NCBI GenBank database currently contains the full genomes of the Y. pestis strains CO92, KIM, Nepal 516, Antiqua, Angola, 91001, Pestoides F, Z176003, D106004, and D182038, and the EMBLEBI database contains the genomes of the A1122 and Harbin 35 strains. Fullgenome sequenc ing for microbes causing extremely dangerous infec tious diseases is still insufficiently developed in Russia, notwithstanding the broad opportunities that it offers. CONCLUSIONS Notwithstanding the large number of studies devoted to molecular typing of Y. pestis, there are only a few reports on unified and reproducible methods used in several laboratories that allow for differentia tion of both intraspecies groups (biovars, subspecies, ecotypes, etc.) and individual strains [23, 24, 47, 69, 74, 75, 79]. Each of the methods considered in the present review has its own advantages and drawbacks determin ing its applicability for molecular typing of Y. pestis. A researcher will often have to choose between obtaining a result rapidly and achieving high reproducibility and resolution. For example, PFGE is very attractive for subtyping isolates obtained during one epidemic or even an epidemic outbreak, while the resolution of the MLVA, MLST, and SNP typing methods developed in the postgenomic period is not lower (and sometimes even higher) than that of PFGE, with the time period required for obtaining the result by these methods being shorter. A need for sequencing (a relatively costly method even nowadays) is the main drawback of MLST and SNP typing, limiting the use of these


Vol. 28

No. 2

2013


methods in practical laboratory diagnostics. The wide selection of the available genotyping and genome typ ing methods differing both with regard to targets used and to methods of sequencevariation detection com plicates the choice of an optimal method for a specific epidemiological task. A difference in one molecular typing target can be overlooked if two isolates are ana lyzed with a method employing another target. A sin gle nucleotide polymorphism detected with MLST or SNP typing is unlikely to affect PFGE profiles of the strains under consideration. Therefore, combination of methods employing different targets seems a suit able alternative to fullgenome sequencing, which will be probably introduced into practical laboratory work in 3–4 years (according to the opinion of European experts). One of the methods is used for preliminary clustering of the isolates studied, while another method or several other methods are used to verify the data obtained or determine isolate subtypes within clusters defined according to the results of typing with the first method. ACKNOWLEDGMENTS The present review was prepared under the State Contract no. 61D of 22.07.11 as part of the federal targeted program “The National Chemical and Bio logical Safety System of the Russian Federation (2009–2013).” REFERENCES 1. Aparin, G.P. and Golubinskii, E.P., Mikrobiologiya chumy. Rukovodstvo (Plague Microbiology: A Guide), Irkutsk, 1989. 2. Balakhonov, S.V., Tsendzhav, S., and Erdenebat, A., Mol. Genet., 1991, no. 1, pp. 22–29. 3. Bobrov, A.G. and Filippov, A.A., Mol. Genet., 1997, no. 2, pp. 36–40. 4. Gorshkov, O.V., Savostina, E.P., Popov, Yu.A., et al., Mol. Genet., 2000, no. 3, pp. 12–17. 5. Gracheva, I.V., Karavaeva, T.B., Merkulova, T.K., et al., Probl. Osobo Opasnykh Infekts., 2009, no. 99, pp. 42–49. 6. Eroshenko, G.A., Vidyaeva, N.A., Odinokov, G.N., et al., Mol. Genet., 2009, no. 3, pp. 21–25. 7. Eroshenko, G.A., Odinokov, G.N., Krasnov, Ya.M., et al., Probl. Osobo Opasnykh Infekts., 2009, no. 99, pp. 52–54. 8. Eroshenko, G.A., Pavlova, A.I., Kukleva, L.M., et al., Zh. Mikrobiol. Epidemiol. Immunobiol., 2007, no. 3, pp. 6–10. 9. Ivanova, V.S., Lebedeva, S.A., Goncharova, N.A., et al., Mol. Genet., 1990, no. 3, pp. 16–18. 10. Inokent’eva, T.I., Izv. Irkutsk. Gos. Nauch.Issled. Inst. Sibiri Dal’nego Vostoka, 1968, vol. 27, pp. 432–438. 11. Kozlov, M.P., Chuma (prirodnaya ochagovost’, epizoo tologiya, epideminologicheskie proyavleniya) (Plague (Natural Foci, Epizootology, and Epideminolog icheskie Manifestations)), Moscow, 1979.

49

12. Kukleva, L.M., Eroshenko, G.A., Kuklev, V.E., et al., Mol. Genet., 2008, no. 2, pp. 23–27. 13. Kukleva, L.M., Eroshenko, G.A., Kuklev, V.E., et al., Probl. Osobo Opasnykh Infekts., 2008, no. 97, pp. 38–42. 14. Kukleva, L.M., Eroshenko, G.A., Pavlova, A.I., et al., Probl. Osobo Opasnykh Infekts., 2007, no. 94, pp. 50–53. 15. Kutyrev, V.V. and Smirnova, N.I., Mol. Genet., 2003, no. 1, pp. 6–14. 16. Levi, M.I., in Tezisy dokl. nauch. konf. po prirodnoi ochagovosti i profilaktike chumy i tulyaremii (Abstr. Sci. Conf. on Natural Foci and Prevention of Plague and Tularemia), RostovonDon, 1962, pp. 72–74. 17. Martinevskii, I.L., Biologiya i geneticheskie osobennosti chumnogo i blizkorodstvennykh emu mikrobov (Biolog ical and Genetic Characteristics of the Plague Bacte rium and Closely Related Bacteria), Moscow, 1969. 18. Mikhailova R.S. Characteristics of properties and clas sification of strains of the plague microbe isolated in the Caucasus, Extended Abstract of Cand. Sci. (Med.) Dissertation, Stavropol’, 1968. 19. Odinokov, G.N., Eroshenko, G.A., Vidyaeva, N.A., et al., Probl. Osobo Opasnykh Infekts., 2008, no. 98, pp. 40–42. 20. Odinokov, G.N., Eroshenko, G.A., and Kutyrev, V.V., Probl. Osobo Opasnykh Infekts., 2009, no. 100, pp. 50–52. 21. Peisakhis, L.A. and Stepanov, V.M., Probl. Osobo Opasnykh Infekts., 1975, no. 2, pp. 5–9. 22. Peisakhis, L.A., Stepanov, V.M., and Poshevina, G.O., Probl. Osobo Opasnykh Infekts., 1971, no. 4 (20), pp. 28–32. 23. Platonov, M.E., Moleculargenetic study of the diver sity and microevolution of Yersinia pestis, Extended Abstract of Cand. Sci. (Biol.) Dissertation, Obolensk, 2010. 24. Platonov, M.E., Evseeva, V.V., Efremenko, D.V., et al., Probl. Osobo Opasnykh Infekts., 2011, no. 108, pp. 42–45. 25. Popov, Yu.A., Eroshenko, G.A., Bulgakova, E.G., et al., Probl. Osobo Opasnykh Infekts., 2009, no. 2, pp. 5–10. 26. Rall’, Yu.M., Prirodnaya ochagovost' i epizootologiya chumy (Natural Foci and Epizootology of Plague), Moscow, 1965. 27. Savostina, E.P., Popov, Yu.A., Kashtanova, T.N., et al., Mol. Genet., 2004, no. 1, pp. 22–26. 28. Sludskii, A.A., in Tezisy dokl. V s”ezd Vsesoyuznogo teriologicheskogo obva Akad. Nauk SSSR (Abstr. V AllUnion Congress of Theriological Society), Mos cow, 1990, vol. 3, pp. 222–223. 29. Smirnova, N.I. and Kutyrev, V.V., Mol. Genet., 2006, no. 1, pp. 9–19. 30. Timofeeva, L.A., Probl. Osobo Opasnykh Infekts., 1972, no. 1 (230), pp. 15–22. 31. Trukhachev, A.L. and Lebedeva, S.A., Mol. Genet., 2007, no. 1, pp. 3–8. 32. Tumanskii, V.M., Zh. Mikrobiol. Epidemiol. Immuno biol., 1957, no. 6, pp. 3–7. 33. Filippov, A.A., Solodovnikov, N.S., Kukleva, L.M., et al., Zh. Mikrobiol. Epidemiol. Immunobiol., 1992, no. 3, pp. 10–13. 34. Yan, G., Evchenko, Yu.M., Grizhebovskii, G.M., et al., in Diagnostika, lechenie i profilaktika opasnykh


Vol. 28

No. 2

2013

50

PLATONOV et al.

infektsionnykh boleznei. Biotekhnologiya. veterinariya: Materialy yubil. nauch. konf., posvyashch. 70letiyu NII mikrobiologii MO RF (Kirov, 30 noyabrya–1 deka brya 1998 g.) (Diagnosis, Treatment, and Prevention of Infectious Diseases. Biotechnology. Veterinary: Proceedings of the Anniversary Scientific Conference Dedicated to the 70th Anniversary of the Institute of Microbiology, Russian Defense Ministry, Kirov, November 30–December 1, 1998), Pimenov, E.V. and Darmov, I.V., Eds., Kirov: Nauchn.Issled. Inst. Mik robiologii, 1998, pp. 408–409. 35. Achtman, M., Morelli, G., Zhu, P., et al., Proc. Natl. Acad. Sci. U.S.A., 2004, vol. 101, pp. 17837–17842. 36. Achtman, M., Zurth, K., Molelli, G., et al., Proc. Natl. Acad. Sci. U.S.A., 1999, vol. 96, pp. 14043–14048. 37. Adair, D.M., Worsham, P.L., Hill, K.K., et al., J. Clin. Microbiol., 2000, vol. 38, pp. 1516–1519. 38. Anisimov, A.P., Lindler, L.E., and Pier, G.B., Clin. Microbiol. Rev., 2004, vol. 17, pp. 434–464. 39. Auerbach, R.K., Tuanyok, A., Probert, W.S., et al., PLoS ONE, 2007, vol. 2, p. e770. 40. Beres, S.B., Richter, E.W., Nagiec, M.J., et al., Proc. Natl. Acad. Sci. U.S.A., 2006, vol. 103, no. 18, pp. 7059–7064. 41. Bobrov, A.G., Huang, X.Z., and Lindler, L.E., in Pro ceedings 25th Army Science Conference, Orlando, Flor ida, 2006, no. 27–30. 42. Brubaker, R.R., Clin. Microbiol. Rev., 1991, vol. 4, pp. 309–324. 43. Brudey, K., Driscoll, J.R., Rigouts, L., et al., BMC Microbiol., 2006, vol. 9, no. 6, p. 23. 44. Butler, T., Plague and Other Yersinia Infections, New York, 1983. 45. Chain, P.S., Carniel, E., and Larimer, F.W., Proc. Natl. Acad. Sci. U.S.A., 2004, vol. 101, pp. 3826–13831. 46. Chain, P.S., Hu, P., Malfatti, S.A., et al., J. Bacteriol., 2006, vol. 188, pp. 4453–4463. 47. Cui, Y., Li, Y., Gorge, O., et al., PLoS ONE, 2008, vol. 3, p. e2652. 48. Deng, W., Burland, V., Plunkett, IIIG., et al., J. Bac teriol., 2002, vol. 184, pp. 4601–4611. 49. Devignat, R., Bull. WHO, 1951, vol. 4, pp. 247–263. 50. Dobrindt, U. and Hacker, J., Curr. Opin. Microbiol., 2001, vol. 4, no. 5, pp. 550–557. 51. Esaki, H., Noda, K., Otsuki, N., et al., J. Microbiol. Meth., 2004, vol. 58, pp. 131–134. 52. Gage, K.L. and Kosoy, M.Y., Ann. Rev. Entomol., 2005, vol. 50, pp. 505–528. 53. Goyal, M., Saunders, N.A., van Embden, J.D., et al., J. Clin. Microbiol., 1997, vol. 35, no. 3, pp. 647–651. 54. Grissa, I., Bouchon, P., Pourcel, C., et al., Biochimie, 2008, vol. 90, pp. 660–668. 55. Grissa, I., Vergnaud, G., and Pourcel, C., BMC Bioin formatics, 2007, vol. 8, no. 1, p. 172. 56. Grissa, I., Vergnaud, G., and Pourcel, C., Nucleic Acids Res., 2007, vol. 35, pp. 2–7. 57. Grissa, I., Vergnaud, G., and Pourcel, C., Nucleic Acids Res., 2008, vol. 36, pp. 145–148. 58. Guiyoule, A., Grimont, F., Itean, I., et al., J. Clin. Microbiol., 1994, vol. 32, pp. 634–641.

59. Guiyule, A., Rasoamanana, B., Buchrieser, C., et al., J. Clin. Microbiol., 1997, vol. 35, pp. 2826–2833. 60. Hinchliffe, S.J., Isherwood, K.E., Stabler, R.A., et al., Genome Res., 2003, vol. 13, no. 9, pp. 2018–2029. 61. Huang, X.Z., Chu, M.C., Engelthaler, D.M., et al., J. Clin. Microbiol., 2002, vol. 40, pp. 1164–1173. 62. Hurst, M.R., Becher, S.A., Young, S.D., et al., Int. J. Syst. Evol. Microbiol., 2011, vol. 61, no. 4, pp. 844–849. 63. Jansen, R., Embden, J.D., Gaastra, W., et al., Mol. Microbiol., 2002, vol. 43, no. 6, pp. 1565–1575. 64. Kiefer, D., Dalantai, G., Damdinforj, T., et al., Vectro Borne Zoonotic Dis., 2012, vol. 12, no. 3, pp. 183–188. 65. Kim, W., Song, M.O., Song, W., et al., Antonie van Leeuwenhoek, 2003, vol. 83, no. 2, pp. 125–133. 66. Klevytska, A.M., Price, L.B., Schupp, J.M., et al., J. Clin. Microbiol., 2001, vol. 39, pp. 3179–3185. 67. Knirel, Y.A., Dentovskaya, S.V., Senchenkova, S.N., et al., J. Endotoxin Res., 2006, vol. 12, pp. 3–9. 68. Kotetishvili, M., Kreger, A., Wauters, G., et al., J. Clin. Microbiol., 2005, vol. 43, pp. 2674–2684. 69. LaukkanenNinios, R., Didelot, X., Jolley, K.A., et al., Environ. Microbiol., 2011, vol. 95, pp. 3114– 3127. 70. Le Fléche, P., Fabre, M., Denoeud, F., et al., BMC Microbiol., 2002, vol. 2, no. 37, p. 27. 71. Le Fléche, P. and Hauck, Y., Onteniente, L., et al., BMC Microbiol., 2001, vol. 1, no. 2, pp. 2180–2193. 72. Lechner, D., Lathrop, G.M., and Gut, I.G., Curr. Opin. Chem. Biol., 2002, vol. 6, pp. 31–38. 73. Lehann, K.B. and Neumann, R., Atlas und grundriss der Bakteriologie und Lehrbuch der speziellen bakterio logischen diagnostic, 1st ed., Munchen, 1896. 74. Li, Y., Cui, Y., and Hauck, Y., PLoS ONE, 2009, vol. 4, no. 5, p. e6000. 75. Li, Y., Dai, E., Cui, Y., et al., PLoS One, 2008, vol. 3, no. 5, p. e2166. 76. Lindler, L.E., J. AOAC Int., 2009, vol. 92, no. 4, pp. 1174–1183. 77. Lucier, T.S. and Brubaker, R.R., J. Bacteriol., 1992, vol. 174, pp. 2078–2086. 78. Maiden, M.C., Bygraves, J.A., Feil, E., et al., Proc. Natl. Acad. Sci. U.S.A., 1998, vol. 95, pp. 3140–3145. 79. Morelli, G., Song, Y., Mazzani, C.J., et al., Nat. Genet., 2010, vol. 42, pp. 1140–1143. 80. Motin, V.L., Georgescu, A.M., Elliott, J.M., et al., J. Bacteriol., 2002, vol. 184, pp. 1019–1027. 81. MurrosKontiainen, A., FredrikssonAhomaa, M., Korkeala, H., et al., Int. J. Syst. Evol. Microbiol., 2011, vol. 61, pp. 2368–2372. 82. Ogata, M., Zbl. Bakt., 1897, vol. 21, pp. 769–777. 83. Parkhill, J., Wren, B.W., Thomson, N.R., et al., Nature, 2001, vol. 413, pp. 523–527. 84. Perry, R.D. and Fetherston, J.D., Clin. Microbiol. Rev., 1997, vol. 10, pp. 35–66. 85. Pourcel, C., AndréMazeaud, F., Neubauer, H., et al., BMC Microbiol., 2004, vol. 4, p. 22. 86. Pourcel, C., Salvignol, G., and Vergnaud, G., Micro biology, 2005, vol. 151, pp. 653–663.


Vol. 28

No. 2

2013

MOLECULAR TYPING OF Yersinia pestis 87. Qiu, J., Guo, Z., Liu, H., et al., J. Microbiol., 2008, vol. 46, no. 5, pp. 557–563. 88. Radnedge, L., Agron, P.G., Worsham, P.L., et al., Microbiology, 2002, vol. 148, pp. 1687–1698. 89. Rakin, A. and Heesemann, J., Mol. Genet. Mikrobiol. Virusol., 1995, vol. 3, pp. 26–29. 90. Ruiz, M., Rodríguez, J.C., Sirvent, E., et al., APMI, vol. 111, no. 9, pp. 848–856. 91. Schork, N.J., Fallin, D., and Lanchbury, J.S., Clin. Genet., 2000, vol. 58, pp. 250–264. 92. Simond, P.L., Ann. Inst. Pasteur, 1898, vol. 12, pp. 625–687. 93. Skerman, V.B.D., Mcgowan, V., and Sneath, P.H.A., Int. J. Syst. Bacteriol., 1980, vol. 30, pp. 225–420. 94. Smith, J.E. and Thal, E., Acta Pathol. Microbiol. Scand., 1965, vol. 64, pp. 213–233. 95. Song, Y., Tong, Z., Wang, J., et al., DNA Res., 2004, vol. 11, pp. 179–197. 96. Stenseth, N.C., Atshabar, B.B., Begon, M., et al., PLoS Med. 2008, vol. 5, no. 1, p. e3. 97. Tan, J., Liu, Y., Shen, E., et al., Huan Jing Ke Xue, 2002, vol. 23, no. 3, pp. 1–8. 98. Tang, T.H., Bachellerie, J.P., Rozhdestvensky, T., et al., Proc. Natl. Acad. Sci. U.S.A., 2002, vol. 99, pp. 7536–7541. 99. Top, J., Schouls, L.M., Bonten, M.J., et al., J. Clin. Microbiol., 2004, vol. 42, no. 10, pp. 4503–4511.

51

100. Torrea, G., ChenalFrancisque, V., Leclercq, A., et al., J. Clin. Microbiol., 2006, vol. 44, no. 6, pp. 2084– 2092. 101. Touchman, J.W., Wagner, D.M., Hao, J., et al., PLoS ONE, 2007, vol. 2, p. e220. 102. Tyagi, S., Bratu, D.P., and Kramer, F.R., Nat. Biotech nol., 1998, vol. 16, pp. 49–53. 103. van Loghem, J.J., Antonie van Leeuwenhoek, 1944, vol. 10, pp. 15–16. 104. Weiner, M.P. and Hudson, T., J, BioTechniques, 2002, suppl. 4–7, pp. 12–13. 105. Yersin, A., Ann. Inst. Pasteur, 1894, vol. 8, pp. 662– 667. 106. Zhang, G., Xhang, J., and Wang, R., Chin. J. Ctrl. Endem. Dis., 2002, vol. 17, pp. 101–103. 107. Zhang, W., Qi, W., Albert, T.J., et al., Genome Res., 2006, vol. 16, pp. 757–767. 108. Zhou, D., Han, Y., Song, Y., et al., J. Bacteriol., 2004, vol. 186, no. 15, pp. 5138–5146. 109. Zhou, D., Han, Y., Song, Y., et al., Microbes Infect., 2004, vol. 6, pp. 1226–1234. 110. Zhou, D., Nong, Z., Song, Y., et al., J. Bacteriol., 2004, vol. 186, pp. 5147–5152.


Translated by S. Semenova

Vol. 28

No. 2

2013