Nematology, 2006, Vol. 8(6), 921-938
Morphological and molecular characterisation of Panagrellus spp. (Cephalobina: Panagrolaimidae): taxonomic status and phylogenetic relationships S. Patricia S TOCK 1,∗ and Steven A. NADLER 2 1
Department of Entomology, University of Arizona, Forbes 410, 1140 E, South Campus Drive, Tucson, AZ 85721-0036, USA 2 Department of Nematology, University of California, Davis, One Shields Avenue, Davis, CA 95616-8668, USA Received: 24 March 2006; revised: 29 September 2006 Accepted for publication: 29 September 2006
Summary – The genus Panagrellus currently comprises 12 known species. These nematodes have a worldwide distribution and have been found in a variety of habitats such as slime flux, thermal springs, insect frass and spoiled cider. Diagnosis of Panagrellus species is rather problematic since few morphological features can be used to discriminate between species and the original publications do not indicate the number of specimens measured and lack standard descriptions of variance. In this study we review the taxonomic status of several species from this genus combining classical morphological data and molecular sequences. Eleven live isolates and fixed material from currently available type specimens representing six Panagrellus species were included. Morphological analysis included the examination of qualitative and quantitative characters of males and females. The taxonomic utility of morphometric data was evaluated by means of multivariate statistics (principal component and canonical discriminant analyses). Phylogenetic inference was based on analysis of nucleotide sequences from the LSU rDNA gene and morphological characters. Parsimony tree topologies inferred from nucleotide datasets strongly supported monophyly of the P. dubius isolates, but not the P. redivivus isolates. Phylogenetic interpretation of these rDNA sequence data suggests that both the P. redivivus and P. dubius isolates each include more than a single species. Only two of the 15 morphological characters evaluated were variable within the ingroup taxa. A long spicule bifurcation length maps on the combined evidence trees as a putative synapmorphy for P. dubius, whereas male D% was homoplastic within isolates of that species. The diagnosis of the genus Panagrellus is emended. Keywords – 28S rDNA, evolutionary relationships, free-living nematodes, molecular, morphology, phylogeny, systematics, taxonomy.
The first Panagrellus species to be recognised, a nematode currently known as Panagrellus redivivus, was described by Linnaeus (1767) as Chaos redivivus Linnaeus, 1767. This species was more commonly known as the ‘sour paste nematode’ in reference to its isolation from book-binding glue, or as described by Linnaeus in 1767, “habitat in aceto and glutine bibliopegorum”. The generic name Panagrellus was not established until 1938, when Thorne described a nematode isolated from wounds of a cottonwood tree in Utah. Based on observation of new diagnostic morphological features, Thorne (1938) erected the genus Panagrellus Thorne, 1938, describing Panagrellus pycnus Thorne, 1938 as a new species. Controversy over the acceptance of the generic name Panagrellus over Chaos prevailed for many years (Rühm, 1956). How∗ Corresponding
ever, because Chaos redivivus had a rather vague description and no known type specimens, the name Panagrellus was eventually accepted based on modern taxonomic standards (Hechler, 1971). Panagrellus has a worldwide distribution, with species described from almost every continent except Antarctica and Australia. According to Andrássy (1984) 12 species are recognised, with P. pycnus as the type species and ten other named species: P. ludwigi (de Man, 1910) T. Goodey, 1945; P. nepenthicola (Menzel, 1922) T. Goodey, 1945; P. silusioides Thalolikhin, 1965; P. redivivus (Linnaeus, 1767) T. Goodey, 1945; P. redivivoides (T. Goodey, 1943) T. Goodey, 1945; P. ventrodentatus (Weingärtner, 1954) J.B. Goodey, 1963; P. dorsibidentatus (Rühm, 1956) J.B. Goodey, 1963; P. dubius Sanwal, 1960; P.
author, e-mail:
[email protected]
© Koninklijke Brill NV, Leiden, 2006 Also available online - www.brill.nl/nemy
921
S.P. Stock & S.A. Nadler
filiformis (Sukul, 1971) Andrássy, 1984; P. ceylonensis Hechler, 1971; and P. leperisini Massey, 1974. These species have been delimited and described using Linnaean or phenetic species concepts, based on morphological or morphometric data. Only the morphology of the spicules and occasionally the structure of the vulva in females are useful for diagnosis and identification of species (Hechler, 1971). This lack of distinctive morphological features makes diagnosis of Panagrellus species rather problematic. In this study we combined classical morphological imaging (differential inference contrast light microscopy), with data from scanning electron microscopy (SEM) and nucleotide sequences (nuclear ribosomal DNA) to evaluate the taxonomic position and phylogenetic relationships of certain Panagrellus species.
Materials and methods O RIGIN OF THE SPECIES AND ISOLATES Type material of six Panagrellus species was obtained from various nematode collections: P. dubius specimens (slide numbers 9 (holotype and four male paratypes), 9c (three male paratypes), S-9b (four female paratypes)) were obtained from the National Nematode Collection, Canada. Paratypes of P. ludwigi (slide number 35/2/2, nine males) were borrowed from the nematode collection at Rothamsted Research, Harpenden, UK. Specimens of P. pycnus (slide numbers T-846, T841P (11 male paratypes), T-840/1, T840, T843p, T844p, T-845p (ten
female paratypes)), P. redivivoides (slide numbers T-848p (three male and three female paratypes)), P. redivivus (slide numbers G-2807, G-2809, G-2813 (12 female paratypes), G-2806, G-2808 (nine male paratypes)), and P. ceylonensis (slide numbers T910, T-911 (two male paratypes), T-909 (five female paratypes)) were obtained from the USDA Nematode Collection, Beltsville, MD, USA. Live cultures representing 13 isolates and three Panagrellus species (P. dubius, P. ceylonensis and P. redivivus) were obtained from various sources (Table 1). M ORPHOLOGICAL STUDIES Nomarski differential interference contrast microscopy For morphological studies, nematodes were examined either live or heat-killed (60◦ C) in Ringer’s solution. For permanent slides, specimens were fixed in triethanolamine formalin (TAF) (Courtney et al., 1965) and processed to anhydrous glycerin for mounting (Seinhorst, 1959). The following abbreviations for morphological features have been used in the text or tables: ABD = anal body diam.; BbL = basal bulb length; CL = corpus length; PH = pharynx length; D% = EP/PH × 100; E% = EP/TL × 100; EP = excretory pore position; GL = gonad length; GuL = gubernaculum length; LrD = lip region diam.; MBD = maximum body diam.; NL = neck length; NR = nerve ring position; IL = isthmus length; StL = stoma length; StD = stoma diam.; SpBifL = spicule bifurcation length; SpL = spicule length (measured along the curvature); L = total body length; TL = tail length; TRL = testis reflexion length.
Table 1. Origin of Panagrellus species maintained in culture. Species
Isolate code
Habitat
P. ceylonensis Vietnam unknown P. dubius I beetle wounds and frass in Populus tremuloides P. dubius II beetle wounds and frass in Salix sp. P. dubius III beetle wounds and frass in Populus tremuloides P. dubius IV beetle wounds and frass in Populus balsamifera P. dubius V beetle wounds and frass in Salix sp. P. dubius VI beetle wounds and frass in Salix sp. P. dubius VII beetle wounds and frass in Salix sp. P. dubius VIII beetle wounds and frass in Populus tremuloides P. redivivus JB052 unknown P. redivivus JB129 compost pile P. redivivus MT8872 unknown P. redivivus PS1163 unknown
922
Location
Source
Vietnam Spokane, WA, USA Coeur d’Arlene, ID, USA Coeur d’Arlene, ID, USA Coeur d’Arlene, ID, USA Coeur d’Arlene, ID, USA Spokane, WA, USA Spokane, WA, USA Spokane, WA, USA Brazil Riverside, CA, USA Missouri, USA Rothamsted Research, UK
C. Womersley J. Kerrigan J. Kerrigan J. Kerrigan J. Kerrigan J. Kerrigan J. Kerrigan J. Kerrigan J. Kerrigan C. Winters J. Baldwin CGC CGC
GenBank accession DQ408251 DQ408252 DQ408253 DQ408254 DQ408255 DQ145648 DQ408256 DQ408257 DQ408258 DQ145647 DQ421389 DQ408249 DQ408250
Nematology
Phylogeny and taxonomy of Panagrellus
Measurements were made using a Nikon Eclipse E600 DIC microscope and an ocular micrometer, or by using Scion Image software (Frederick, MD, USA) calibrated with a stage micrometer. All specimens representing three Panagrellus species (Table 1), P. ceylonensis (Vietnam isolate), P. dubius (WA and ID isolates) and P. redivivus (isolates JB052, JB129, MT 8872 and PS 1163), were measured using Scion Image software. Type specimens of P. ceylonensis (two males), P. dubius (seven males), P. ludwigi (nine males), P. pycnus (11 males), P. redivivoides (three males) and P. redivivus (12 males) were measured and included in the multivariate analysis (Table 2). Nine morphometric traits of adult males that have been considered key characters for diagnostic purposes (Hechler, 1971; Andrássy, 1984) were used for this study: L, MBD, EP, NL, TL, ABD, SpL, GuL and SpBifL. Initial illustrations were prepared by hand using a drawing tube; these illustrations were then digitised and final drawings prepared using Illustrator® 7.0 software (Adobe Systems, Mountain View, CA, USA). Scanning electron microscopy Formalin fixed (5% aqueous solution for >24 h) nematodes were rinsed in several changes of 0.1 M phosphate buffer (pH 7.0), and post-fixed in 4.0% aqueous OsO4 solution. Post-fixed specimens were rinsed several times in cold 0.1 M phosphate buffer within a 15 min period, dehydrated through a graded series of 20-100% ethanol, and critical point dried using a Tousimis Autosamdri-810 critical point drier. Dried nematodes were mounted in several orientations on double-sided copper tape attached to aluminium stubs. Stubs with mounted nematodes were coated for 3 min with a 25 nm layer of gold palladium in a Hummer V sputter coater (Techniques™). Specimens were observed using a JOEL 35 or XL30-FEG Phillips 35 Scanning Electron Microscope at 10 kV.
ear combination of the input variables (i.e., morphometric characters). The number of PCs is equal to the number of the original character variables, but only the first two to four PCs are typically interpretable in a biological sense as they explain the highest percentage of variation in the data (Reyment et al., 1981). PCA does not require any a priori grouping of the specimens. Consequently, it reveals overall patterns but does not distinguish variation within groups from variation between groups (Thorpe, 1976). For this reason, only the first four PC values were considered in this study. Canonical discriminant analysis (CANDISC) was performed to examine the extent of separation among individuals of each species and to confirm results obtained by PCA. C ROSS - HYBRIDISATION TESTS Reproductive compatibility of Panagrellus was tested considering the following isolates: P. dubius isolates I, II, V and VIII, P. redivivus PS1163, MT8872, JB129 and JB052. Circa 30 young females (J4) of each isolate were selected from stock cultures and transferred into new baby-food agar plates allowing them to recover, grow and become adults. Young males were also collected from stock cultures and kept in separate dishes until they were fully mature. Assays were done in an incubator at 25◦ C, and monitored every 24 h for 2 consecutive weeks. Mating pairs were established by transferring five males of a given isolate (e.g., P. dubius isolate I) into a dish containing five females of another isolate (e.g., P. dubius isolate VIII), and vice versa (e.g., females of P. dubius isolate I with males of P. dubius isolate VIII). Positive controls consisted of dishes containing five males and five females of the same isolate. Breeding was considered successful when progeny production was observed. The progeny from each plate was collected and transferred to fresh agar plates so that a hybrid line could be established. Mating combinations are given in Table 3.
M ULTIVARIATE ANALYSIS M OLECULAR CHARACTERISATION The utility of individual morphometric characters, particularly those emphasised previously for diagnostic purposes, was assessed by means of multivariate statistics. Variation in the specified morphological characters among isolates and species was examined through principal component (PCA) and canonical discriminant (CAN) analyses using SAS software (SAS version 8.2, Cary, NC, USA). The analysis was performed on the selected morphometric variables, and a series of new variables (principal components or PC) were generated. In PCA, each PC is a linVol. 8(6), 2006
DNA amplification and sequencing Nucleic acid preparations used for Polymerase Chain Reaction (PCR) amplifications of Panagrellus spp. were extracted from pools of 10-50 adults obtained from in vitro cultures. For outgroup rooting of the phylogenetic trees, two panagrolaimid taxa, Plectonchus hunti Stock, De Ley, Mundo-Ocampo, Baldwin & Nadler, 2002 (GenBank accession DQ145652) and Panagrobelus stammeri Rühm, 1956 (GenBank accession DQ145649) were also 923
924
L
MBD
LrD
StL
StD
NL
CL
IL
BbL
EP
NR
TL
ABD
TRL
GL
760-1010 – – – – – – – – – – – – – – (900) P. dubius isolate I 830-1034 34-51 7-11 8-10 3.5-5.5 140-170 78.5-99 23-47 21-29 96-138 103-137 103-128 29-36 83.5-136 427-655 (936) (44) (9) (9) (4.5) (162) (90.5) (38) (25) (125) (125) (119) (33) (104.5) (529) P. dubius isolate II 768-1112 33-46 10-18 7-18 3-10 111-195 62-128 20-47 21-34 95-154 88-150 67-127 26-44 68-168 511-867 (946) (39) (13) (11) (6) (158) (98) (34) (28) (131) (124) (102) (34) (109) (681) P. dubius isolate III 727-1075 33-44 8.5-12 6-10 3-5 118-172 60-98 24-43 21-29 81-125 83-132 99-111 21-35 109-144 476-668 (910) (37) (10) (8) (4) (141) (77) (33) (26) (98) (102) (103) (28.5) (122) (576) P. dubius isolate IV 901-1075 22-49 9-13 9-11 4-5 147-169 79-97 30-39 24-30 112-133 101-131 98-116 30-38 65-131 346-786 (980) (36) (110) (10) (4.5) (160) (90) (34) (27) (124) (118) (106) (34) (108) (562) P. dubius isolate V 846-1054 28-46 8.5-14 4-12 4-11 160-180 92-117 26-41 23-28 126-162 123-148 109-150 28-39 72-108 409-713 (935) (36) (11.5) (9) (5) (171) (101) (36) (26) (144) (133) (120) (33) (91) (541) P. dubius isolate VI 837-1178 40-47 10-13 11-13 4.5-6.5 146-172 82-97 29-44 21-26 107-130 118-148 98-136 32-39 106-239 490-750 (1057) (44) (11) (12) (5.5) (163) (93) (36.5) (24) (118) (139) (119) (35) (145) (647) P. dubius isolate VII 840-1100 40-45 10-12 11-12 4-6 150-175 85-95 30-45 20-27 110-128 120-145 99-130 30-36 105-189 458-523 (1050) (42) (11) (11.5) (50 (165) (90) (35) (25) (117) (135) (115) (33) (135) (498) P. dubius isolate VIII 778-1100 26-47 6-14 7-15 3.5-6 140-229 82-147 33-55 19-34 93-116 103-179 103-183 24-53 24-53 98.5-166 (890) (37) (8) (11) (5) (178) (101) (44) (26) (105) (127) (129) (32) (32) (129) P. ceylonensis (type)* 1090-1180 – – 13-14 – – – – – – – – – – – P. ceylonensis 1056-1230 40-51 13-16 11-13.5 5-9 159-209 87-125 28-44 28-41 118-163 119-144 151-180 32-47 110-188 662-753 (1150) (45) (14) (12) (6) (175) (101) (35) (32) (129) (134) (169) (38) (136) (700) P. redivivus (type)* 867-870 – – 8-11 – – – – – – – – – – – P. redivivus 705-962 23-38.5 6-15 8-15 4-7 141-250 91-153 33-56 22-37 109-232 107-179 93-163 23-35 62-108 373-584 isolate JB129 (801) (30.5) (10) (10) (5) (173) (110) (38) (29) (123) (140) (123) (29) (84) (459) P. redivivus JB052 700-915 27-33 4.5-7.5 5.5-9 3.5-5 165-190 94-121 32-62 24-35 116-135 104-113 100-134 23-29 52-85 409-524 (784) (30) (5.5) (7.5) (4.5) (176) (108) (46) (26) (125) (108) (117) (25) (71) (453) P. redivivus PS1163 1287-1625 46-56 8.5-12 8-14 3-6 176-190 94-105 34-49 26-33 122-142 104-162 88-122 24-42 106-210 863-1025 (1483) (53) (11) (10) (5) (182) (101) (44) (30) (136) (140) (108) (35) (143) (963) P. redivivus MT8872 1200-1598 45-54 8-12 8-13.5 3-6 175-192 92-187 35-48 25-31 121-140 105-160 88-121 25-40 106-210 863-1024 (1482) (52) (11) (10.5) (5) (183) (105) (45) (29) (135) (141) (110) (35) (144) (962) P. ludwigi (type) 700-900 32-38 7-10 – – 164-175 85-95 35-48 24-32 – – 97-115 27-32 – – (835) (35) (9) (170) (90) (45) (27) (105) (29) P. redivivoides (type) 800-1095 32-37 7-10 – – 162-174 83-94 34-45 24-33 – – – – (830) (35) (9) (170) (87) (42) (28) P. pycnus (type) 900-1170 34-40 7.5-11 – – 165-179 95-187 38-49 25-38 – – – – (1035) (38) (10) (175) (118) (44) (33)
P. dubius (type)*
(n = 20)
Table 2. Summary of morphometric data of Panagrellus species/isolates considered in this study. All measurements are in µm and in the form: range (mean). Characters Species/isolate
S.P. Stock & S.A. Nadler
Nematology
Vol. 8(6), 2006
52-72
77.5-94 (86) 55-80 (68) 80-85 (81) 63-74 (69) 59-73 (65.5) 61-70 (64) 58-71 (68) 80-94.5 (86) 76-90 83-99 (92) 51-61
P. dubius (type)*
P. dubius isolate I
7-11 (8.5) 8.5-13 (11) 8-11.5 (9.6) 15-19 (16.5) 14-17 (15) 10-15 (12) 9-11 (10) 8.5-13 (10) – 9-15 (13) –
–
ratio a
ratio b
ratio c
D
E
* Specimens poorly preserved, certain morphometric data could not be obtained.
25-36 26.2-30.3 5.3-5.7 8.4-10.1 – – (29) (5.4) (9.3) 31-41.5 18-25 5.3-6.3 6.9-8.7 87-116 80-116 (35.5) (22) (5.8) 97.9) (110) (105) 20-35 20-29 5.2-7.8 7.8-15.7 80-150 90-180 (27) (25) (6.1) (9.4) (110) (130) 29-35 21-27 4.9-7.5 7.3-10.4 60-80 80-120 (32) (25) (6.5) (8.8) (70) (90) 20-34 19-48 2.1-5.5 8.4-105 70-85 103-130 (25) (29) (5.2) (9.3) (80) (120) 21-34 20-34 5.2-6.1 5.7-7.9 70-100 100-130 (25) (26) (5.4) (8.9) (80) (120) 22-32 19-26 5.7-6.9 8.2-9.9 80-100 1.0-1.3 (25) (24) (6.5) (8.9) (90) (1.2) 27-30 20-25 5.5-6.8 8.1-8.9 80-100 1.0-1.3 (28) (23) (6.3) (8.7) (90) (120) 29-35 19-31 4.2-8.3 5.4-9.2 50-110 60-110 (28) (25) (5.4) (6.9) (60) (80) 34 27-29 5.3-6.1 7.3-9.7 – – 28-36 23-29 9.5-13 6.4-7.2 110-150 75-90 (32) (26) (11.5) (6.8) (130) (80) 24-32 22-35.4 4.1-7.8 6.9-11.5 – – (29.3) (6.5) (9.2) 17-28 20-36 3-6 5-9 70-150 110-160 (21) (27) (4.7) (7) (90) (130) 21-28 24-29 4-8 6-8 60-70 80-110 (25) (27) (4.5) (6.7) (65) (90) 27-31 25-31 6.8-9.2 11-17 60-90 100-160 (29) (28) (8.1) (14) (0.8) (130) 25-34 24-29 7-9 12-15 60-90 100-150 (28) (27) (8) (13) (75) (130) 14-17 18.6-22.5 5.84-5.87 5.87-6.75 – – 10-18 20.3-32.7 4.5-6.1 7.9-11.8 – – (13.9) (25.7) (5.0) (9.6) 25-27 20.6-26.9 5.7-7.4 7.9-10.4 – – (26) (24.5) (6.4) (9.0)
SpBifL GuL
52-88 4-7 (67) (5) 68-74 5.5-10 (80) (7) P. redivivus PS1163 61-72 3-5 (67) (4) P. redivivus TM8872 64-75 3-5 (68) (4) P. ludwigi (type)* 23-24 – P. redivivoides 21-34 – (type) (26.8) P. pycnus (type)* 60-70 (64.8) –
P. ceylonensis (type)* P. ceylonensis (Vietnam isolate) P. redivivus (type)* P. redivivus isolate JB129 P. redivivus JB052
P. dubius isolate VIII
P. dubius isolate VII
P. dubius isolate VI
P. dubius isolate V
P. dubius isolate IV
P. dubius isolate III
P. dubius isolate II
SpL
Species/isolate (n = 20)
Table 2. (Continued).
–
9-17 (13) 8.2-13 (11) 13.6-19.8 (15.7) 14-18 (14.5) – –
–
8.2-12.3 (9.9) 13-23 (16) 7-11 (8.6) 22-28 (24) 19.5-25 (23) 16-24 (19) 17-23 (19) 10.5-15 (12) –
– 2.4-2.9 (2.6) 1.5-3.7 (2.1) 2.3-3.8 (2.9) 1.8-2.7 (2.2) 1.7-2.6 (2) 1.8-2.0 (1.9) 1.7-1.9 (1.8) 1.8-3.5 (2.9) – 2.1-2.9 (2.4) –
–
SpL/ ABD
–
–
–
–
–
61.5-95 (78) 58-68 (71) 59-88 (77) 61-86 (75) – –
11.5-14 (13) 6-13 (11) 9.6-13.6 (11.5) 9.5-12 (11) 11-17 (13) 9.2-13.6 (11.3) 9.5-13 (11.5) 11-18.5 (15) – 13-15 (14) –
–
TL (%L)
–
–
64-118 12-21 (88) (15) 67-76 13-16 (71) (15) 69-79 6-9 (74.5) (7) 68-75 7-10 (72) (8) – – – –
65-86 (74) 65-102 (79) 66-76 (72) 68-83 (74) 68-832 (77) 81-91 (85) 82-90 (86) 67-78 (72) – 86-105 (97) –
–
EP NR (%NL) (%NL)
1.8-3.9 68-85 (2.5) (77) 1.8-3.3 70-113 (2.4) (84) 0.7-1.2 567-74 (0.8) (69) 2.2-3.0 70-83 (2.7) (78) 2.3-4.6 70-82 (2.9) (77) 2.2-3.3 63-78 (2.6) (72) 2.3-3.2 64-76 (2.7) (70) 1.8-2.7 48-79 (2.3) (62) – – 3.5-4.4 113-146 (4.0) (134) – –
–
CL/IL
0.7-1.7 7.5-12.5 2.2-4.2 (1.0) (9.5) (2.9) 1.1-1.6 2.7-3.3 1.9-2.9 (1.4) (3) (2.5) 0.6-1.4 1.6-2.5 2-3 (0.9) (2.0) (2.5) 0.9-1.5 2.9-3.4 2-3 (1.0) (2.6) (2.5) – – – – – –
0.8-1.3 (10.9) 0.6-1.1 (0.9) 0.7-1.0 (0.8) 1.0-1.3 (1.2) 0.8-2.7 (1.9) 0.9-1.3 (1.1) 0.9-1.1 (1.0) 1.7-3 (2.4) – 0.2-0.3 (0.25) –
–
SpBifL./SpL StL/ (%) LRD
Phylogeny and taxonomy of Panagrellus
925
S.P. Stock & S.A. Nadler
Table 3. Cross-hybridisation between selected Panagrellus isolates.
1. P. dubius I 2. P. dubius II 3. P. dubius V 4. P. dubius VIII 5. P. redivivus JB052 6. P. redivivus JB129 7. P. redivivus PS1163 8. P. redivivus MT8872
1
2
3
4
5
6
7
8
+ + + + – – – –
+ + + – – – –
+ + – – – –
+ – – – –
+ + – –
+ + +
+ +
+
Positive breeding is represented by + and absence of breeding by −.
amplified and sequenced. Criteria for selection of these two taxa for outgroup rooting was based on results from a phylogenetic study of Cephaloboidea using LSU rDNA sequences, which supports P. hunti and P. stammeri as more closely related to Panagrellus than other Panagrolaimidae taxa (Nadler et al., 2006). For nucleic acid extraction, nematode pools were incubated at 50◦ C in pH 8.0 TE buffer (Ausubel et al., 1989) containing proteinase K (1 µg µl−1 final concentration) and digested until only cuticle remained. Nucleic acids were extracted from the digestion supernatant using phenol-chloroform enrichment, ethanol/ammonium acetate precipitation (Ausubel et al., 1989). The resulting pellet was washed with 70% ethanol, resuspended in TE buffer (pH 8.0), treated with 50 µg of RNAse A (1 h at 37◦ C), and DNA recovered following reprecipitation with ethanol. DNA was quantified by spectrophotometry, and 100-200 ng used per PCR reaction. PCR was used to amplify a region within the 5 -end of the nuclear large-subunit (LSU) ribosomal DNA that included the D2 and D3 domains. Design of the forward PCR primer no. 391 (5 -AGCGGAGGAAAAGAAACT AA) was described in Nadler and Hudspeth (1998). The reverse primer no. 501 (5 -TCGGAAGGAACCAGCTA CTA) was designed by Thomas et al. (1997). Two alternative reverse PCR primers, no. 535 (5 -TAGTCTTTCGC CCCTATAC) and no. 536 (5 -CAGCTATCCTGAGGG AAAC), were designed for this study. Proofreading polymerase (ID Proof, ID Labs Biotechnology, or Finnzymes DyNAzyme EXT; MJ Research, Waltham, MA, USA) was used for PCR amplification. Typical PCR reactions included 0.5 µM of each primer, 200 µM deoxynucleoside triphosphates, and MgCl2 concentration of 2 mM in a total reaction volume of 25 µl. PCR conditions, e.g., annealing temperature and MgCl2 concentration, were adjusted empirically as needed to optimise reaction speci926
ficity for individual isolates; typical conditions included denaturation at 94◦ C for 3 min, followed by 33 cycles of 94◦ C for 30 s, 52◦ C for 30 s, and 72◦ C for 1 min, followed by a post-amplification extension at 72◦ C for 7 min. One µl of each PCR product was used for agarose gel electrophoresis (1.3% agarose in 1 × TBE buffer) to confirm amplicon size and yield. PCR products were prepared for direct sequencing using enzymatic treatment with exonuclease I and shrimp alkaline phosphatase (PCR product pre-sequencing kit; USB Corporation, Cleveland, OH, USA). Sequencing reactions were performed using dye-terminator cycle sequencing chemistry and reaction products were separated and detected using an ABI 3730 automated DNA Sequencer. Sequences for each species were completely double-stranded for accuracy using the PCR primers and two internal sequencing primers. The forward internal primer was no. 504 (5 CAAGTACCGTGAGGGAAAGTTG), and the reverse internal primer no. 503 (5 -CCTTGGTCCGTGTTTCAAGA CG). LSU sequences have been deposited in GenBank (see Table 1). Sequence analysis Contig assembly and sequence conflict resolution were performed with the aid of Sequencher v 3.0 (Gene Codes, Ann Arbor, MI, USA). Sequence regions corresponding to the PCR amplification primers were removed prior to multiple sequence alignment and phylogenetic analysis as primer incorporation during amplification masks potential mismatches (substitutions) that may occur in PCR priming sites. Sequences were aligned using ProAlign Version 0.5 (Loytynoja & Milinkovitch, 2003). A ProAlign guide tree was constructed using corrected (for multiple hits) pair-wise distances, and this tree was used to estimate the hidden Markov model parameters (δ and ε) for progressive multiple alignment. For this LSU rDNA region of Panagrellus spp. (and outgroups), this yielded an alignment of 993 characters (the ‘full alignment’ or LSU FA). The effect of alignment ambiguity on phylogenetic analysis of these LSU data was explored by using the average minimum posterior probability of sites as the criterion for detecting and removing unreliably aligned sequence, since this value is strongly correlated with correctness as determined by simulation studies (Loytynoja & Milinkovitch, 2003). To reduce the likelihood of excluding correctly aligned sites, the filter threshold was set to 60% minimum posterior probability, a value intermediate between the threshold of posterior probabilities for correctly vs incorrectly aligned sites in most simulaNematology
Phylogeny and taxonomy of Panagrellus
Morphological analysis and character evolution
tion results (Loytynoja & Milinkovitch, 2003). This filtering excluded 95 characters of the FA; this filtered dataset (‘minus uncertainty’ or LSU MUNC) was also used as a data matrix for phylogenetic analysis. As an alternative approach intermediate between using all aligned sites and removing characters based on a posterior-probability threshold, a dataset was constructed that included all aligned sites, but with each character weighted according to its estimated posterior probability (LSU WHTS). All molecular (LSU MUNC dataset) and morphological characters (see following section) were also analysed as a combined evidence dataset. Data were analysed by maximum parsimony (MP) using PAUP* v 4.0b10 (Swofford, 2000). Gap states (which did not occur among the ingroup taxa) were treated as missing data. Tree searches for these LSU and combined datasets were performed using the branch-and-bound option. Reported consistency indices (C.I.) do not include uninformative characters. Bootstrap parsimony analyses were performed using branch-and-bound searches with 1000 pseudoreplicates. Datasets and tree-files from analyses have been deposited in TreeBASE (Sanderson et al., 1994).
A total of 15 morphological characteristics (ten qualitative and five quantitative), including those typically used for diagnosis of species were evaluated (Table 4). Range, mean, and standard deviation were determined for five quantitative characteristics. For cladistic analysis, continuous traits were coded as discrete states employing Simon’s (1983) homogenous subset coding method. Oneway analysis of variance (ANOVA) was conducted for character values across the taxa using MSTAT-C v.2.0 (Freed, 1991). For all characters, groups were defined that were significantly different at P < 0.05. This method confirmed the statistical distinctiveness of the groups within the sample, which is required for the application of subset gap coding. Finally, an a posteriori multiple comparisons test (Student-Newman-Keul’s multiple range test) was performed to establish the subsets (character-states) within each quantitative character. Maximum parsimony analysis of morphological data was performed using PAUP* with all characters unordered and weighted equally. Searches for the most parsimonious trees were performed as described previously for the molecular datasets.
Table 4. Morphological characters and character states for Panagrellus species/isolates.
Panagrobelus stammeri Plectonchus hunti P. redivivus JB052 P. redivivus JB129 P. redivivus (MT8872) P. redivivus (PS1163) P. ceylonensis (Vietnam) P. dubius (isolate I) P. dubius (isolate II) P. dubius (isolate III) P. dubius (isolate IV) P. dubius (isolate V) P. dubius (isolate VI) P. dubius (isolate VII) P. dubius (isolate VIII)
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
0 1 1 1 1 1 1 1 1 1 1 1 1 1 1
0 0 1 1 1 1 1 1 1 1 1 1 1 1 1
0 0 1 1 1 1 1 1 1 1 1 1 1 1 1
0 0 1 1 1 1 1 1 1 1 1 1 1 1 1
0 0 1 1 1 1 1 1 1 1 1 1 1 1 1
0 0 1 1 1 1 1 1 1 1 1 1 1 1 1
0 1 1 1 1 1 1 1 1 1 1 1 1 1 1
0 1 1 1 1 1 1 1 1 1 1 1 1 1 1
? 0 0 0 0 0 1 2 2 2 2 2 2 2 2
1 0 2 2 2 2 2 2 2 2 2 2 2 2 2
0 1 1 1 1 1 1 1 1 1 1 1 1 1 1
0 0 1 1 1 1 1 1 1 1 1 1 1 1 1
0 1 1 1 1 1 1 1 1 0 0 0 1 1 0
0 2 1 1 1 1 1 1 1 1 1 1 1 1 1
0 0 1 1 1 1 1 1 1 1 1 1 1 1 1
Characters: 1. Lip region: (0) crown-shaped, (1) not crown-shaped; 2. Stegostom: (0) half or more than stoma length, (1) shorter than stoma length; 3. Spermatheca: (0) present, offset, (1) present, axial; 4. Vagina: (0) without muscular sheath, (1) with muscular sheath; 5. Postvulval sac: (0) absent, (1) present; 6. Spicule length: (0) 50 µm; 7. Gubernaculum shape: (0) subtriangular, (1) thin elongate; 8. Spicule tip: (0) hook-like, (1) bifid; 9. Spicule bifurcation length: (0) 10% length of spicule; 10. Vulval lips: (0) very protruding, symmetrical; (1) protruding, asymmetrical; (2) slightly protruding, asymmetrical; 11. Spicule lamina: (0) without rostrum, (1) with rostrum; 12. Male tail shape: (0) conoid-blunt, (1) flagellum-like; 13. Male D%: (0) >90, (1) 90; 14. Male E%: (0) 150; 15. Male tail length (as % of L): (0)
