Morphological and molecular investigation of

Zoological Journal of the Linnean Society (2001), 131: 363-379. With 17 figures doi: 10.1006/zjls.2000.0235, available online at httpJ/www.ideallbrary.com on

e

IDEkL@

1

Morphological and molecular investigation of polymorphism and cryptic species in tanaid crustaceans: implications for tanaid systematics and biodiversity estimates KIM LARSEN* Department of Biological Sciences, Macquarie University, Sydney, N S W 2109, Australia Received July 1999; accepted for publication February 2000

A combination of traditional taxonomic procedures and molecular techniques has provided new insight into the problems of cryptic species and sexual and ontogenetic polymorphism in the Tanaidacea. Using polymerase chain reaction and DNA markers, three cryptic species of Paratanais were identified. PCR primers were used to amplify the divergent internal transcribed spacers (ITS) of these species. Restriction digestion of the amplified rDNA generated species specific DNA banding. Male and five female stages of Paratanais maleficus sp. nov. and two other new species, P. malignus and P. perturbatius, are described. Morphological variation, both sexual and ontogenetic, was found in several generic characters of Paratanais and required the diagnosis to be modified. The identification of three undescribed cryptic species from a single microhabitat in a well studied, shallow water and easily accessible locality, demonstrate that the biodiversity of tanaid crustacean is significantly underestimated. O 2001 The Linnean Society of London

ADDITIONAL KEYWORDS: Tanaidacea - Peracarida - polymorphism - cryptic species - biodiversity estimation - DNA amplification.

INTRODUCTION Differentiation among species of tanaidaceans is notoriously difficult. Members of the suborder Tanaidomorpha present problems due to their small size (1-3 mm) and the currently unresolved systematics of this group. In most families (Paratanaidae, Leptocheliidae, Typhlotanaidae and most genera of Anarthruridae) polymorphic males and ontogenetic variation present a n additional obstacle. Male polymorphism in tanaidaceans is the consequence of a peculiar reproductive strategy involving protogynous hermaphroditism (Lang, 1973; Sieg, 1983; Schram, 1986). Adult males are non-feeding terminal stages devoted solely to reproduction. Since females live in tubes, which they do not leave voluntarily, males locate females by roaming the substrate. This activity exposes males to a high predation pressure that, combined with their non-feeding life-style, makes male life span

* Present address: Gulf Coast Research Lab, Ocean Spring, MS 35564, U.S.A. E-mail: [email protected] 00244082/01/030353 + 27 $35.00/0

short. In situations where depletion of males from the population occurs, females may molt into males a t several different instars. Thus, males can originate from (1) a juvenile male (primary male), (2) a female having had the first brood (secondary male), (3) a female having had two broods (tertiary males) and possibly also at later developmental stages (BuckleRamirez, 1965; Sieg, 1978, 1983; Highsmith, 1982, 1983; Stoner, 1986; Modlin & Harris, 1989). Primary male morphology is radically different from female and from secondary and tertiary males, which also differ from each other (Buckle-Ramirez, 1965; Sieg, 1978, 1983; Schram, 1986). Therefore, species assignment of males in these families is dubious. The problem has been identified in cultures (Buckle-Ramirez, 1965) and from large-scale population studies (NIasunari, 1983). However, under normal collection procedures, and particularly in divers' deep-sea collections, identifying males to species is unlikely unless these are caught inside a female's tube. Sexual polymorphism is, however, not the only obstacle for the systematics of Tanaidacea. Ontogenetic

353

O 2001 The Linnean Society of London

354

K. LARSEN

variation presents a n additional problem. Even familylevel characters, such as uropod articulation and relative pereonite length, have been shown to vary considerably according to developmental stage (Lang, 1953; Masunari, 1983; Bird & Holdich, 1985; Larsen & Wilson, 1998). Species-level features, such as number of maxillule spiniform setae and maxilliped armament, have also been reported to vary with development (Larsen & Wilson, 1998). To obtain information about the extent of these problems and to identify a method to overcome them, molecular techniques and traditional taxonomic procedures were combined and applied to a shallow-water tanaidacean fauna inhabiting kelp in Botany Bay, Australia. This epifauna consists mainly of apseudomorphs (which have no significant sexual dimorphism) and Paratanais. Species of Paratanais, which are difficult to identify because of systematic coniusion (Sieg, 1984) and the presence of cryptic species, also have considerable sexual polymorphism (Sieg, 1983). Paratanais are thus a suitable subject for a study of this type. The primers ITS1 and ITS4 (White et al., 1990) were applied in this study. These primers were originally designed to amplify fungal rDNA, but also amplify the non-coding spacers and the 5.8 S rDNA gene between the 18 S and 28s rDNAs of several invertebrate taxa (Gillings, 1996) as well as other organisms (White et al., 1990). While molecular techniques have been applied to other arthropods (Boge, Gerstmeier & Einspanier, 1994) as well as Crustacea (Bulnheim & Scholl, 1981) for species identification, they have so far mainly been applied to peracarids for phylogenetic reconstruction (Meyran, Monnerot & Taberlet, 1997; Kobusch, 1998; Spears & Abele, 1998). This is the first time that DNA amplification techniques are used to reveal sexual and ontogenetic polymorphism in peracarid crustaceans. MATERIAL AND METHODS COLLECTION

Kelp (Echlonia radiata), within an area of approximately 5 m', was collected by SCUBA in Frenchman's Bay (33'85 S 151°13E), Botany Bay, Australia. The tanaidaceans occurred as epifauna on the kelp taken at 4-4.5 m depth. At the shore, the kelp holdfast and thallus were separated and briefly washed separately in fresh water to osmotically shock and release the epifauna. This procedure forced tanaidaceans, other tube dwelling organisms and free-living epifauna from the kelp, greatly facilitating the sorting procedure. Specimens were transferred back into seawater for transport to the laboratory where they were sorted live and preserved in 90% alcohol. Specimens are deposited in the Australian Museum (AM).

Specimens of Paratanais and unidentified apseudomorphan specimens occurred, both on the thallus and holdfast region of the kelp, but Paratanais is more abundant in the holdfast region. A few specimens of an undescribed species Leptochelia were found only on the thallus. TAXONOMIC PROCEDURES

Specimens of Paratanais were separated into morphological working groups (Table 1) according to the following criteria: (1) sex, (2) colour, (3) uropod length, (4) developmental stage, and (5) adult length. Three specimens from each group were then dissected to confirm homogeneity within the group (except from the male group from which only one specimen was used due to the small number of male specimens). Representztives were then selected for DNA extraction, for SEM and for intact museum specimens. 2

SEM PREPARATION Specimens were slowly rehydrated in demineralized water. A few drops of TWEEN 80 were added to release surface tension. Specimens were then sonicated for 5 min and slowly taken to 100% ethanol. The ethanol was then exchanged for a solution of 50% absolute ethanol and 50% hexamethyldisilazane for 30 min, in 100% hexamethyldisilazane for 30 min and air dried under cover for 12h. Specimens were mounted on stubs, sputter coated for 4 min with gold-palladium and examined in a JEOL JSM-840 SEM. MOLECULAR TECHNIQUES

DNA extraction

Before DNA extraction, specimens were transferred to 1.5m1 Eppendorf tubes and the ethanol removed.

SDS phenol extraction A series of specimens were carefully ground in 150 p1 TNE [25 mM Tris-HCl (pH 8.0), 100mM NaCl, 100mM EDTA] using a sterile plastic pestle. A further 200 p1 TNE, 100 ~ 1 2 0 % (w/v) SDS and 350 p1 Tris-equilibrated phenol (Sambrook, Fritsch & Maniatis, 1989) were added. The tubes were briefly vortexed and stored overnight a t 4°C. 300 p1 chloroform isoamylaIcohol(24: 1 w/v) was added to each tube, briefly vortexed and centrifuged (10 min a t 12 000 rpm). Supernatant (4001.11) was recovered and DNA precipitated with 850 p1 absolute ethanol at -20°C for 1h. After centrifugation (10 min, 12 000 rpm), DNA pellet was washed in 80 11170% ethanol, 100 mM Na acetate. After air-drying for lomin, the pellet was resuspended in 30 p1 TE (10 mM Tris-HC1 pH 7.6, 1 mM EDTA) a t 4°C overnight.

356

K. LARSEN

Chelex 100 extraction A series of 10 other specimens were homogenized and boiled for 10 min in 100 p1 Chelex suspension (10 mM Tris pH8.0, 0.1 mM EDTA, 5% Chelex 100). Immediately after boiling, specimens were put on ice for 3 min, briefly vortexed and centrifuged (3 min, 12 000 rpm). Supernatant (75 p1) was transferred to a new tube on ice until PCR.

Amplification of the rDNA ITS regLon The rDNA internal transcribed spacer (ITS) region was targeted with the universal primers ITSl and ITS4. ITSl as the forward primer (5' TCCGTAGGTGAACCTGCGG) and ITS4 as the reversed primer (5' TCCTCCGCTTATTGATATGC) (White et al., 1990). These primers are based on conserved regions in the 18 S and 28 S rDNA genes and amplify the non-coding regions and the 5.8 S rDNA gene between the 18 S and 28 S genes (White et al., 1990). PCR: 11-11DNA (c. 25 ng) was mixed with 8 p1 Gene releaser (Bioventures Inc.) in a 0.5 m1 tube and covered with 2 drops sterile paraffin. Tubes were then heated (on high) in a microwave oven (650-Watt) for 7min (4550 W/min) in a microwave transparent rack (Bioventures). An Erlenrneyer flask containing 100-m1 water was included as a microwave sink. Tubes were incubated for 10 min in a Hybaid thermal cycler (Preheated to 80°C). PCR mastermix (40 1-11)was added to each tube. Final concentrations of reagents were as follows: 20 mM (NH,),SO,, 75 mM Tris-HC1 (pH 9.0), 0.01 5 (w/v) Tween, 2mM MgCl,, 0.5mM of each primer, 0.2mM of each deoxyribunucleotide triphosphate, and 1p1 Red Hot DNA polymerase (Advanced Biotechnologies, Surrey, UK). The thermal cycle was performed as follows: 94°C 3min (1 cycle); 94°C 30 sec, 48°C 30 sec, 72°C 90 sec (35 cycles), 72°C 5 min (1 cycle). The internal transcribed spacer region (ITS) could be successfully amplified from DNA extracted from either SDS/phenol or the Chelex 100 methods. However, the Chelex 100 method was faster and more reliable.

GEL ELECTROPHORESIS

First amplification gel (Fig. l) A gel electrophoresis was made on the amplified DNA. This gel included a 100-bp ladder in each of the fringing wells. TWOpositive controls, mite DNA (Phytoseid sp.) and fungi DNA (Agaricus bisporus), both previously known to amplify with the primers and two negative

controls, sterile water and pure genreleaser, were included. Specimen DNA from all morphological groupings (and from one Apseudomorpha specimen for comparison of genetic distance), were examined. Genomic DNA and PCR products were separated by electrophoresis on 2% agarose gels cast and run in TBE buffer (45 mM Tris-borate, 1mM EDTA, pH 8.3, (Sambrook, Fritsch & Maniatis, 1989). DNA extraction gels were stained with ethidium bromide ( l mg/ml). Restriction digestion gels was stained in Sybr Green (1:10000). All gels were stained for 30min, briefly rinsed, and photographed with Polaroid film in transmitted UV light. All gels had a 100-bp ladder (Pharmacia) in the terminal wells. Restriction digestion of amplified ITS (Fig. 2) To investigate any sequence differences that might be present in the ITS fragments amplified from different specimens, each PCR product was separately digested with the restriction enzymes Hinf 1and Cfo 1.Aliquots (25 1-11) of amplified ITS from nine specimens were digested separately with the two restriction enzymes according to the manufacturer's instructions (Promega). The size of the fragments was estimated by electrophoresis in comparison with a 100 base pair molecular weight marker.

RESULTS MOLECULAR RESULTS

Amplification of tanaidacean DNA using the primers of White et al. (1990) generated several different banding patterns for specimens separated into morphological groupings (Table 1). Morphotypes 1,3,4,5 had identical bands of 600 and 1000 bp (Fig. 1, lanes b,d,e,f). Morphotype 2 had the same 600 bp band but variation in the l000 bp band (Fig. 1, lane c). Other morphotypes 6-9 lacked the 600 band (Fig. 1, lanes i-l) and also showed minor variation in the 1000 bp band. The samples with a 600 and a 1000 bp band, showed identical banding after treatment with the two restriction enzymes Hinf 1 and Cfo 1 (Fig. 2, lanes g-j) and these morphotypes could thus be assigned to the same species, regardless of morphology. Morphotype 2 (male), although with small variation in the 1000 bp band, showed identical banding after restriction digestion as the above mentioned groups, (Fig. 2, lane f) and could thus also be assigned to the same species. The initial variation in the lOOObp band of morphotype 2 is thus here attributed to sexual genetic variation. The samples without the 600 band and with variation in the lOOObp band, could after restriction digestion (Fig. 2, lanes b-e) be divided into two genotypes (morphotypes 6 & 7 and 8 & 9) differing substantially from each other

POLYMORPHIC AND CRYPTIC TANAID SPECIES

a

b

c

d

e

f

a

h

i

i

k

l

m

n

o

p

357

q

Figure 1. Amplification of the internal transcribed spacer region (ITS1 + 5.8s + ITS2) of the ribosomal gene separated on 2% agarose gels and stained with ethidium bromide. Tracks as follows: (a) 100 base pair ladder molecular weight marker (Pharmacia). (b) Morphotype 1. (c) Morphotype 2. (d) Morphotype 3. (e) Morphotype 4. (f) Morphotype 5. (g) Apseudomorpha sp. (h) 100 base pair ladder. (i) Morphotype 6. 6)Morphotype 7. (k)Morphotype 8. (1) Morphotype 9. (m) Positive control, fungi (Agaricus bisporus). (n) Positive control, mite (Phytoseid sp). Negative control, genreleaser only. (p) Negative control, H 2 0 only. (q) 100 base pair ladder.

Hinf 1 a

b

c

d

e

f

g

h

i

j

k

a

b

c

d

e

f

g

h

i

j

k

Figure 2. Restriction enzyme analysis of ITS fragments. PCR products digested with Hinf 1 (left panel) or Cfo 1(right panel), separated on 2% agarose gels and stained with 1:10000 sybr. green. Tracks as follows: (a) and (k) are a 100 base pair ladder molecular weight marker (Pharmacia). @I)l? malignus sp. nov., large adult female. (c) E! malignus sp. nov., manca. (d) E! perturbatius sp. nov., small adult female. (e) E! perturbatius sp. nov., manca. ( f ) E! maleficus sp. nov., male. (g) E! maleficus sp. nov., middle sized adult female. (h) E! maleficus sp. nov., large adult female. (i) E! maleficus sp. nov., manca 11. (j) E! maleficus sp. nov, small ovigerous adult.

with both restriction enzymes. Because banding patterns differ, two separate species must be present (Fig. 2, lanes b-e). The A ~ s e u d o m o r ~ hsample a (Fig. 1, lane g) differed markedly by having a 1400bp band and lacked the l000 bp band found i n all the Paratanais samples tested. The three Paratanais species are described below.

Ecological i~nplications Tanaidaceans can occur a t high densities, often exceeding 10 000 individuals/m2 (Woodin, 1974; Johnson & Attrarnadal, 1982; Highsmith, 1982, 1983; BaileyBrock, 1984; Modlin & Harris, 1989), with reports of over 140000 individuals/rn2 (Delille, Guidi & Soyer, 1985; Krasnow, 1992). Despite the obvious ecological

358

K. LARSEN

importance displayed by such population sizes, tanaidaceans are neglected in most ecological surveys. Ecological studies from both shallow waters (Pires, 1980) and deep waters (Sokolova, 1972), indicate that tanaidaceans cannot be ignored. Several other authors have acknowledged the lack of tanaid data in ecological studies (Sergerstrgle, 1962; Thorson, 1966; Woodin, 1976; Peterson, 1977; Wilson, 1980, 1981). Beside the three new species of Paratanais and several other undescribed species of tanaidaceans, at least 20 species of isopods (G. Wilson, pers. comm.) and a large number of undescribed amphipods was also found in the same area (approx. 5 m2) Finding a large number of undescribed species in such a small area in a relatively well examined body of water has implications. The universities in Sydney have regular collection excursions to Botany Bay and the Australian AIT..-Fl--l----------l --ll--L ~ v ~ u n a aam l s u u a a never iu C U I L ~ L L ~ IbI ~ ~ i l ~ i vin ~ i'ine s bay. The large number of underscribed species found during this study demonstrates that the global biodiversity of peracarid crustaceans could be seriously underestimated. Furthermore the finding of cryptic tanaidacean species indicate even higher diversity. Cryptic tanaidaceans are also likely to be frequent in the deep sea, considering the large tanaid coniponent of the deep-sea benthos. The global proportion of marine species, has lately been a source of controversy (Grassle, 1991; Grassle & Maciolek, 1992; May, 1992; Poore & Wilson, 1993; Knowlton, 1993; review by Gage, 1996) ranging from 0.5 million (May, 1992) to 100 million species (Grassle & Maciolek, 1992). The finding of cryptic tanaid species supports the higher estimates in the discussion of total marine species richness. .L-L

Male. Sexual dimorphism extensive. Antennule with more than 5 articles and dense pack of aesthetasc. Mouthparts strongly reduced, only a reduced maxilliped and a functional epignath present. GENUS PARATANAIS DANA, 1852

Synonymy Paratanais Dana, 1852a:306, 1852b:792, 798-799. Lilljeborg, 1864:7, 1865:7, 31. Bate & Westwood, 1866: 137. Czerniavski, 1868:88. Thomson,1880:207. Harger, 1880:416,420.Kossman, 1880:102,103.Haswell, 1882: 306. Sars, 1882:31-32. Boas, 1883:551. Blanc, 1884: 198. Claus, 1884:327. Carus, 1886:430. Beddard, 1886: 121, 129. Sars, 1886:315, 316. Norman & Stebbing, 1886:107, 109. Gerstaecker, 1883-1888:293, 297, 315, 517, 532. Stebbing, 1893:323, 1896:157. Sars, 1896: 16.-Smith, 1906:324-326. Richardson, 1907:2. Hansen, 1913:2, 34. Nierstrasz, 1913:38.-Barnard, 1920:329. Monod, 1923:38, 44. Zimmer, 1926:696. Fee, 1927:17. Nierstrasz & Schuurmans Stekhoven, 1930: 143-144. Moers-Messmer, 1936:22. Hacth, 1947:161, 166. Lang, 1949:7, 1956:473. Shiiiio, 1964:192, 1965: 63. Haffer, 1965:189, 190. Kussakin, 1966:326. Shiino, 1968:164. Lang, 1973:197, 218-222. Sieg, 1973:35, 81. Gardiner, 1975:179. Sieg, 1976:71. Marchand, 1977: 125. Sieg, 198023, 11, 12, 1981:1271, 1983a:238, 239, 1983b:479-480. Kudinova-Pasternak, 198557. Sieg, 198656, 57. Dojiri & Sieg, 1997:218, 220. Acanthotanais Kussakin, 1966:326. Lang, 1973:197, 219. Sieg, 1973:35, 1976:179. Type species. Paratanais elongatus (Dana, 1849). Gender. Masculine.

SYSTEMATICS SUBORDER TANAIDOMORPHA SUPERFAMILY PARATANAOIDEA LANG, 1949 FAMILY PARATANAIDAE LANG, 1949

Diagnosis. Modified from Larsen & Wilson (1998). Female. With eyes. Carapace consists of 8 dorsal and lateral plates. Antenna with 6 articles, article 3 with prominent dorsal spiniform seta. Mandible molar well developed. Maxilliped endites broader than basis, with 2 flat teeth and anterolateral corners with setae arising from cuticular depressions. Cheliped attached to cephalothorax via a sclerite. Pereopods 1-3 with coxa. Pereopods 4-6 without coxa, basis twice as thick as that of pereopods 1-3, and with dactylus and terminal spine modified to a hook-shaped claw. Marsupium consists of 4 pairs of oostegites. Pleon with 5 pleonites and well-developed pleopods present. Uropodal endopod with 2 articles. Uropodal exopod with 1 or 2 articles.

Diagnosis. Modified from Lang (1973). Female. Antennule with 5 articles and without long setulose setae. Antenna article 2 without ventral expansion. Pereopod 4-6 with cuticular scales. Pleopod endopod and exopod both with terminal seta. Uropodal exopod with 1 or 2 articles. Male. Eyes 3 times larger than female. Pleonites of almost similar appearance as pereonites. Antennule with 6-11 articles, articles 3 and 4 with dense ventral group of aestlietasc. Pereopod 1 not modified for tube construction. Pereopods 4-6 basis not significantly thicker than that of pereopods 1-3, dactylus and terminal spine not modified to a claw. PARATANAIS MALEFICUS SP. NOV.

(Figs 3-1 0, 16) Material examined One non-ovigerous female holotype, body length 3.7 mm, (AM P54474). Paratypes: 1 male, body length

POLYMORPHIC AND CRYPTIC TANAID SPECIES 1.5 mm (AM P54475). 2 non-ovigerous females, mouthparts and limbs dissected (AM P54476). 1 ovigerous female, body length 2.6mm (AM-P54477). 1 female large variant, body length 4.6mm (AM P54478). Locality: see Material andMethods. Collected by K. Larsen and S. Keable. Types, SEM stubs, slides and remaining specimens are deposited in the AM. Other material Forty-one adult females, 2 adult males + l head and 32 juveniles. Same locality. Diagnosis Left mandible lacina mobilis upper margin serrated. Cheliped dactylus with 2 small spiniform setae on i m c r surface, fixed finger without broad leaf shape:! setae a t dactylus insertion. Uropods longer than pleotelson. Etymology Named to reflect the impact that the variation displayed by this species might have on tanaid systematics. Latin: maleficus = evil-doer. Description: adult female (Figs 3, 4 & 16) Body (Figs 3A, 4A & 16A). Slender, subcylindrical, about 7 times longer than broad. Cephalothorax Length marginally shorter than pereonites 1 and 2 together. Pereonites. All pereonites wider than long. Pereonite 1 length 0.5 width. Pereonites 2 & 3 1.25 length of pereonite 1. Pereonites 4 & 5 length 1.17 of pereonite 3. Pereonite 6 as long as pereonite 2. Pleon. All pleonites subequal, width approximately 4.5 length. Pleotelson length equals length of 2 pleonites, subequal to width of pleonites. Antennule (Fig. 5A). Length 0.75 of cephalothorax. Article 1 marginally shorter than combined length of articles 2-5, width 0.5 length, with 3 distal short simple and 6 medial setae. Article 2 length 0.25 of article 1, width 0.8 length, with 2 short and 1 long simple distal setae. Article 3 length and width subequal, length 0.5 of articles 4-5, with 2 short simple distal setae. Article 4 0.5 length of article 1, width 0.25 length, with 1 simple distal seta. Article 5 (Fig. 16C) minute, with 3 short simple and 1 long simple distal setae. Antenna (Fig. 5B). Length approximately 0.9 of antennule. Article 1 not recovered. Article 2 length 2.0 of article 3, with 1 simple distal seta and setules along upper margin. Article 3 length and width subequal,

359

with 1 distal spiniform seta. Article 4 marginally shorter than article 2, with 2 short distal simple setae. Article 5 length 0.5 of article 4, with 1 short simple distal seta. Article 6 minute with 2 short and 1 long setae. Mouthparts. Labrum (Fig. 5C) divided into a basal and anterior part, lateral margins with setules. Labium (Fig. 5F) with 2 lobes, anterior corners and lateral margins with sparse setulation and few setae. Mandibles (Fig. 5D, E) molar process broad with medial depression. Left mandible (Fig. 5D) lacinia mobilis as long as incisor with proximal denticulation on upper margin, incisor smooth. Right mandible (Fig. 5E) incisor broad, tapering distally and with denticulation on upper margin. Maxillule (Fig. 5G) endite with 9 spiniform setae and several small simple setae. Palp with 2 long setat: of urrequal la~igth.Maxilla (Fig. 6Iij tapering distally. Maxilliped (Fig. 3D) endites (Fig. 3E) with 1 seta on inner anteriomedial corners. Basis with 1 long distal seta. Palp article 1 with 1 short stout distal seta on outer margin. Article 2 with 1 serrated spiniform and 3 setulose setae. Article 3 with 4 setulose setae. Article 4 with 3 distal setulose setae and 1short stout serrated seta. Epignath (Fig. 51) thin and blunt without distal setules. Cheliped (Fig. 55). Basis divided unequally by sclerite, shorter than carpus. Merus triangular with 1 sternal seta. Carpus widening distally, with 2 tergal and 2 sternal setae. Propodus (Figs 5K, 16D) shorter than basis. Fixed finger with 2 setae sternal and 3 on inner margin. Inner margin heavily calcified with several shallow groves. Dactylus stout with 2 small spiniform setae on inner margin. Pereopod 1 (Fig. 6A). Length 1.5 of other pereopods. Coxa with 1 simple sternal seta. Basis slightly bent with 1 simple sternal seta. Ischium with 1 simple tergal seta. Merus rectangular, longer than carpus and smooth. Carpus rectangular with 1 simple distal sternal seta. Propodus with 1small distal seta on each margin and small distal spine. Dactylus and terminal spine marginally shorter than propodus. Pereopod 2 (Fig. 6B). Coxa as pereopod 1. Basis straight, wider and shorter than pereopod 1. Ischium as pereopod 1.Merus shorter than carpus with 1 distal spiniform and 1 simple setae. Carpus shorter than propodus with 2 small and 1 heavy distal spiniform setae. Propodus as pereopod 1. Dactylus and terminal spine more curved than pereopod 1. Pereopod 3 (Fig. 6C). Similar to pereopod 2, except propodus with 3 distal setae. Pereopod 4 (Fig. 6D). Basis with 2 proximal small sternal, 2 simple and 1 circumplumose distal setae. Ischium with 2 tergal setae. Merus length as carpus

360

K. LARSEN

POLYMORPHIC AND CRYFTIC TANAID SPECIES

361

Figure 4. Paratanais maleficus s p . nov., lateral view. A, female holotype, AM P54474. B, paratype, AM P54478, large female variant. C, paratype, AM P54477, ovigerous female. Scale bar = l mm.

with 1 small tergal distal spiniform seta. Carpus with 3 spiniform and 1simple distal setae, setules on tergal margin. Propodus with 1 medial sternal thick circumplumose, 1 thick curved distal and 2 small tergal spiniform distal setae and cuticular scales on tergal margin.

basis with 2 simple and 1 circumplumose tergal setae; (2)meruscurvedwithsetules ontergalmargin; (3)carpus with only 2 spiniform and 2 simple distal setae, cuticular scales on tergal margin; (4) propodus with 1 circumplumose medial sternal distal seta and with 1simple, 1small simple and 2 circumplumose spiniform setae.

Pereopod 5 (Fig. 6E). Similar to pereopod 4, except: (1)

Pereopod 6 (Fig. 6F). Similar to pereopod 4, except: (1)

362

K. LARSEN

Figure 5. Paratanais maleficus sp. nov. Female paratype AM P54476. A, antennule. B, antenna. C, labrum. D, left mandible. E, right mandible. F, labium. G, maxillule. H, maxilla. I, epignath. J , cheliped. K, propodus of same. Scale bar A, B, J=0.5 mm. Scale bar C-I, K=0.1 mm.


363

Figure 6. Paratanais maleficus sp. nov. Female paratype AM P54476. A, pereopod 1. B, pereopod 2. C, pereopod 3. D, pereopod 4. E, pereopod 5. F, pereopod 6. G, pleopod. H, uropod. Scale bar =0.5 mm.

364

K. LARSEN

basis 2 wider, as long as carpus and merus together, with 1proximal circumplumose seta and 1simple and 1 circumplumose distal setae; (2) carpus with 2 small circumplumose and 1broad distal spiniform setae; (3) propodus (Fig. 16D) marginally shorter than carpus, with cuticular scales on tergal margin, 1 small spiniform and 3 setulose distal spiniform setae. Dactylus and terminal spine shorter than longest spiniform seta.

Pleopods (Fig. 6G). All 5 pairs similar. Protopod square and smooth. Exopod with 25 plumose setae. Endopod with 16 plumose setae and 2 distal thick pappose than the rest, and setules on outer margin.

Cheliped (Fig. 8D). Weaker than female. Basis as long as carpus, divided into equal parts by sclerite. Merus with 1 sternal seta. Carpus tergal margin longer than sternal. Propodus as long as carpus. Fixed finger with 2 sternal setae and 5 on inner margin. Dactylus stout, with 1 tergal seta. Pereopod 1 (Fig. 8E). Coxa smooth. Basis longer than merus and carpus together, smooth. Ischium with small tergal seta. Merus widening distally, with 1 small distal seta. Carpus rectangular with 2 small distal setae. Propodus longer than carpus with 1 small distal seta. Dactylus and terminal spine 0.5 propodus length.

Uropods (Figs 6H, 16G). Protopod with 1 small seta. Endopod with 2 articles. Article 1 longer than article 2 with 1 simple distal seta. Article 2 with 5 distal long simple and 1 short circumplumose setae. Exopod with 2 articles and 2 long and 1 short simple setae.

Pereopod 2 (Fig. 8F). Similar to pereopod 1, except: (1) carpus with 3 small distal setae; (2) propodus with 1 proximal sternal seta and 2 distal small setae and distal spine.

DESCRIPTION: ADULT MALE

Pereopod 3 (Fig. 8G). Similar to pereopod 1, except propodus with 2 distal small setae and distal spine.

(Figs 7, 8) Body (Fig. 7A,B) Cephalothorax. As long as first four pereonites. Eyes. Large, diameter 0.4 times cephalothorax length. Pereonites. Significantly shorter than female. Pereonites 1-3 marginally shorter than pereonites 4-6. Pleon. All similar, almost as long as pereonites. Pleotelson tapering distally, as long as last 2 pleonites together. Antennule (Fig. 8A). Longer than cephalothorax, with 8 articles. Article 1longest, 3 times wider than articles 3-8, with several small simple setae. Article 2 only 0.5 length of article 1 with 2 simple setae. Articles 3 & 4 dorsal margin longer than ventral with large number of long ventral aestetasks. Article 5 longer than articles 3 & 4 together, with several long ventral aesthetascs. Article 6 marginally shorter than article 5, smooth. Article 7 marginally shorter than article 6 with 2 small distal setae. Article 8 minute with 2 setae. Antenna (Fig. 8B). With 6 articles. Article 1incomplete. Article 2 with 1 distal simple seta, 2.0 length of article 3. Article 3 widening distally, with 1 simple distal seta. Article 4 longer than other articles, with 2 small medial and 2 distal setae. Article 5 0.75 length of article 4, smooth. Article 6 minute with 3 small and 1 long simple setae. Mouthparts. Only a reduced maxilliped retained in the male. Maxilliped (Fig. 8C) endites smooth and narrower than basis. Palp with 4 articles, articles 1 & 2 smooth, article 3 with 2 simple setae, article 4 with 4 simple setae.

Pereopod 4 (Fig. 8H). Basis wider than pereopod 1-3, with small spines along tergal margin otherwise smooth. Ischium smooth. Merus widening distally, with 2 small distal seta. Carpus with 3 distal small setae along both margins. Propodus with spines along both margins, 1medial sternal, 3 distal setae. Dactylus and terminal spine with setules and not fused. Pereopod 5 (Fig. 81). Similar to pereopod 4, except: (1) ischium with 2 small setae; (2) carpus smooth with 2 distal small setae; (3) terminal spines bifurcate. Pereopod 6 (Fig. 8J). Similar to pereopod 4, except: (1) basis smooth; (2) merus with 1 tergal seta; (3) carpus without spines; (4) propodus with 2 tergal setae but without spines; (5) dactylus without setules. Pleopods (Fig. 7C). All 5 pairs similar. Protopod oval and smooth. Exopod with 14 plumose setae. Endopod with 10 plumose setae. Uropods (Fig. 7D). Protopod smooth. Endopod article 1 with 1 small seta. Article 2 with 2 small, 1 long and 1 very long simple setae. Exopod with 1 article and 1 medial and 2 distal simple setae. Large variant Body (Figs 3B, 4B). BL 4.6mm. Length 5.5 width. Separations between pereonites less obvious than in holotype. Carapace. Length 1.2 holotype. Appendages. As for paratype, except cheliped has fixed finger with only 1sternal seta (holotype also with only 1 seta). Pleopods (Fig. 3F). Endopod armed with 24 plumose setae. Exopod armed with 42 plumose and 2

e


365

Figure 7. Paratanais maleficus sp. nov. A, male paratype, lateral view, AM P54475. B, male holotype, dorsal view. C, pleopod. D, uropod. Scale bar A, B = 1mm. Scale bar C, D =0.25 mm.

distal thick pappose setae. Terminal setae present in both but significantly closer to the other setae on exopod.

Ouigerous female (not dissected) Body (Figs 3C, 4C). BL= 2.6 mm. Length 6.0 width. Pereonite 1, relative to other pereonites, longer than on holotype. Marsupium consists of 4 oostegites, originated from pereonite 1-4. Juvenile (Fig. 9) Body (Fig. 9A,B). BL 1.2mm. Length 5.0 width. Mouthparts. As for adult female, except: (1) maxillule (Fig. 9C) with 5 thick and 2 small terminal setae; (2) maxilliped (Fig. 9D) palp article 2 without serrated spiniform setae.

Cheliped (Fig. 9E). As adult female, except fixed finger with only 1 tergal seta. Pereopod 1. As adult female, except merus as long as carpus. Pereopod 6 (Fig. 9F). As adult female, except cuticular scale not developed. Pleopods (Fig. 9G). Endopod armed with 7 plumose setae. Exopod armed with 14 plumose setae. Terminal setae present in both articles. Uropod (Fig. 9H). Endopod articles completely separated. Article 1shorter than both exopod and endopod articles 2. Exopod with 1 long article decreasing in width midlength. Manca II ((Fig. 10). Body (Fig. 10A,B). BL 0.95 mm. Pereonite 6 only marginally longer than pleonites.

366

K. LARSEN

Figure 8. Paratanais maleficus s p . nov. Male paratype, AM P54475. 4 , antennule. B, antenna. C, maxilliped. D, cheliped. (d) propodus of same. E, pereopod 1. F, pereopod 2. G, pereopod 3. H, pereopod 4. I, pereopod 5 . J, pereopod 6. Scale bar = 0.25 mm.


367

Figure 9. Paratanais maleficus sp. nov., juvenile. A, dorsal view. B, lateral view. C, maxillule. D, maxilliped. E, cheliped. F, pereopod 6. G, pleopod. H, uropod. Scale bar A, B = l mm.

Mouthparts. As adult female, except: (1) maxillule (Fig. 10C) with only 5 thick and 1 small terminal setae; (2) maxilliped (Fig. 10D) palp article 2 without serrated spiniform setae. Cheliped (Fig. 10E). As adult female, except fixed finger with only 1 sterna1 and 2 tergal setae. Pereopod 1 (Fig. 10F). As adult female, except merus as long as carpus. Pereopod 5 (Fig. 10G). As adult female, except: (1) rnerus, carpus and propodus cuticular scales not developed; (2) dactylus and terminal spine considerably

longer and less curved than adult female; (3) fusion line more obvious.

Pereopod 6 and pleopods. Not developed at this stage. Uropod (Fig. 10H). Endopod articles not completely separated. Exopod with 1 article only.

Remarks

This species can be separated from E! malignus by the

368

K. LARSEN

Figure 10. P a r a t a n a i s m a l e f i c u s s p . nov., manca 11. A, dorsal view. B, lateral view. C, maxillule. D, maxilliped. E, cheliped. F, pereopod 1. G, pereopod 6. H, uropod. Scale bar A, B = l mm.

long uropods. For separation from l? perturbatius see that species.

Body (Fig. 11A,B). Relatively broad, length 5.0 width, subcylindrical.

PARATANAZS MALZGNUS SP. NOV.

Cephalothorax (Fig. 17B). Length marginally shorter than pereonite 1 and 2 together.

(Figs 11-1 3, 17) Material examined One non-ovigerous female holotype (AM P54482), body length 3.1 mm. Paratypes: 1 non-ovigerous female mouthparts and limbs dissected (AM P54483). 1 nonovigerous female (AM P54484). Locality: see methods and materials. Collected by K. Larsen & S. Keable. Types, SEM stubs, slides and remaining specimens are deposited in the AM. Other material Four females and 6 mancas. Locality as above. Diagnosis Left mandible lacina mobilis upper margin serrated. Cheliped dactylus without spiniform setae on inner margin, fixed finger with broad leaf-shaped setae a t dactylus insertion. Uropods shorter than pleotelson. Etymology The species name reflects the apparently maleficent appearance of this species. Latin: malignus =wicked.

Pereonites. All pereonites wider than long. Pereonite 1 length 0.8 of pereonite 5-6. Pereonite 3 & 4 and 5 & 6 identical, respectively. Pleon. All pleonites subequal, width approximately 4.5 length. Pleotelson length equal to length of 3 pleonites, width subequal pleonites. Antennule (Fig. 11C). Length 0.8 of cephalothorax. Article 1marginally shorter than articles 2-5 together, width 0.5 length, with 2 short simple and 2 short plumose setae. Article 2 longer than article 3, width 0.8 length, with 2 simple and 1 plumose distal setae. Article 3 wider than long, with 1 short simple distal seta. Article 4 width 0.25 length, tapering distal, smooth. Article 5 (Fig. 17C) minute, length and width subequal, with 3 simple distal setae. Antenna (Fig. 11D). Length approximately 0.6 of cephalothorax. Article 1 smooth, wider than long. Article 2 length 2.0 of article 3, with 2 simple distal setae and setules along upper margin. Article 3 length and width subequal, with 1 spinifoim seta distal on dorsal side. Article 4 marginally shorter than article 2, with 1 short plumose seta distal and 2 medial. Article 5 length 0.5 article 4, with 2 simple distal setae. Article 6 minute with 4 long simple setae.


369

Figure 11. Paratanais malignus sp. nov. A & B, female holotype, AM P54482. C-I, female paratype. A, dorsal view. B, lateral view. C, antennule. D, antenna. E, labrum. F, right mandible. G, left mandible. H, maxillule. I, epignath. Scale bar A, B = 1mm; C, D = 0.5 mm. E-I = 0.25 mm.

370

K. LARSEN

Figure 12. Paratanais malignus sp. nov. Female paratype. A, labium. Scale bar=O.l mm. B, maxilliped. Scale bar =0.5 mm.

Mouthparts. Labrum (Fig. 11E) lateral margins with setules. Labium (Fig. 12A) with 2 lobes, lateral margins with sparse setulation. Mandibles (Fig. 11F,G) of unequal size, molar process broad with medial depression. Left mandible (Fig. 11G) larger than right mandible, lacinia mobilis as long as incisor with weak distal denticulation, incisor smooth. Right mandible (Fig. 11F) incisor divided into 2 parts, tapering distally and smooth. Maxillule (Fig. 11H) endite with 7 spiniform setae and setules. Palp as long as endite and with 2 long setae. Maxilla lost. Maxilliped (Fig. 12B) endites without anteriomedial setae. Palp socket with 1 seta. Article 1 smooth. Article 2 with 1 spiniform serrated and 1 spiniform smooth setae on inner distal margin, and 1 seta on outer distal margin. Article 3 with 5 setulose setae on inner margin. Article 4 with 4 distal setulose setae. Epignath (Fig. 111) relatively broad and without distal setules. Cheliped (Fig. 13G). Basis divided unequally by sclerite, shorter than carpus. Merus triangular with 1 sternal seta. Carpus widening distally, with 2 small distal setae. Propodus (Figs 13G, 17D) with small serrated distal thick sternal seta. Fixed finger with 1 seta sternal and 1broad leaf shaped as well as 3 simple setae on inner margin, inner margin heavy calcified with several shallow groves. Dactylus stout with 1 tergal seta. Oostegites. No ovigerous specimens found. Pereopod 1 (Fig. 13A). Almost twice as long as other pereopods. Coxa smooth. Basis slightly bent with 1 simple sternal seta. Ischium with 1 simple tergal seta. Merus rectangular, longer than carpus and smooth. Carpus rectangular with 1 simple sternal seta. Propodus with 2 distal sternal and 1tergal setae. Dactylus and terminal spine marginally shorter than propodus.

Pereopod 2 (Fig. 13B). Basis wider and shorter than pereopod 1. Ischium as pereopod 1. Merus shorter than carpus with 1 distal spiniform and 1 simple setae. Carpus shorter than propodus with 2 distal spiniform setae. Propodus and dactylus as pereopod 1. Pereopod 3 (Fig. 13C). Similar to pereopod 2 except: propodus with 1 distal seta. Pereopod 4 (Fig. 13D). Without coxa. Basis 2 times wider than pereopods 2 and 3, longer than carpus and merus together, with 1small proximal seta and 3 distal simple setae. Ischium with 2 tergal setae. Merus longer than carpus with 1 small tergal and 1 spiniform setae, tergal margin with numerous setules. Carpus with numerous spicular scales, with 2 distal spiniform setae, tergal margin with cuticular scales. Propodus longer than carpus with 1 spiniform, 1 circuinplumose and 1 simple setae, with numerous spicular scales. Dactylus and terminal spine with spicular scales and weak fusion line. Pereopod 5 (Fig. 13E). Similar to pereopod 4 except: (1) basis with 2 5 tergal setae; (2) ischium smooth. Pereopod 6 (Fig. 13F). Similar to pereopod 4 except: (1) basis wider and with 2 simple distal setae; (2) propodus with 1tergal spiniform and 3 serrated sternal spiniform distal setae. Pleopods (Fig. 13H). All 5 pairs similar. Protopod smooth. Endopod armed with 16 plumose setae, the 2 most distal thicker than the rest. Exopod armed with 19 plumose and distal thick pappose setae. Uropods (Figs 131, 17G). Protopod almost square, 2 times wider t h a n endopod. Endopod with 2 articles,


371

Figure 13. Paratanais malignus s p . nov. Female paratype. A, pereopod 1.B, pereopod 2. C, pereopod 3. D, pereopod 4. E, pereopod 5 . F, pereopod 6. G, cheliped. (g) propodus of same. H, pleopod. I, uropod. Scale bars: A-G=0.5 mm; H, I =0.25mm.

372

K. LARSEN

article 1 with 1 distal seta, article 2 with 2 circumplumose and 5 simple setae. Exopod uniarticulated, as long as endopod article 1,with 2 simple setae.

Remarks The uropodal exopod is uniarticulated even in a fully developed specimen (the paratype submitted to SEM is 3.3 mm long). I! malignus can be separated from I! maleficus and P perturbatius by the uropod being shorter than pleotelson. PARATANAIS PERTURBATIUS SP. NOV.

(Figs 14, 15) Material examined One female non-ovigerous holotype (AM P54479). Body length 2.6 mm. Paratypes: 1 female, non-ovigerous (dissected) (AM P54480). 1female, non-ovigerous (AM P54481. Locality: see material and methods. Other material Five non-ovigerous females and 2 mancas. Collected by K. Larsen & S. Keable. Types, SEM stubs, slides and remaining specimens are deposited in the AM. Diagnosis Body slightly more slender than P maleficus. Left mandible lacina mobilis with smooth upper margin. Cheliped dactylus without small spiniform setae, fixed finger without broad leaf-shaped setae at dactylus insertion. Etymology Name reflecting the disturbance the finding of this species could cause to tanaidacean systematics. Latin: perturbatius = disturbance. Description: adult female (Fig.144B) Body. Slender, more than 7 times longer than broad, subcylindrical. Cephalothorax. Length marginally longer than pereonite 1 and 2 together. Pereonites. All pereonites wider than long although 4 and 5 only marginally. Pereonite 1 length 0.4 of pereonite 2. Pereonite 2 length 0.8 of pereonite 3. Pereonite 3-5 length and width subequal. Pereonite 6 marginally longer than pereonite 2. Pleon. All pleonites subequal, width approximately 3.0 length. Pleotelson length marginally shorter than length of 3 pleonites, subequal pleonite width.

Antennule (Fig. 14C). Length 0.9 of cephalothorax. Article 1 longer than articles 2-3 together, width 0.5 length, with 1short simple and 3 plumose setae. Article 2 length 2.0 article 3, with 1 short simple seta. Article 3 wider than long, with 2 short simple distal setae. Article 4 length 0.6 article 1,with 1 simple distal seta. Article 5 minute, with 3 simple setae and 1aesthetascs. Antenna (Fig. 14D). Length approximately same as antennule. Ai-ticle 1 not recovered. Article 2 length 1.25 article 3, with 3 simple setae. Article 3 length and width subequal, with 1 spiniform distal seta and setules on upper margin. Article 4 as long as article 2, smooth. Article 5 length 0.5 article 4, with 1 simple distal seta. Article 6 minute with 1 small and 2 long setae. Mouthparts. Labrum (Fig. 14E) anterior margins with setules. Labium (Fig. 145) with 2 lobes, anterior corners with a few setae and setules. Mandibles (Fig. 14F, G) molar process broad with medial depression. Left mandible (Fig. 14F) lacinia mobilis as long as incisor with smooth upper margin, incisor smooth. Right mandible (Fig. 14G) incisor broad, tapering distally and with denticulation on upper margin. Maxillule (Fig. 14H) endite with 5 long and 2 short stout spiniform setae. Palp with 2 long setae of equal length. Maxilla (Fig. 141) almost square. Maxilliped (Fig. 14K) Endites with 1 seta on inner anteromedial corners. Palp article 1 with 1 distal seta. Article 2 with 2 setulose and 1serrated spiniform seta on inner margin. Article 3 with 4 setulose setae on inner margin. Article 4 with 4 distal setulose setae. Epignath not recovered. Cheliped (Fig. 15G). Basis divided unequally by sclerite, shorter than carpus. Merus triangular with 2 sternal setae. Carpus widening distally, with 2 small tergal setae. Propodus (Fig. 15G) shorter than basis. Fixed finger with 1 setae sternal and 3 on inner margin, inner margin heavy calcified. Dactylus stout without spiniform setae on inner margin. Oostegites. No ovigerous specimens found. Pereopod 1 (Fig. 15A). Longer than other pereopods. Coxa small and smooth. Basis slightly bent with 1 proximal simple sternal seta. Ischium with 1 simple tergal seta. Merus rectangular, marginally longer than carpus and with 1 tergal distal seta. Carpus rectangular with 2 simple sternal setae. Propodus smooth. Dactylus and terminal spine shorter than propodus. Pereopod 2 (Fig. 15B). Coxa as pereopod 1. Basis straight, wider and shorter than pereopod 1. Ischium as pereopod 1. Merus shorter than carpus with 1small distal spiniform setae. Carpus shorter than propodus with 1 small spiniform distal seta. Propodus wider

'

-


373

Figure 14. Paratanais perturbatius s p . nov. A & B, female holotype, AM P54479.C-K, female paratype. A, dorsal view. B, lateral view. C, antennule. D, antenna. E, labrum. F, labium. G, maxillule. H, maxilla. I, right mandible. J, left mandible. K, maxilliped. Scale bars: A, B = 1mm; C-K = 0.25 mm.

than pereopod 1, with 2 simple distal seta. Dactylus and terminal spine more curved than pereopod 1.

Pereopod 4 (Fig. 15D). Basis twice as wide as pereopods 2 & 3, as long as carpus & merus together, with 2

Pereopod 5 (Fig. 15E). Similar to pereopod 4 except: (1) basis with 1 simple and 2 circumplumose tergal setae; (2) merus widening distally, with 1 spiniform tergal seta; (3) carpus with 2 spiniform and 1 simple distal setae, tergal margin with cuticular scales; (4) propodus with 1 medial circumplumose sternal and 2 spiniform distal setae, tergal margin with cuticular scales.

circumplumose setae. Dactylus and terminal spine with medial scales and weak fusion line.

Pleopods (Fig. 15H). All 5 pairs similar. Protopod rounded and smooth. Endopod with 14 plumose setae.

Pereopod 3 (Fig. 15C). Similar to pereopod 2 except: (1) carpus with 2 distal spiniform setae; (2) propodus with 1 tergal medial and 1 sternal distal seta.

374

K. LARSEN

Figure 15. Paratanais perturbatius s p . nov. Female paratype. A, pereopod 1. B, pereopod 2. C, pereopod 3. D, pereopod 4. E, pereopod 5. F, pereopod 6. G, cheliped. (g) propodus of same. H, pleopod. I, uropod. Scale bars: A-G= 0.25 mm; H, I = 0.25 mm.

'OLYMORPHIC AND CRYPTIC TANAID SPECIES Exopod with 10 plumose and 2 distal thick pappose setae. Uropods (Fig. 151). Protopod smooth. Endopod article 1as long as article 2 with 1simple and 1circumplumose distal setae. Article 2 with 5 distal long simple and 1 circumplumose setae. Exopod uniarticulated, shorter than endopod article l and with 2 simple setae.

.

Remarks Morphologically l? perturbatius is almost identical to l? maleficus. This species can be separated from l? maleficus and l? malignus by the left mandible lacinia mobilis having a smooth upper margin and the lack of small setae on the cheliped dactylus. The terminal spiniform setae on the maxillule vary ontogenetically in l? maleficus and thus cannot be used to separate these species. l? perturbatius showed a slight colour variation (more grey than pinkish brown as l? nzaleficus) which disappears when fixed. DISCUSSION The three species described in this work are the first from Australia proper. l? occulatus have been recorded from Macquarie Island (subpolar region) and l? linearis is a misidentification belonging to Anarthrura (Sieg, 1983: 485). The development of l? maleficus from manca to adult and from small to large adult, illustrates several problems with tanaidacean diagnostic characters. (l) Pereonites, especially pereonite 1; relative length (family-level character: Sieg, 1977: 9) does not increase relative to width with growth. (2) The number of sterna1 setae on cheliped fixed finger (species-level character: Bird & Holdich, 1989: 285) is not constant. (3) Maxilliped armament (species-level character: Sieg, 1981: 1277) does not completely develop until adulthood. (4) Pereopod 1 merus/carpus relative length (specieslevel character: Dojiri & Sieg, 1997: 220) is ontogenetically dependent. (5) Pereopods 4-6: cuticular scales do not develop until adulthood. (6) The number of plumose setae on pleopods increase throughout life and the distance between exopod terminal and other setae (family-level character: Sieg & Winn, 1978: 846) decreases. (7) Maxillule terminal setae number (species-level character: Bird & Holdich, 1988: 1598) also increase in number from manca to adult but do not change further with age. (8) Uropod articles (family-level character: Lang, 1973: 223) are not fully separated until maturity

375

and the exopod articles separate last or not at all. Furthermore, male l? maleficus share no specieslevel characters with the female. No patterns in this variation could be found and the impact on the systematics is unsettling. Three different restriction patterns (i.e. species) were generated using digestion enzymes. Both enzymes, Hinf 1 and Cfo 1, revealed the same pattern. These patterns correspond to the species l? maleficus (long uropod, pinkish-brown coloration) l? malignus (short uropod, brownish-pink coloration) and l? perturbatius (long uropod, grey coloration). The male specimen and various adult forms of female specimens of l? maleficus had the same restriction pattern, demonstrating the efficacy of this method for rapid confirmation of species identity. The existence of three cryptic species in a small area demonstrates that the diversity of tanaids is significantly underestimated. This is particularly significant in the deep-sea where tanaids are a dominant component of the fauna (Wilson, 1987). The species are separate and do not interbreed since they shared no bands on the ITS digestion, even though they have the opportunity to do so (sympatric). During this work only one type of male was collected of l? maleficus and no males of the other two species. The males constitute a small percentage of the population (