mTORC1 Phosphorylates Acetyltransferase p300 to Regulate ...

Article

mTORC1 Phosphorylates Acetyltransferase p300 to Regulate Autophagy and Lipogenesis Graphical Abstract

Authors Wei Wan, Zhiyuan You, Yinfeng Xu, ..., Tianhua Zhou, Hongguang Xia, Wei Liu

Correspondence [email protected]

In Brief Wan et al. report that the acetyltransferase p300 is a novel target of mTORC1. mTORC1-mediated phosphorylation at 4 serine residues located in the C terminus activates p300 by obviating the intra-molecular inhibition of p300. Phosphorylation of p300 is required for mTORC1-dependent autophagy inhibition and lipogenesis activation.

Highlights d

mTORC1 interacts with p300 and phosphorylates p300

d

Phosphorylation of 4 serine residues at the C terminus activates p300

d

mTORC1-dependent phosphorylation obviates the intramolecular inhibition of p300

d

The mTORC1-p300 pathway regulates cell autophagy and cell lipogenesis

Wan et al., 2017, Molecular Cell 68, 323–335 October 19, 2017 ª 2017 Elsevier Inc. https://doi.org/10.1016/j.molcel.2017.09.020

Molecular Cell

Article mTORC1 Phosphorylates Acetyltransferase p300 to Regulate Autophagy and Lipogenesis Wei Wan,1 Zhiyuan You,1 Yinfeng Xu,1 Li Zhou,1 Zhunlv Guan,1 Chao Peng,3 Catherine C.L. Wong,3 Hua Su,1 Tianhua Zhou,1 Hongguang Xia,1 and Wei Liu1,2,4,* 1Department of Biochemistry and Molecular Biology, Program in Molecular and Cell Biology, Zhejiang University School of Medicine, Hangzhou 310058, China 2Collaborative Innovation Center for Diagnosis and Treatment of Infectious Disease, First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou 310003, China 3National Center for Protein Science Shanghai, Institute of Biochemistry and Cell Biology, Shanghai Institutes of Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China 4Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.molcel.2017.09.020

SUMMARY

Acetylation is increasingly recognized as one of the major post-translational mechanisms for the regulation of multiple cellular functions in mammalian cells. Acetyltransferase p300, which acetylates histone and non-histone proteins, has been intensively studied in its role in cell growth and metabolism. However, the mechanism underlying the activation of p300 in cells remains largely unknown. Here, we identify the homeostatic sensor mTORC1 as a direct activator of p300. Activated mTORC1 interacts with p300 and phosphorylates p300 at 4 serine residues in the C-terminal domain. Mechanistically, phosphorylation of p300 by mTORC1 prevents the catalytic HAT domain from binding to the RING domain, thereby eliminating intra-molecular inhibition. Functionally, mTORC1dependent phosphorylation of p300 suppresses cellstarvation-induced autophagy and activates cell lipogenesis. These results uncover p300 as a direct target of mTORC1 and suggest that the mTORC1p300 pathway plays a pivotal role in cell metabolism by coordinately controlling cell anabolism and catabolism.

INTRODUCTION Cellular metabolism impacts cell growth, differentiation, and senescence by altering the production and consumption of cellular macromolecules and energy. Substantial evidence has demonstrated that cell metabolism is regulated by cellular protein phosphorylation events that modulate the activity of vital kinases located at distinct metabolic steps (Cantley, 2002; Manning and Toker, 2017; Mihaylova and Shaw, 2011; Saxton and Sabatini, 2017). Nevertheless, recent studies have highlighted the importance of intracellular acetylation activity in determining the cell metabolism level (Choudhary et al., 2009; Zhao et al.,

2010), suggesting a key role of acetyltransferases/deacetylases in the regulation of cellular metabolic processes. The intensively studied histone acetyltransferase (HAT) p300 and the related CREB-binding protein (CBP) are evolutionarily conserved and traditionally serve as transcription coactivators by acetylating core histones and nuclear non-histone proteins (Bannister and Kouzarides, 1996; Chan and La Thangue, 2001; Ogryzko et al., 1996). However, it has recently emerged that p300 is also involved in various cytoplasmic events by deploying its acetyltransferase activity on cytoplasmic proteins (Jiang et al., 2011; Min et al., 2010). p300 is predominantly nuclear but can shuttle between the nucleus and cytoplasm, a process that is regulated by the shuttling protein BAT3 (Sebti et al., 2014). Recently, it has been suggested that p300 participates in the regulation of autophagy (Lee and Finkel, 2009), a catabolic process that maintains cellular homeostasis by directing cytoplasmic components for lysosomal degradation (Klionsky, 2007; Mizushima, 2007). Several autophagy-related (Atg) proteins, including LC3 (microtubule-associated protein 1 light chain 3, a mammalian homolog of yeast Atg8), Atg5, and Atg7, are targeted by p300-mediated acetylation, leading to inhibition of their autophagic activities (Huang et al., 2015; Lee and Finkel, 2009). Deacetylation of LC3 by the histone deacetylase Sirt1 is essential for the redistribution of nuclear LC3 to the cytoplasm and its conjugation to autophagic membranes (Huang et al., 2015), suggesting a critical role of acetylation/deacetylation events in autophagy induction. During autophagy, Sirt1 can be activated by two mechanisms that depend on the energy sensor AMPK. The first is AMPK-dependent transcription of the NAD+ biosynthetic enzyme Nampt, which raises the level of the Sirt1 coenzyme NAD+ (Fulco et al., 2008); the second is AMPK-mediated phosphorylation and nuclear translocation of the glycolytic enzyme GAPDH, which directly interacts with Sirt1 in the nucleus (Chang et al., 2015). However, the mechanism by which p300 is inactivated during autophagy remains unclear. Cellular p300 activity responds to multiple intracellular and extracellular stimuli (Chen et al., 2007; Huang and Chen, 2005; Yang et al., 2001). The intracellular metabolic intermediate acetyl-coenzyme A (acetyl-CoA) plays a major role in p300 activation by providing the acetyl group not only for p300 substrates

Molecular Cell 68, 323–335, October 19, 2017 ª 2017 Elsevier Inc. 323

but also for autoacetylation of p300 itself, an event that marks p300 activation (Marinõ et al., 2014; Thompson et al., 2004). In addition, several post-translational modifications including sumoylation and methylation can also influence p300 activity (Girdwood et al., 2003; Yadav et al., 2003), although the mechanism underlying these effects remains elusive. Structural analysis has suggested an intra-molecular inhibition mechanism in the regulation of p300 activity. The RING (really interesting new gene) domain directly interacts with the catalytic HAT domain and may occlude the HAT active site (Delvecchio et al., 2013), while the AIL (autoinhibitory loop) binds to an electronegative patch on the HAT domain and competes with substrate association (Liu et al., 2008). Autoacetylation of the AIL motif reduces the affinity of AIL for the HAT domain, thereby activating p300 (Delvecchio et al., 2013; Thompson et al., 2004). Recently, we revealed that while LC3 deacetylation can be induced by deprivation of glucose or amino acids, Sirt1 activation is essential for autophagy triggered by glucose starvation, but not for autophagy led by amino acid starvation (Chang et al., 2015). Deprivation of amino acids or treatment with rapamycin, an inhibitor of mammalian target of rapamycin complex 1 (mTORC1), causes LC3 deacetylation and autophagy in Sirt1-inhibited cells (Chang et al., 2015). When these observations support the previous findings showing that inhibition or deletion of Sir2 (Sirt1 in C. elegans) has no effect on rapamycin-promoted autophagy in C. elegans (Morselli et al., 2010), they suggest a possible connection between mTORC1 and p300. Therefore, in this study, we investigated a potential role of mTORC1 in the regulation of p300. Our results demonstrate that p300 is a phosphorylation substrate of mTORC1. Phosphorylation at the C-terminal domain of p300 by mTORC1 prevents intra-molecular inhibition. Further, we show that this phosphorylation is essential for the function of p300 in autophagy inhibition and transcription activation. RESULTS mTORC1 Regulates p300 Activity To investigate a potential role of mTORC1 in regulating p300, we first set up an assay to examine intracellular p300 activity by measuring the acetylation of histone H3 and p300 itself. Using the specific p300/CBP inhibitor C646 and the p300/CBP activator CTB as controls, we found that treatment of cells with amino-acid-free medium or the mTORC1 inhibitors Torin1 or rapamycin significantly reduced the acetylation of p300 and histone H3 (Figure 1A). Giving back amino acids to the starved cells dramatically elevated the acetylation of p300 and histone H3 (Figure 1A). Consistent results were obtained using a fluorometric p300 activity assay kit with recombinant p53 peptide (Figure 1B) and an in vitro acetylation assay with purified recombinant glutathione S-transferase (GST)-tagged histone H3 (Figure 1C), indicating that inhibition of mTORC1 markedly decreased the ability of p300 to acetylate p53 and histone H3. We then utilized cells in which mTORC1 was constitutively activated by overexpression of the mTORC1 activator Rheb (Ras homolog enriched in brain) or deletion of the mTORC1 inhibitors TSC1 (tuberous sclerosis complex 1) or TSC2, we found that p300 activity was enhanced in these cells, as indicated by the

324 Molecular Cell 68, 323–335, October 19, 2017

elevation in acetylation of p300 and histone H3 (Figures 1D and 1E). As long-term rapamycin treatment may affect mTORC2 activity (Sarbassov et al., 2006), we further used rapamycin at a low concentration (25 nM) for a short period of time (2 hr), which dramatically suppressed mTORC1 substrate S6K1 without observably influencing mTORC2 substrate Akt activity (Figure 1F). In these cells, p300 activity was also evidently inhibited (Figure 1F). Further, knockdown of Raptor, a component of mTORC1 required for mTORC1 activity, but not Rictor, a subunit of mTORC2 essential to mTORC2 activation, significantly decreased p300 activity (Figure 1G). Because p300 can be growth-factor-dependently activated by Erk1/2 and Akt (Chen et al., 2007; Huang and Chen, 2005; Meissner et al., 2011), to determine whether Erk1/2 and/or Akt are involved in mTORC1dpendent p300 activation, we treated cells with Erk1/2 inhibitor U0126 or Akt inhibitor MK2206. Although U0126 and MK2206 fully suppressed Erk1/2 and Akt, respectively, they showed a much lower inhibitory effect on p300 activity than rapamycin (Figure S1A). Rapamycin caused Erk1/2 and Akt activation in the cells (Figure S1A), which is consistent with previous observations (Carracedo et al., 2008; Wan et al., 2007). These data suggest that mTORC1 activates p300 in a manner that is independent of either Erk1/2 or Akt. Considering that Erk1/2 or Akt only activates p300 with extra epidermal growth factor (EGF) or insulin stimulation (Chen et al., 2007; Huang and Chen, 2005), mTORC1 may be the major regulator for p300 activity in normal growth conditions. Changing mTORC1 activity in cells also influenced the acetylation (activation) of CBP (Figures S1B–S1D). Intriguingly, knockdown of CBP caused less reduction in histone H3 acetylation than knockdown of p300 (Figure S1E), although acetylation at this site (Lys56) can be mediated by both CBP and p300 (Das et al., 2009). In addition, knockdown of p300 but not CBP almost completely blocked the acetylation of histone H3 stimulated by Rheb overexpression (Figure S1F). These results therefore suggest that acetylation of histone H3 at Lys56 is predominantly dependent on p300, consistent with the notion that p300 and CBP have different specificity/selectivity for lysines within histone H3 (Henry et al., 2013). Together, these data suggest that mTORC1 is an upstream regulator of p300. mTORC1 Interacts with p300 To test whether mTORC1 regulates p300 by increasing acetylCoA production, we measured cellular acetyl-CoA in cells in which mTORC1 was activated or inactivated using a fluorometric acetyl-CoA assay kit (Masui et al., 2015). The intracellular acetylCoA level was dramatically reduced by glucose deprivation (Wellen et al., 2009) but unaffected by mTORC1 inhibition (Figure S2A) or mTORC1 activation (Figure S2B). We then asked whether the regulation is mediated by a direct interaction between mTORC1 and p300. We checked in cells the interaction of p300 with Raptor, which recognizes and interacts with mTORC1 substrates (Nojima et al., 2003; Yu et al., 2011). Coimmunoprecipitation detected an association of endogenous p300 with transfected Flag-Raptor, which was reduced by amino acid starvation or Torin1 treatment and dramatically enhanced either by giving back amino acids after starvation or by Rhebmyc overexpression (Figure 2A). To verify the specific interaction between mTORC1 and p300, we constructed p300 truncated

Figure 1. mTORC1 Regulates p300 Activity (A) Acetylation of p300 and histone H3 in HeLa cells treated with amino-acid-free medium, the mTORC1 inhibitor Torin1, the mTORC1 inhibitor rapamycin (Rapa), the p300 inhibitor C646, the p300 activator CTB, or amino acids after amino acid deprivation. Immunoprecipitated p300 and lysate histone H3 were analyzed by western blot using anti-acetyl-lysine and anti-acetyl-histone H3, respectively. (B) Quantification of p300 activity in HeLa cells treated as indicated and measured using p53 peptide as a substrate with acetyl-CoA. p300 was immunoprecipitated from the cells with anti-p300. Data are presented as mean ± SEM of triplicates. **p < 0.01, ***p < 0.001. (C) In vitro acetylation assay using purified GST-histone H3 and p300-Flag immunoprecipitated from HeLa cells in the presence of acetyl-CoA. (D–G) Acetylation of p300 and histone H3 in HeLa cells overexpressing the mTORC1 activator Rheb (D), in MEFs with or without deletion of the mTORC1 inhibitor TSC1/2 (E), in HeLa cells treated with rapamycin of 25 nM for 2 hr or with 250 nM for 6 hr (F), or in HeLa cells incubated with small interfering RNAs (siRNAs) against the mTORC1 subunit Raptor or the mTORC2 subunit Rictor (G). In (F), the phosphorylation of S6K1 and Akt in the cells was also shown. See also Figure S1.

mutants and found that deletion of the C terminus of p300 (amino acids 1,665–2,414) abolished the co-precipitation of Raptor with p300-Flag (Figure S3A). Further narrowing down the interaction domain in the C terminus revealed that the amino acid 2,165– 2,414 region located at the end of the C terminus is required for p300 to interact with Raptor (Figure S3B). In response to abundant amino acids, mTORC1 is targeted to the lysosomal surface by the Rag-Ragulator complex for its activation and for interaction with its substrates in many cases (Martina and Puertollano, 2013; Sancak et al., 2010; Settembre et al.,

2012). We checked to see whether p300 resides on lysosomes, although it is predominantly distributed in the nucleus. Co-localization of p300 with mTOR and GFP-tagged LAMP2, a lysosomal marker, was detected upon amino acid stimulation of starved HEK293 cells (Figure 2B). Distribution of p300 with mTOR on lysosomes was also observed in HeLa cells by staining p300 and endogenous LAMP2 or p300 and mTOR, respectively (Figures S3C and S3D). To verify the lysosomal localization of p300, we designed an organelle precipitation assay. Cells expressing GFP-tagged LAMP1, a lysosomal transmembrane protein, and

Molecular Cell 68, 323–335, October 19, 2017 325

Figure 2. mTORC1 Interacts with p300 (A) Co-immunoprecipitation of endogenous p300 with Flag-Raptor in treated HeLa cells expressing Flag-Raptor with or without Rheb-myc. Flag-Raptor was immunoprecipitated using anti-Flag, and the precipitates were analyzed using anti-p300. (B) Subcellular localization of LAMP2-GFP, mTOR, and p300 in HEK293 cells stably expressing LAMP2-GFP. The cells were amino acid starved for 50 min or restimulated with amino acids after the starvation for 10 min and then subjected to immunostaining using anti-mTOR and anti-p300. Scale bars, 10 mm. (C) HeLa cells transiently expressing LAMP1-GFP and RFP-Raptor were homogenized in extraction buffer without detergent. The post-nuclear supernatants were then incubated with a specific GFP antibody and subjected to organelle precipitation with protein A agarose. Fluorescent images of the agarose beads are shown; the green signal indicates that LAMP1-GFP-labeled lysosomes were bound to the agarose beads. Scale bars, 10 mm. The precipitated lysosomes were analyzed by western blot using the indicated antibodies. (D) Co-immunoprecipitation of p300 with Raptor in the nuclear or cytoplasmic fractions from HeLa cells. (E) Recombinant Flag-p300 was incubated with recombinant mTORC1 comprising Flag-mTOR, His-Raptor, and His-MLST8. Flag-p300 was then pulled down using anti-p300, and the bound mTOR and Raptor were detected by western blot using anti-Flag and anti-His. See also Figures S2 and S3.

RFP-Raptor were homogenized without the use of detergent, and the lysosomes were pulled down with a specific GFP antibody. Following incubation with protein A agarose beads, the


lysosomes bound to the beads were analyzed by western blot and fluorescent imaging. Clearly, p300 was co-precipitated with lysosomes, but another nuclear protein, lamin B1, was not

(Figure 2C). It is known that activated mTORC1 is detectable in €ger, 2008; Zhang et al., the nucleus (Rosner and Hengstschla 2002), suggesting a possibility that mTORC1 may also encounter p300 in the nucleus. We therefore carried out cell fractionation and purified the nuclear and cytoplasmic fractions from HeLa cells. Although mTOR was detected in both of fractions but mainly in the cytoplasmic fraction, p300 was detected predominantly in the nuclear fraction but was also detected in the cytoplasmic fraction (Figures S3E and S3F). Treatment of cells with the nuclear export inhibitor leptomycin B accumulated mTOR and Raptor in the nucleus (Figure S3E), whereas treatment with the nuclear import inhibitor ivermectin led to increased levels of p300 in the cytoplasm (Figure S3F). These observations were consistent with the results of previous studies suggesting that both mTORC1 and p300 shuttle between the cytoplasm and nucleus (Bachmann et al., 2006; Sebti et al., 2014). We then performed co-immunoprecipitation analysis and found that immunoprecipitation of Raptor co-precipitated p300 in both the nuclear fraction and the cytoplasmic fraction (Figure 2D), suggesting that mTORC1 can associate with p300 in both the nucleus and cytoplasm. Finally, we carried out an in vitro pull-down assay to identify a direct interaction between mTORC1 and p300. Purified recombinant p300 was incubated with purified recombinant mTORC1 comprising mTOR, Raptor, and MLST8. When p300 was immunoprecipitated with a specific p300 antibody, mTORC1 was pulled down (Figure 2E). Together, these data suggest a direct interaction between mTORC1 and p300 in cells. mTORC1 Phosphorylates p300 at C-Terminal Serine Residues The interaction of mTORC1 with p300 prompted us to test whether p300 is a phosphorylation substrate of mTORC1. We used anti-phospho-serine/threonine and anti-phospho-tyrosine antibodies to examine the phosphorylation status of p300 immunoprecipitated from cells. Intriguingly, while both tyrosine phosphorylation and serine/threonine phosphorylation of p300 were detected in fed control cells, inhibition of cellular mTORC1 by treatment with amino-acid-free medium, Torin1, or rapamycin significantly decreased the phosphorylation at serine/threonine, but not at tyrosine (Figure 3A). Knockdown of Raptor also reduced p300 serine/threonine phosphorylation (Figure 3B). Accordingly, TSC1- or TSC2-deleted mouse embryonic fibroblasts (MEFs) displayed a much higher constitutive phosphorylation of p300 than wild-type (WT) MEFs (Figure 3C). Furthermore, in insulin-stimulated cells or in cells in which amino acids were replenished after deprivation, p300 phosphorylation was significantly upregulated, which could be abolished by Torin1 treatment (Figure 3D). These data suggest that the phosphorylation of p300 at serine/threonine residues is regulated by mTORC1. We then performed an in vitro kinase assay using recombinant full-length p300 and recombinant mTORC1. Direct phosphorylation of p300 by mTORC1 was revealed, and the level of phosphorylation was high enough to detect with unlabeled ATP and an anti-phospho-serine/threonine antibody rather than 32P-labeled ATP and autoradiography (Figure 3E). In addition, we found that the phosphorylation level of both nuclear p300 and cytoplasmic p300 was evidently reduced by depriva-

tion of amino acids or treatment with mTORC1 inhibitors, while the distribution of intracellular p300 was not observably changed (Figure S4A). Further, utilizing purified recombinant Flag-p300 as a substrate, in vitro kinase assay indicated that both nuclear mTORC1 and cytoplasmic mTORC1 were able to phosphorylate p300 in the presence of ATP (Figure S4B). To identify the mTORC1 phosphorylation site(s) on p300, we analyzed the phosphorylated full-length p300 with mass spectrometry. Four residues (Ser2271, Ser2279, Ser2291, and Ser2315) were suggested (Figure S5), all of which were located in mTORC1 consensus motifs within the C-terminal domain (Hsu et al., 2011; Kim et al., 2015). We then created p300 mutants by replacing each of the 4 serine residues with alanine and performed in vitro kinase assays. Mutation of each of the 4 serines reduced the phosphorylation of the recombinant C-terminal region of p300 (GST-tagged p300C, amino acids 2,175– 2,414) (Figure 3F). Replacement of all 4 serines (p300C-4SA) eliminated phosphorylation (Figure 3F), confirming that they are the major mTORC1 phosphorylation sites on p300. Accordingly, both the full-length p300-4SA and p300-4SD, a p300 mutant in which the 4 serines were replaced by aspartic acid to mimic phosphorylated p300, showed dramatically weakened phosphorylation in cells (Figure 3G). Together, these results suggest that p300 is a direct phosphorylation substrate of mTORC1. mTORC1-Dependent Phosphorylation Disrupts the Intra-molecular Inhibition of p300 To examine the functional effect of phosphorylation, the acetyltransferase activity of cell-expressed WT p300 and the amino acid substitution mutants was measured with a fluorometric activity assay kit. Compared to WT p300, each of the single serineto-alanine mutants showed reduced activity (Figure 4A). p3004SA demonstrated the lowest activity, while p300-4SD displayed the highest activity, which was not influenced by Torin1 treatment (Figure 4A). Consistent with this, Rheb-myc overexpression failed to restore the reduced activity of p300-4SA, and Torin1 treatment could not inhibit the elevated activity of p3004SD in cells (Figure 4B). An acetylation assay of cellular p300 and purified histone H3 also indicated that p300-4SA decreased acetyltransferase activity while p300-4SD increased it (Figure 4C). Finally, we designed an in vitro assay using purified mTORC1 and p300 to exclude the possibility that the acetylation of purified histone H3 is due to other proteins co-immunoprecipitated with p300 (MacLellan et al., 2000; Miyake et al., 2000). We first incubated purified recombinant p300 with recombinant mTORC1 and ATP. Then, p300 was immunoprecipitated and incubated with acetyl-CoA. We found that the autoacetylation of p300 was significantly enhanced by pre-incubation of p300 with mTORC1 (Figure 4D). Together, these results suggest that mTORC1-dependent phosphorylation is sufficient to activate p300 as an acetyltransferase. To investigate the molecular mechanism by which the mTORC1-mediated phosphorylation activates p300, we tested whether phosphorylation impacts the intra-molecular inhibition of p300. We created two Flag-tagged truncated p300 mutants in which the RING domain or the AIL motif was deleted (Delvecchio et al., 2013) (Figure 4E) and examined their cellular activity by transfecting them into cells in which the endogenous p300


Figure 3. p300 Is a Direct Phosphorylation Substrate of mTORC1 (A) Phosphorylation of p300 in HeLa cells treated with amino-acid-free medium, Torin1, or rapamycin. p300 was immunoprecipitated from cells with anti-p300 and analyzed by western blot using anti-phospho-serine/threonine and anti-phospho-tyrosine. Cell lysates were analyzed using anti-S6K1 and anti-phospho-S6K1. (B–D) Phosphorylation of p300 in HeLa cells incubated with Raptor siRNAs (B), in MEFs with or without TSC1/2 deletion (C), and in HeLa cells with insulin, amino acid deprivation, or addition of amino acids after deprivation (D). (E) In vitro kinase assay of mTORC1 using recombinant mTORC1 and recombinant p300, with or without ATP. (F) In vitro kinase assay using recombinant mTORC1, recombinant GST-p300C (amino acids 2,175–2,414), or p300C mutants, with or without ATP. (G) Phosphorylation of Flag-tagged p300 or p300 mutants expressed in HeLa cells. 4SA, all 4 serines were replaced by alanine; 4SD, all 4 serines were replaced by aspartic acid. See also Figures S4 and S5.

was knocked down. Lack of the AIL motif dramatically reduced the p300 acetylation level (Figure 4F), confirming the presence of autoacetylation sites within the AIL motif (Delvecchio et al., 2013; Thompson et al., 2004). Deletion of the RING domain increased p300 acetylation, and overexpression of each of the truncated mutants significantly promoted the acetylation of intracellular histone H3 (Figure 4F), supporting the intra-molecular inhibitory effect of the RING domain and AIL motif. Interestingly, treatment with the mTORC1 inhibitor Torin1 attenuated the elevated histone H3 acetylation caused by deletion of the AIL motif, but not of the RING domain (Figure 4F). Deletion of the RING domain also restored the decreased acetylation of p300-4SA but did not affect the increased acetylation of p300-


4SD (Figure 4G). An acetyltransferase activity assay using recombinant p53 peptide as a substrate confirmed that deletion the RING domain significantly elevated the activity of p3004SA (Figure 4H). These results suggest that the mTORC1-mediated phosphorylation activates p300 by preventing the inhibitory function of the RING domain. Finally, we created and purified a truncated BRP (Bd, RING and PHD module) mutant containing the bromodomain (Bd), RING domain, and plant homeodomain (PHD) and a truncated HAT and C-terminal domain (HC) mutant comprising the HAT domain and the C-terminal domain (CTD) (Delvecchio et al., 2013) (Figure 4E). The two bacterially expressed and purified recombinant peptides were incubated together, and their interaction was analyzed by an

Figure 4. mTORC1-Dependent Phosphorylation Disrupts the Intra-molecular Inhibition of p300 (A) Activity quantification of the Flag-tagged p300 or p300 mutants in HeLa cells. (B) Acetylation of Flag-tagged p300 or p300 mutants and histone H3 in HeLa cells treated with p300 siRNA. (C) In vitro acetylation assay using purified GST-H3 and Flag-tagged p300 or p300 mutants immunoprecipitated from treated HeLa cells. (D) Recombinant p300 incubated with recombinant mTORC1 was immunoprecipitated and incubated with acetyl-CoA, and the autoacetylation of p300 was analyzed using anti-acetyl-lysine. (E) Domain architecture of p300. AIL, autoinhibitory loop; Bd, bromodomain; BRP, Bd, RING, and PHD module; CTD, C-terminal domain; HAT, histone acetyltransferase; NTD, N-terminal domain; PHD, plant homeodomain; RING, really interesting new gene (RING). (F and G) Flag-tagged p300 or p300 mutants were transfected into p300-knockdown HeLa cells. p300 (F) or p300 mutants (G) were immunoprecipitated by antiFlag and the acetylation levels were analyzed by western blot using anti-acetyl-lysine. The acetylation of endogenous histone H3 in the cells is also shown. (H) Quantification of the acetyltransferase activity of Flag-tagged p300, p300-4SA, or p300-4SD with or without RING deletion in HeLa cells and measured using p53 peptide as a substrate with acetyl-CoA. (I and J) Purified p300 (HAT and CTD) or p300HC mutants were incubated with purified GST-tagged p300BRP with or without RING deletion (GST-BRP or GSTBRPDRING). GST-BRP (I) or GST-BRPDRING (J) was then immunoprecipitated by anti-GST, and the bound p300HC or p300HC mutants were detected by western blot using anti-p300, which recognizes the C terminus of p300. The statistical data are presented as mean ± SEM of triplicates. *p < 0.05, **p < 0.01.


Figure 5. mTORC1-Dependent Phosphorylation of p300 Inhibits Autophagy (A) Formation of GFP-LC3 puncta in HEK293 cells stably expressing GFP-LC3. The cells were transfected with Flag-tagged p300 or p300 mutants 48 hr after p300 RNAi. Amino acid starvation was carried out 16 hr after transfection. Scale bars, 10 mm. (B) Statistical analysis of the number of GFP-LC3 puncta per cell in (A). Data are shown as mean ± SEM; n = 30. ***p < 0.001. (C) LC3I/LC3II and p62 levels in HEK293 cells treated as in (A). (D) Acetylation of GFP-LC3 in HEK293 cells stably expressing GFP-LC3 and treated as indicated. (E and F) Acetylation of GFP-LC3 (E) or co-immunoprecipitation of Atg7 with GFP-LC3 (F) in HEK293 cells stably expressing GFP-LC3. Cells were transfected with p300-Flag, p300-4SA-Flag, or p300-4SD-Flag 48 hr after p300 RNAi. See also Figure S6.

in vitro pull-down assay. We found that GST-BRP associated with HC or HC-4SA, but not with HC-4SD (Figure 4I). In addition, a GST-BRP lacking a RING domain failed to bind the purified recombinant HC-4SA (Figure 4J). These data support the notion that C-terminal phosphorylation prevents binding of the RING domain to the HAT domain. mTORC1-Dependent Phosphorylation of p300 Inhibits Autophagy To investigate the biological function of mTORC1-mediated p300 phosphorylation, we first examined its effect on aminoacid-starvation-induced cell autophagy, which is initiated by mTORC1 inactivation. In amino-acid-fed GFP-LC3-expressing cells, knockdown of p300 stimulated the formation of intracellular GFP-LC3 puncta (Figures 5A and 5B), confirming an inhibitory effect of p300 on basal autophagy (Lee and Finkel, 2009; Marinõ et al., 2014). Interestingly, expression of WT p300 or p300-4SD, but not p300-4SA, reversed the p300-knockdowntriggered formation of GFP-LC3 puncta, while p300-4SD expression abolished the GFP-LC3 puncta induced by amino acid starvation (Figures 5A and 5B). Consistent with this, while both WT


p300 and p300-4SD expression prevented p300-knockdowntriggered conversion of LC3-I to LC3-II and degradation of p62 in cells (Figure 5C), only p300-4SD expression blocked the LC3 conversion and p62 degradation resulting from amino acid starvation (Figure 5C). Autophagy inhibition by p300 can be attributed in part to the p300-mediated acetylation of LC3 and consequent loss of the LC3-Atg7 interaction (Huang et al., 2015; Lee and Finkel, 2009). To further verify the function of p300 phosphorylation in mediating mTORC1-dependent autophagy inhibition, we transfected the phosphorylation-disabled and phosphorylationmimicking p300 mutants into p300-RNAi cells and determined their effect on LC3 acetylation and the LC3-Atg7 interaction. Compared to WT p300, LC3 deacetylation and LC3-Atg7 association were stimulated by p300-4SA and inhibited by p3004SD (Figures 5D–5F). Previously, it has been shown that both p300 and CBP can acetylate Atg7, and Atg7 acetylation is most heavily influenced by p300 levels (Lee and Finkel, 2009). To determine why p300 phosphorylation or p300 knockdown significantly affects cell autophagy, we compared the role of p300 and CBP in autophagy regulation. We found that

knockdown p300 and, to a much lesser extent, CBP stimulated GFP-LC3 puncta formation in cells stably expressing GFP-LC3 (Figures S6A and S6B). Although treatment of cells with the p300/CBP inhibitor C646 dramatically induced LC3-I to LC3-II conversion, p62 degradation, and LC3 deacetylation, knockdown of p300, but not CBP, produced an effect similar to that of C646 treatment (Figures S6C and S6D). These data therefore suggest that p300, but not CBP, is a key acetyltransferase in autophagy regulation. Taken together, these results suggest that the phosphorylation of p300 by mTORC1 is required to mediate inhibition of autophagy by activated mTORC1. mTORC1-Dependent Phosphorylation of p300 Promotes Lipogenesis We further investigated the role of mTORC1-mediated phosphorylation in regulating the activity of p300 as a transcription coactivator. We chose to assess the effect of the phosphorylation of p300 on SREBP-1c, a master transcription factor for lipogenesis that is acetylated by p300 (Ponugoti et al., 2010). First, we utilized a p300 knockdown/rescue experiment in HepG2 cells to check SREBP-1c acetylation, which promotes the transcriptional activity of SREBP-1c (Ponugoti et al., 2010). Knockdown of p300 caused deacetylation of SREBP-1c (Figure 6A). Interestingly, while expression in the p300-knockdown cells of WT p300, but not p300-4SA, rescued SREBP-1c deacetylation, expression of p300-4SD reversed the deacetylation of SREBP-1c (Figure 6A). This suggests that p300 phosphorylation has an essential role in SREBP-1c acetylation. We further examined the binding of SREBP-1c and RNA polymerase II (Pol II) to the promoter regions of FASN, a target gene of SREBP-1c (Figure 6B), the association of SREBP-1c with Pol II (Figure 6C), and the expression of the SERBP-1c target genes FASN, SCD, and ELOVL6 (Figure 6D). Consistent with the function of p300 phosphorylation in SREBP-1c acetylation, expression of WT p300 or p300-4SD, but not p300-4SA, rescued the p300-knockdown-induced reduction in the binding of SREBP-1c and Pol II to the FASN promoter (Figure 6B), the SREBP-1c-Pol II association (Figure 6C), and the expression of FASN, SCD, and ELOVL6 (Figure 6D). Furthermore, we examined the intracellular lipid level by staining the neutral lipids in the cells using oil red O. As expected, knockdown of p300 almost eliminated the accumulation of neutral lipids in HepG2 cells (Figures 6E and 6F). p300 knockdown also dramatically reduced the lipids in TSC2-knockdown cells, which accumulate high levels of lipids as mTORC1 is constitutively activated (Figures 6E and 6F). In HepG2 cells with or without TSC2 knockdown, expression of WT p300 or p300-4SD, but not p300-4SA, reversed the p300knockdown-induced reduction of cellular lipids (Figures 6E and 6F). Because increased cellular lipid stores could also be due to the inhibition of autophagy caused by p300 phosphorylation (Singh et al., 2009), we directly measured the level of intracellular total fatty acids, which correlates negatively with autophagy inhibition. Consistent with the lipid accumulation results, knockdown of p300 dramatically decreased intracellular fatty acids in HepG2 cells with or without TSC2 knockdown, and this decrease was prevented by expression of WT p300 or p300-4SD, but not p300-4SA (Figure 6G). Taken together,

these results suggest that mTORC1-dependent phosphorylation of p300 is crucial for cellular lipid synthesis through the activation of SREBP-1c. DISCUSSION Although the functions of p300 in the nucleus and/or cytoplasm are well known, little is known about how these functions are specifically regulated in response to intracellular and cell environmental cues. Here, we report a previously unrecognized pathway for p300 regulation. Our data suggest that mTORC1mediated phosphorylation activates p300 acetyltransferase activity, and this mTORC1-p300 axis plays a pivotal role in coordinating cell anabolism and catabolism. By integrating inputs from a variety of intracellular and extracellular cues, the homeostatic sensor mTORC1 controls major cellular processes, including protein and lipid synthesis and autophagy, at the levels of gene transcription, protein translation, and post-translational modification (Saxton and Sabatini, 2017; Shimobayashi and Hall, 2014). Identification of p300 as a direct substrate of mTORC1 provides further interpretation of the functions of mTORC1, in addition to those mediated by the known downstream targets (Kim et al., 2011, 2015; Peterson et al., 2011). Our data suggest that mTORC1 is able to modulate gene expression by targeting a transcription coactivator besides the translational machinery and transcription factors. We have demonstrated that the identified mTORC1-p300 pathway regulates autophagy and lipid synthesis, and we postulate that this signaling pathway may also be involved in coupling other cellular functions of mTORC1 and p300. An example might be ribosome biogenesis, in which mTORC1 directly phosphorylates TIF-1A (Mayer et al., 2004) and may promote the effect of p300 on upstream binding factor (UBF) (Meraner et al., 2006), thus contributing to the assembly of RNA polymerase I, which is required for rDNA transcription. More importantly, considering the role of p300 in histone acetylation, this mTORC1-p300 pathway may be involved in a wider range of cellular responses in which modulation of histone acetylation is required, especially in the situations with the intracellular acetyl-CoA level is not markedly altered. Identification of the phosphorylation sites allows us to investigate the molecular nature of p300 activation by mTORC1. Utilizing the p300 phosphorylation-disabled and phosphorylation-mimicking mutants, our results demonstrated that phosphorylation is essential for and is sufficient to the activation of p300 acetyltransferase activity. In addition, the results suggest that this phosphorylation-based activation involves elimination of the intra-molecular autoinhibition of p300. Structurally, p300 possesses a long C-terminal domain (Delvecchio et al., 2013). The identified phosphorylation sites are all located in the C-terminal region, which is distant from the catalytic HAT domain. Phosphorylation dissociates the HAT domain from the RING domain, possibly through a conformational change in the protein, as the structure of the full-length p300 has yet not been determined. Considering that the phosphorylation of p300 by Akt or Erk1/2 also occurs in the C-terminal domain and activates p300 (Chen et al., 2007; Huang and Chen, 2005; Meissner et al., 2011), our findings may present a general mechanism of p300


Figure 6. mTORC1-Dependent Phosphorylation of p300 Promotes Lipogenesis (A–C) Acetylation of Myc-SREBP-1c (A), binding of Myc-SREBP-1c and RNA polymerase II (Pol II) to the FASN gene promoter (B), or co-immunoprecipitation of Pol II with Myc-SREBP-1c (C) in HepG2 cells with or without transfection of Flag-tagged p300 or p300 mutants 48 hr after p300 RNAi. (D) Relative mRNA levels of FASN, SCD, and ELOVL6 in HepG2 cells treated as in (A). (E–G) Oil red O staining (E) and quantification of intracellular oil red O content (F) or fatty acids (G) in HepG2 cells with or without transfection of Flag-tagged p300 or p300 mutants 48 hr after p300 or TSC2 RNAi. Scale bars, 20 mm. The statistical results are presented as mean ± SEM of triplicates. **p < 0.01.

activation by post-translational modifications that can be physiologically regulated. Our findings suggest that under amino acid starvation, the rapid LC3 deacetylation and consequent enhanced LC3-Atg7 interaction, which are essential for LC3 lipidation and autophagosome formation (Huang et al., 2015), come from dephosphorylation of p300 as a result of mTORC1 inactivation. This explains why LC3 deacetylation and autophagy induction are independent of Sirt1 activation under amino acid starvation or rapamycin treatment (Chang et al., 2015; Morselli et al., 2010). More impor-


tantly, it also explains the essential and sufficient role of p300 suppression in autophagy induction (Lee and Finkel, 2009; Marinõ et al., 2014). During nutrient-deficiency-induced autophagy, activation of class III phosphoinositide 3-kinase for the generation of isolation membranes, and deacetylation and lipidation of LC3 for the growth of isolation membranes, need to be coordinated for complete autophagosome biogenesis. The mTORC1-p300 pathway may serve as an important coordinator, because in addition to regulating LC3 acetylation, p300 directly acetylates Beclin1/VPS34 to affect the formation of isolation

membranes (Su et al., 2017; Sun et al., 2015). This pathway may also be involved in the initiation of other mTORC1regulated autophagy processes, such as the autophagy triggered by DNA-damaging agents (Alexander et al., 2010; Tripathi et al., 2013). It is worth noting that p300 is predominately localized in the nucleus, even under conditions like starvation and Torin1 treatment (as shown in Figure S4A). Both the phosphorylation-disabled and phosphorylation-mimicking mutations do not significantly alter the intracellular distribution of p300 (data not shown). These findings suggest that the phosphorylation status of p300 does not impact its nucleo-cytoplasmic shuttling. Based on these observations, it can be proposed that after being phosphorylated by mTORC1 on lysosomes, while activated p300 can acetylate cytoplasmic substrates for autophagy suppression, it can also move into the nucleus for the acetylation of nuclear histones and nonhistone proteins for transcription activation. Nevertheless, our results demonstrating that p300 associates with mTORC1 in the nucleus and that nuclear mTORC1 harbors the activity for p300 phosphorylation suggest another possibility in which activated mTORC1 encounters p300 and activates p300 in the nucleus, and activated p300 then shuttles to the cytoplasm. In any case, our study has uncovered a direct and strong regulatory relationship between mTORC1 and p300 and the role of regulation in the control and coordination of cell metabolism.

AUTHOR CONTRIBUTIONS

STAR+METHODS

Bannister, A.J., and Kouzarides, T. (1996). The CBP co-activator is a histone acetyltransferase. Nature 384, 641–643.

Detailed methods are provided in the online version of this paper and include the following:

Cantley, L.C. (2002). The phosphoinositide 3-kinase pathway. Science 296, 1655–1657.

d d d

d

d

KEY RESOURCES TABLE CONTACT FOR REAGENT AND RESOURCE SHARING EXPERIMENTAL MODEL AND SUBJECT DETAILS B Cell Culture and Transfection B Stable Cell Lines Construction METHOD DETAILS B Reagents and Treatment B Confocal Microscopy B Immunoprecipitation and Western Blot B Protein Expression and Purification B In Vitro Acetylation Assay and In Vitro Kinase Assay B In Vitro Pull-Down Assay B Lysosomes Isolation B Cell Fractionation B Fluorometric p300 Activity Assay B Fluorometric Acetyl-CoA Quantitation Assay B Oil Red O Staining B Fluorometric Free Fatty Acid Quantitation Assay B RNA Isolation and Real-Time PCR B Chromatin Immunoprecipitation Assay B HPLC/MS/MS in an LTQ Mass Spectrometer QUANTIFICATION AND STATISTICAL ANALYSES

SUPPLEMENTAL INFORMATION Supplemental Information includes six figures and can be found with this article online at https://doi.org/10.1016/j.molcel.2017.09.020.

W.L. and W.W. designed the experiments. W.W., Z.Y. and Y.X. performed the experiments. C.P. and C.C.L.W. performed mass spectrometry. W.L. and W.W. wrote the manuscript. All authors discussed the results and commented on the manuscript. ACKNOWLEDGMENTS We are grateful to the Imaging Center of Zhejiang University School of Medicine for their assistance in confocal microscopy. We thank members of Dr. Liu’s lab for helpful discussions. This study was supported by the National Natural Science Foundation of China (31530040 and 31671434), the National Basic Research Program of China (2013CB910200), and the Ministry of Science and Technology of the People’s Republic of China (2017YFA0503400). Received: May 5, 2017 Revised: August 10, 2017 Accepted: September 13, 2017 Published: October 12, 2017 REFERENCES Alexander, A., Cai, S.L., Kim, J., Nanez, A., Sahin, M., MacLean, K.H., Inoki, K., Guan, K.L., Shen, J., Person, M.D., et al. (2010). ATM signals to TSC2 in the cytoplasm to regulate mTORC1 in response to ROS. Proc. Natl. Acad. Sci. USA 107, 4153–4158. Bachmann, R.A., Kim, J.H., Wu, A.L., Park, I.H., and Chen, J. (2006). A nuclear transport signal in mammalian target of rapamycin is critical for its cytoplasmic signaling to S6 kinase 1. J. Biol. Chem. 281, 7357–7363.

Carracedo, A., Ma, L., Teruya-Feldstein, J., Rojo, F., Salmena, L., Alimonti, A., Egia, A., Sasaki, A.T., Thomas, G., Kozma, S.C., et al. (2008). Inhibition of mTORC1 leads to MAPK pathway activation through a PI3K-dependent feedback loop in human cancer. J. Clin. Invest. 118, 3065–3074. Chan, H.M., and La Thangue, N.B. (2001). p300/CBP proteins: HATs for transcriptional bridges and scaffolds. J. Cell Sci. 114, 2363–2373. Chang, C., Su, H., Zhang, D., Wang, Y., Shen, Q., Liu, B., Huang, R., Zhou, T., Peng, C., Wong, C.C., et al. (2015). AMPK-dependent phosphorylation of GAPDH triggers Sirt1 activation and is necessary for autophagy upon glucose starvation. Mol. Cell 60, 930–940. Chen, Y.J., Wang, Y.N., and Chang, W.C. (2007). ERK2-mediated C-terminal serine phosphorylation of p300 is vital to the regulation of epidermal growth factor-induced keratin 16 gene expression. J. Biol. Chem. 282, 27215–27228. Choudhary, C., Kumar, C., Gnad, F., Nielsen, M.L., Rehman, M., Walther, T.C., Olsen, J.V., and Mann, M. (2009). Lysine acetylation targets protein complexes and co-regulates major cellular functions. Science 325, 834–840. Chu, B.B., Liao, Y.C., Qi, W., Xie, C., Du, X., Wang, J., Yang, H., Miao, H.H., Li, B.L., and Song, B.L. (2015). Cholesterol transport through lysosome-peroxisome membrane contacts. Cell 161, 291–306. Das, C., Lucia, M.S., Hansen, K.C., and Tyler, J.K. (2009). CBP/p300-mediated acetylation of histone H3 on lysine 56. Nature 459, 113–117. Delvecchio, M., Gaucher, J., Aguilar-Gurrieri, C., Ortega, E., and Panne, D. (2013). Structure of the p300 catalytic core and implications for chromatin targeting and HAT regulation. Nat. Struct. Mol. Biol. 20, 1040–1046. Fulco, M., Cen, Y., Zhao, P., Hoffman, E.P., McBurney, M.W., Sauve, A.A., and Sartorelli, V. (2008). Glucose restriction inhibits skeletal myoblast differentiation by activating SIRT1 through AMPK-mediated regulation of Nampt. Dev. Cell 14, 661–673. Girdwood, D., Bumpass, D., Vaughan, O.A., Thain, A., Anderson, L.A., Snowden, A.W., Garcia-Wilson, E., Perkins, N.D., and Hay, R.T. (2003). P300


transcriptional repression is mediated by SUMO modification. Mol. Cell 11, 1043–1054. Guo, Y., Chang, C., Huang, R., Liu, B., Bao, L., and Liu, W. (2012). AP1 is essential for generation of autophagosomes from the trans-Golgi network. J. Cell Sci. 125, 1706–1715. Henry, R.A., Kuo, Y.M., and Andrews, A.J. (2013). Differences in specificity and selectivity between CBP and p300 acetylation of histone H3 and H3/H4. Biochemistry 52, 5746–5759. Hsu, P.P., Kang, S.A., Rameseder, J., Zhang, Y., Ottina, K.A., Lim, D., Peterson, T.R., Choi, Y., Gray, N.S., Yaffe, M.B., et al. (2011). The mTOR-regulated phosphoproteome reveals a mechanism of mTORC1-mediated inhibition of growth factor signaling. Science 332, 1317–1322. Huang, W.C., and Chen, C.C. (2005). Akt phosphorylation of p300 at Ser-1834 is essential for its histone acetyltransferase and transcriptional activity. Mol. Cell. Biol. 25, 6592–6602. Huang, R., Xu, Y., Wan, W., Shou, X., Qian, J., You, Z., Liu, B., Chang, C., Zhou, T., Lippincott-Schwartz, J., and Liu, W. (2015). Deacetylation of nuclear LC3 drives autophagy initiation under starvation. Mol. Cell 57, 456–466. Jiang, W., Wang, S., Xiao, M., Lin, Y., Zhou, L., Lei, Q., Xiong, Y., Guan, K.L., and Zhao, S. (2011). Acetylation regulates gluconeogenesis by promoting PEPCK1 degradation via recruiting the UBR5 ubiquitin ligase. Mol. Cell 43, 33–44. Kim, J., Kundu, M., Viollet, B., and Guan, K.L. (2011). AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat. Cell Biol. 13, 132–141. Kim, Y.M., Jung, C.H., Seo, M., Kim, E.K., Park, J.M., Bae, S.S., and Kim, D.H. (2015). mTORC1 phosphorylates UVRAG to negatively regulate autophagosome and endosome maturation. Mol. Cell 57, 207–218. Klionsky, D.J. (2007). Autophagy: from phenomenology to molecular understanding in less than a decade. Nat. Rev. Mol. Cell Biol. 8, 931–937. Lee, I.H., and Finkel, T. (2009). Regulation of autophagy by the p300 acetyltransferase. J. Biol. Chem. 284, 6322–6328. Lin, C.L., Huang, H.C., and Lin, J.K. (2007). Theaflavins attenuate hepatic lipid accumulation through activating AMPK in human HepG2 cells. J. Lipid Res. 48, 2334–2343. Liu, X., Wang, L., Zhao, K., Thompson, P.R., Hwang, Y., Marmorstein, R., and Cole, P.A. (2008). The structural basis of protein acetylation by the p300/CBP transcriptional coactivator. Nature 451, 846–850. MacLellan, W.R., Xiao, G., Abdellatif, M., and Schneider, M.D. (2000). A novel Rb- and p300-binding protein inhibits transactivation by MyoD. Mol. Cell. Biol. 20, 8903–8915. Manning, B.D., and Toker, A. (2017). AKT/PKB signaling: navigating the network. Cell 169, 381–405. Marinõ, G., Pietrocola, F., Eisenberg, T., Kong, Y., Malik, S.A., Andryushkova, A., Schroeder, S., Pendl, T., Harger, A., Niso-Santano, M., et al. (2014). Regulation of autophagy by cytosolic acetyl-coenzyme A. Mol. Cell 53, 710–725. Martina, J.A., and Puertollano, R. (2013). Rag GTPases mediate amino aciddependent recruitment of TFEB and MITF to lysosomes. J. Cell Biol. 200, 475–491. Masui, K., Tanaka, K., Ikegami, S., Villa, G.R., Yang, H., Yong, W.H., Cloughesy, T.F., Yamagata, K., Arai, N., Cavenee, W.K., and Mischel, P.S. (2015). Glucose-dependent acetylation of Rictor promotes targeted cancer therapy resistance. Proc. Natl. Acad. Sci. USA 112, 9406–9411. Mayer, C., Zhao, J., Yuan, X., and Grummt, I. (2004). mTOR-dependent activation of the transcription factor TIF-IA links rRNA synthesis to nutrient availability. Genes Dev. 18, 423–434. Meissner, J.D., Freund, R., Krone, D., Umeda, P.K., Chang, K.C., Gros, G., and Scheibe, R.J. (2011). Extracellular signal-regulated kinase 1/2-mediated phosphorylation of p300 enhances myosin heavy chain I/beta gene expression via acetylation of nuclear factor of activated T cells c1. Nucleic Acids Res. 39, 5907–5925.


Meraner, J., Lechner, M., Loidl, A., Goralik-Schramel, M., Voit, R., Grummt, I., and Loidl, P. (2006). Acetylation of UBF changes during the cell cycle and regulates the interaction of UBF with RNA polymerase I. Nucleic Acids Res. 34, 1798–1806. Mihaylova, M.M., and Shaw, R.J. (2011). The AMPK signalling pathway coordinates cell growth, autophagy and metabolism. Nat. Cell Biol. 13, 1016–1023. Min, S.W., Cho, S.H., Zhou, Y., Schroeder, S., Haroutunian, V., Seeley, W.W., Huang, E.J., Shen, Y., Masliah, E., Mukherjee, C., et al. (2010). Acetylation of tau inhibits its degradation and contributes to tauopathy. Neuron 67, 953–966. Miyake, S., Sellers, W.R., Safran, M., Li, X., Zhao, W., Grossman, S.R., Gan, J., DeCaprio, J.A., Adams, P.D., and Kaelin, W.G., Jr. (2000). Cells degrade a novel inhibitor of differentiation with E1A-like properties upon exiting the cell cycle. Mol. Cell. Biol. 20, 8889–8902. Mizushima, N. (2007). Autophagy: process and function. Genes Dev. 21, 2861–2873. Morselli, E., Maiuri, M.C., Markaki, M., Megalou, E., Pasparaki, A., Palikaras, K., Criollo, A., Galluzzi, L., Malik, S.A., Vitale, I., et al. (2010). Caloric restriction and resveratrol promote longevity through the Sirtuin-1-dependent induction of autophagy. Cell Death Dis. 1, e10. Nojima, H., Tokunaga, C., Eguchi, S., Oshiro, N., Hidayat, S., Yoshino, K., Hara, K., Tanaka, N., Avruch, J., and Yonezawa, K. (2003). The mammalian target of rapamycin (mTOR) partner, raptor, binds the mTOR substrates p70 S6 kinase and 4E-BP1 through their TOR signaling (TOS) motif. J. Biol. Chem. 278, 15461–15464. Ogryzko, V.V., Schiltz, R.L., Russanova, V., Howard, B.H., and Nakatani, Y. (1996). The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87, 953–959. Peterson, T.R., Sengupta, S.S., Harris, T.E., Carmack, A.E., Kang, S.A., Balderas, E., Guertin, D.A., Madden, K.L., Carpenter, A.E., Finck, B.N., and Sabatini, D.M. (2011). mTOR complex 1 regulates lipin 1 localization to control the SREBP pathway. Cell 146, 408–420. Ponugoti, B., Kim, D.H., Xiao, Z., Smith, Z., Miao, J., Zang, M., Wu, S.Y., Chiang, C.M., Veenstra, T.D., and Kemper, J.K. (2010). SIRT1 deacetylates and inhibits SREBP-1C activity in regulation of hepatic lipid metabolism. J. Biol. Chem. 285, 33959–33970. €ger, M. (2008). Cytoplasmic and nuclear distribuRosner, M., and Hengstschla tion of the protein complexes mTORC1 and mTORC2: rapamycin triggers dephosphorylation and delocalization of the mTORC2 components rictor and sin1. Hum. Mol. Genet. 17, 2934–2948. Sancak, Y., Bar-Peled, L., Zoncu, R., Markhard, A.L., Nada, S., and Sabatini, D.M. (2010). Ragulator-Rag complex targets mTORC1 to the lysosomal surface and is necessary for its activation by amino acids. Cell 141, 290–303. Sarbassov, D.D., Ali, S.M., Sengupta, S., Sheen, J.H., Hsu, P.P., Bagley, A.F., Markhard, A.L., and Sabatini, D.M. (2006). Prolonged rapamycin treatment inhibits mTORC2 assembly and Akt/PKB. Mol. Cell 22, 159–168. Saxton, R.A., and Sabatini, D.M. (2017). mTOR signaling in growth, metabolism, and disease. Cell 168, 960–976. Sebti, S., Pre´bois, C., Pe´rez-Gracia, E., Bauvy, C., Desmots, F., Pirot, N., Gongora, C., Bach, A.S., Hubberstey, A.V., Palissot, V., et al. (2014). BAT3 modulates p300-dependent acetylation of p53 and autophagy-related protein 7 (ATG7) during autophagy. Proc. Natl. Acad. Sci. USA 111, 4115–4120. Sen, N., Hara, M.R., Kornberg, M.D., Cascio, M.B., Bae, B.I., Shahani, N., Thomas, B., Dawson, T.M., Dawson, V.L., Snyder, S.H., and Sawa, A. (2008). Nitric oxide-induced nuclear GAPDH activates p300/CBP and mediates apoptosis. Nat. Cell Biol. 10, 866–873. Settembre, C., Zoncu, R., Medina, D.L., Vetrini, F., Erdin, S., Erdin, S., Huynh, T., Ferron, M., Karsenty, G., Vellard, M.C., et al. (2012). A lysosome-to-nucleus signalling mechanism senses and regulates the lysosome via mTOR and TFEB. EMBO J. 31, 1095–1108. Shimobayashi, M., and Hall, M.N. (2014). Making new contacts: the mTOR network in metabolism and signalling crosstalk. Nat. Rev. Mol. Cell Biol. 15, 155–162.

Singh, R., Kaushik, S., Wang, Y., Xiang, Y., Novak, I., Komatsu, M., Tanaka, K., Cuervo, A.M., and Czaja, M.J. (2009). Autophagy regulates lipid metabolism. Nature 458, 1131–1135. Su, H., Yang, F., Wang, Q., Shen, Q., Huang, J., Peng, C., Zhang, Y., Wan, W., Wong, C.C.L., Sun, Q., et al. (2017). VPS34 acetylation controls its lipid kinase activity and the initiation of canonical and non-canonical autophagy. Mol. Cell 67, 907–921 e907. Sun, T., Li, X., Zhang, P., Chen, W.D., Zhang, H.L., Li, D.D., Deng, R., Qian, X.J., Jiao, L., Ji, J., et al. (2015). Acetylation of Beclin 1 inhibits autophagosome maturation and promotes tumour growth. Nat. Commun. 6, 7215.

Xu, Y., Wan, W., Shou, X., Huang, R., You, Z., Shou, Y., Wang, L., Zhou, T., and Liu, W. (2016). TP53INP2/DOR, a mediator of cell autophagy, promotes rDNA transcription via facilitating the assembly of the POLR1/RNA polymerase I preinitiation complex at rDNA promoters. Autophagy 12, 1118–1128. Yadav, N., Lee, J., Kim, J., Shen, J., Hu, M.C., Aldaz, C.M., and Bedford, M.T. (2003). Specific protein methylation defects and gene expression perturbations in coactivator-associated arginine methyltransferase 1-deficient mice. Proc. Natl. Acad. Sci. USA 100, 6464–6468.

Thompson, P.R., Wang, D., Wang, L., Fulco, M., Pediconi, N., Zhang, D., An, W., Ge, Q., Roeder, R.G., Wong, J., et al. (2004). Regulation of the p300 HAT domain via a novel activation loop. Nat. Struct. Mol. Biol. 11, 308–315.

Yang, W., Hong, Y.H., Shen, X.Q., Frankowski, C., Camp, H.S., and Leff, T. (2001). Regulation of transcription by AMP-activated protein kinase: phosphorylation of p300 blocks its interaction with nuclear receptors. J. Biol. Chem. 276, 38341–38344.

Tripathi, D.N., Chowdhury, R., Trudel, L.J., Tee, A.R., Slack, R.S., Walker, C.L., and Wogan, G.N. (2013). Reactive nitrogen species regulate autophagy through ATM-AMPK-TSC2-mediated suppression of mTORC1. Proc. Natl. Acad. Sci. USA 110, E2950–E2957.

Yu, Y., Yoon, S.O., Poulogiannis, G., Yang, Q., Ma, X.M., Villeń, J., Kubica, N., Hoffman, G.R., Cantley, L.C., Gygi, S.P., and Blenis, J. (2011). Phosphoproteomic analysis identifies Grb10 as an mTORC1 substrate that negatively regulates insulin signaling. Science 332, 1322–1326.

Wan, X., Harkavy, B., Shen, N., Grohar, P., and Helman, L.J. (2007). Rapamycin induces feedback activation of Akt signaling through an IGF-1Rdependent mechanism. Oncogene 26, 1932–1940.

Zhang, X., Shu, L., Hosoi, H., Murti, K.G., and Houghton, P.J. (2002). Predominant nuclear localization of mammalian target of rapamycin in normal and malignant cells in culture. J. Biol. Chem. 277, 28127–28134.

Wellen, K.E., Hatzivassiliou, G., Sachdeva, U.M., Bui, T.V., Cross, J.R., and Thompson, C.B. (2009). ATP-citrate lyase links cellular metabolism to histone acetylation. Science 324, 1076–1080.

Zhao, S., Xu, W., Jiang, W., Yu, W., Lin, Y., Zhang, T., Yao, J., Zhou, L., Zeng, Y., Li, H., et al. (2010). Regulation of cellular metabolism by protein lysine acetylation. Science 327, 1000–1004.


STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Rabbit polyclonal anti-GFP

Abcam

Cat#ab290

Mouse monoclonal anti-LAMP2

Abcam

Cat#ab25631

Rabbit polyclonal anti-Akt

Cell Signaling Technology

Cat#9272

Rabbit polyclonal anti-phospho-Akt (Ser473)


Cat#9271

Rabbit monoclonal anti-mTOR


Cat#2983

Rabbit polyclonal anti-S6K1


Cat#9202

Rabbit polyclonal anti-phospho-S6K1 (Thr389)


Cat#9205

Rabbit polyclonal anti-histone H3


Cat#9715

Rabbit polyclonal anti-acetyl-histone H3 (Lys56)


Cat#4243

Rabbit polyclonal anti-acetylated-lysine


Cat#9441

Mouse monoclonal anti-phospho-Tyr


Cat#9411

Rabbit monoclonal anti-Raptor


Cat#2280

Antibodies

Rabbit monoclonal anti-Rictor


Cat#5379

Rabbit polyclonal anti-RFP

MBL

Cat#PM005

Rabbit polyclonal anti-p62/SQSTM1

Proteintech

Cat#18420-1-AP

Rabbit polyclonal anti-Erk1/2

Santa Cruz Biotechnology

Cat#sc-292838

Rabbit polyclonal anti-phospho-Erk1/2 (Thr202/Tyr204)


Cat#sc-16982-R

Rabbit polyclonal anti-p300


Cat#sc-585

Mouse monoclonal anti-CBP


Cat#sc-7300

Rabbit polyclonal anti-Lamin B1


Cat#sc-20682

Rabbit polyclonal anti-RNA polymerase II


Cat#sc-9001

Mouse monoclonal anti-GFP


Cat#sc-9996

Mouse monoclonal anti-Myc


Cat#sc-40

Mouse monoclonal anti-HA


Cat#sc-7392

Mouse monoclonal anti-Flag


Cat#sc-51590

Rabbit polyclonal anti-Flag


Cat#sc-807

Rabbit polyclonal anti-His


Cat#sc-803

Rabbit polyclonal anti-LC3B

Sigma-Aldrich

Cat#L7543

Rabbit polyclonal anti-Atg7

Sigma-Aldrich

Cat#A2856

Mouse monoclonal anti-b-Actin

Sigma-Aldrich

Cat#A5316

Mouse monoclonal anti-b-Tubulin

Sigma-Aldrich

Cat#T8328

Mouse monoclonal anti-p300

Upstate

Cat#05-257

Mouse monoclonal anti-phospho-Ser/Thr-Pro

Upstate

Cat#05-368

Donkey anti-rabbit IgG (H+L) IRDye800CW

LI-COR Biosciences

Cat#926-32213

Donkey anti-mouse IgG (H+L) IRDye680RD

LI-COR Biosciences

Cat#926-68072

Goat anti-Mouse IgG (H+L), Alexa Fluor 488

Molecular Probes

Cat#A-11001

Donkey anti-Rabbit IgG (H+L), Alexa Fluor 488

Molecular Probes

Cat#A-21206

Goat anti-Rabbit IgG (H+L), Alexa Fluor 546

Molecular Probes

Cat#A-11081

Donkey anti-Mouse IgG (H+L), Alexa Fluor 546

Molecular Probes

Cat#A10036

Goat anti-Rabbit IgG (H+L), Alexa Fluor 635

Molecular Probes

Cat#A-31576

Goat anti-Mouse IgG (H+L), Alexa Fluor 635

Molecular Probes

Cat#A-31574

Glutathione-Sepharose 4B beads

GE Healthcare Life Sciences

Cat#17-0756-01

Protein G PLUS-Agarose


Cat#sc-2002 (Continued on next page)

e1 Molecular Cell 68, 323–335.e1–e6, October 19, 2017

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Protein A-Agarose


Cat#sc-2001

Anti-HA affinity beads

Biotool

Cat#B23302

Anti-Flag affinity beads

Biotool

Cat#B23101

Bacterial and Virus Strains E. coli BL21

Transgen Biotech

Cat#CD601

E. coli Trans 5a

Transgen Biotech

Cat#CD201

Chemicals, Peptides, and Recombinant Proteins Insulin

Beyotime Biotechnology

Cat#P3376

Leptomycin B


Cat#9676

Lipofectamine 2000

Invitrogen

Cat#11668019

mTOR assay buffer

Invitrogen

Cat#PV4794

TRIzol reagent

Invitrogen

Cat#15596026

Protease inhibitor Cocktail tablet

Roche

Cat#04693132001

C646

Selleck

Cat#S7152

Ivermectin

Selleck

Cat#S1351

U0126

Selleck

Cat#S1102

MK2206

Selleck

Cat#S1078

Chloroquine

Sigma-Aldrich

Cat#C6628

CTB

Sigma-Aldrich

Cat#C6499

Rapamycin

Sigma-Aldrich

Cat#V900930

Recombinant mTORC1

Sigma-Aldrich

Cat#SRP0364

Recombinant p300

Sigma-Aldrich

Cat#SRP2079

Torin1

Tocris Biosciences

Cat#4247

PicoProbe Acetyl CoA Assay Kit (Fluorometric)

Abcam

Cat#ab87546

Free Fatty Acid Quantification Assay Kit (Fluorometric)

Abcam

Cat#ab65341

SensoLyte HAT (p300) Assay Kit (Fluorometric)

Anaspec

Cat#AS-72172

BCA protein assay kit

Thermo Fisher Scientific

Cat#23227

This paper

https://doi.org/10.17632/ 22gjkdphzb.1

HEK293

ATCC

ATCC CRL-1573

HeLa

ATCC

ATCC CCL-2

HepG2

Donated by Qiming Sun

N/A

WT MEFs

Donated by Han-Ming Shen

N/A

Critical Commercial Assays

Deposited Data Original images were deposited to Mendeley data Experimental Models: Cell Lines

TSC1

/

MEFs


N/A

TSC2

/

MEFs


N/A

GFP-LC3 HEK293

Constructed in our lab

N/A

LAMP2-GFP HEK293

Constructed in our lab

N/A

Raptor siRNA1 GAUGAGGCUGAUCUUACAGTT

This paper

N/A

Raptor siRNA2 ATCCUUAGCUCAGAGCUGGTT

This paper

N/A

Rictor siRNA1 CCUAAUGAAUAUGGCUGCAUCCUUUTT

This paper

N/A

Rictor siRNA2 ACUUGUGAAGAAUCGUAUCTT

This paper

N/A

p300 siRNA CUAGAGACACCUUGUAGUATT

This paper

N/A

Oligonucleotides

(Continued on next page)

Molecular Cell 68, 323–335.e1–e6, October 19, 2017 e2

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

CBP siRNA AAUCCACAGUACCGAGAAAUGTT

This paper

N/A

TSC2 siRNA CAAUGAGUCACAGUCCUUUGATT

This paper

N/A

Non-targeting siRNA UUCUCCGAACGUGUCACGUTT

This paper

N/A

p300-S2271A-Flag

This paper

N/A

p300-S2279A-Flag

This paper

N/A

p300-S2291A-Flag

This paper

N/A

p300-S2315A-Flag

This paper

N/A

p300-4SA-Flag

This paper

N/A

p300-4SD-Flag

This paper

N/A

p300DRING-Flag

This paper

N/A

p300DRING-4SA-Flag

This paper

N/A

p300DRING-4SD-Flag

This paper

N/A

p300DAIL-Flag

This paper

N/A

p300D1-1048-Flag

This paper

N/A

p300D1049-1664-Flag

This paper

N/A

p300D1665-2414-Flag

This paper

N/A

p300D1665-1914-Flag

This paper

N/A

p300D1915-2164-Flag

This paper

N/A

p300D2165-2414-Flag

This paper

N/A

Rheb-myc

This paper

N/A

LAMP1-GFP

This paper

N/A

Recombinant DNA

LAMP2-GFP

This paper

N/A

GST-p300C

This paper

N/A

GST-p300C-S2271A

This paper

N/A

GST-p300C-S2279A

This paper

N/A

GST-p300C-S2291A

This paper

N/A

GST-p300C-S2315A

This paper

N/A

GST-p300C-4SA

This paper

N/A

GST-histone H3

This paper

N/A

GST-BRP

This paper

N/A

GST-BRPDRING

This paper

N/A

GST-HC

This paper

N/A

GST-HC-4SA

This paper

N/A

GST-HC-4SD

This paper

N/A

CBP-HA

Donated by Jimin Shao

N/A

p300-Flag

Donated by Shimin Zhao

N/A

Flag-Raptor

Donated by Zheng Fu

N/A

Myc-SREBP-1c

Donated by Jae Bum Kim

N/A

Software and Algorithms Odyssey infrared imaging system

LI-COR Biosciences

N/A

DNA STAR sequence assay

http://www.dnastar.com

N/A

LSM 510 software

Zeiss

N/A

ABI7500 real-time PCR system

Applied Biosystems

N/A

GraphPad Prism software

GraphPad Software

https://www.graphpad.com

Other All restriction enzymes

Thermo Fisher Scientific

QuikChange II XL

Stratagene

Cat#200518

KOD-plus-neo

TOYOBO

KOD-401


CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for reagents may be directed to, and will be fulfilled by Lead Contact Wei Liu ([email protected]). EXPERIMENTAL MODEL AND SUBJECT DETAILS Cell Culture and Transfection HeLa, HEK293, HepG2 cells and MEFs were cultured in DMEM with 10% FBS at 37 C under 5% CO2. Lipofectamine 2000 was used for plasmids transient transfection according to the manufacturer’s instructions. Cells were analyzed 16-24 hr after transfection. For RNA interference, siRNA duplexes were transfected using Lipofectamine 2000 as specified by the manufacturer. Transfection was repeated twice with an interval of 24 hr to achieve the maximal RNAi efficacy. Stable Cell Lines Construction HEK293 cells stably expressing GFP-LC3 or LAMP2-GFP were created by transient transfection followed by selection with G418. METHOD DETAILS Reagents and Treatment The chemicals were used as follows: C646, 10 mM, 3 hr; Ivermectin, 25 mM; U0126, 10 mM, 12 hr; MK2206, 100 nM, 12 hr; Leptomycin B, 40 nM; insulin, 500 nM, 30 min; rapamycin, 250 nM, 6 hr; Torin1, 250 nM, 3 hr; CTB, 50 mM, 3 hr; chloroquine, 10 mM, 3 hr. For amino acid or glucose starvation, cells were incubated in amino acid-free or glucose-free medium containing 10% dialyzed FBS for 4 hr. Confocal Microscopy For immunostaining, HeLa or HEK293 cells were fixed with 4% formaldehyde followed by permeabilization and blocking with PBS containing 10% FCS and 0.1% saponin. Then the cells were incubated with appropriate primary and secondary antibodies in 0.1% saponin as indicated. Confocal images were captured in multi-tracking mode on a laser scanning confocal microscope with a 63 3 plan apochromat 1.4 NA objective. To quantify the number of GFP-LC3 puncta, a total of 30 cells were recorded and analyzed using the Axiovision Automatic Measurement Program on the Zeiss LSM510 Meta. GFP-LC3 puncta with diameters between 0.3 mm and 1 mm were scored as positive. Immunoprecipitation and Western Blot For immunoprecipitation between mTORC1 and p300, cells were lysed in CHAPS buffer (50 mM HEPES, pH 7.4, 40 mM NaCl, 2 mM EDTA, 1 mM orthovanadate, 50 mM NaF, 10 mM pyrophosphate, and 0.3% CHAPS) supplemented with a complete protease inhibitor cocktail and mixed with antibodies at 4 C overnight, followed by the addition of protein A/G agarose beads. Immunocomplexes were washed extensively four times with high-salt CHAPS buffer (0.5 M NaCl) and subjected to western blot. Otherwise, cells were lysed in Nonidet P40 (NP-40) buffer (50 mM Tris-HCl, pH 7.4, 1% NP-40, 150 mM NaCl, 2 mM EDTA, 1mM DTT, 10% glycerol) supplemented with protease inhibitors. Western blot was performed as described previously (Guo et al., 2012). In brief, proteins from lysed cells or immunoprecipitates were denatured and loaded on sodium dodecyl sulfate polyacrylamide gels. Then they were transferred to polyvinylidene difluoride membranes. After blocking with 5% (w/v) BSA, the membrane was stained with the corresponding primary and secondary antibodies. The specific bands were analyzed using an Odyssey Infrared Imaging System. Protein Expression and Purification Histone H3, p300C (WT, S2271A, S2279A, S2291A, S2315A and 4SA mutants), p300BRP, and p300HC (WT, 4SA, and 4SD mutants) were cloned into pGEX-4T-1 vectors and expressed as the GST-tagged form in Escherichia coli BL21 by induction with 0.1 mM isopropyl b-D-thiogalactopyranoside for 12 hr at 28 C. The recombinant proteins were purified using glutathione-Sepharose 4B beads, and eluted with glutathione or incubated with thrombin at 4 C for 6 hr to release the proteins from the GST. Then the eluates were appropriately concentrated with Amicon Ultra-4 filter (EMD Millipore) and glycerol was added to a final concentration of 25% for storage at 80 C. In Vitro Acetylation Assay and In Vitro Kinase Assay In vitro acetylation assay was performed as described previously (Sen et al., 2008). Briefly, the reaction was performed in 30 ml of reaction buffer (20 mM Tris-HCl, pH 8.0, 20% glycerol, 100 mM KCl, 1mM DTT and 0.2 mM EDTA), 20 mM acetyl-CoA, and immunoprecipitated p300-Flag and recombinant GST-histone H3 was added. After incubation at 30 C for 1 hr, the reaction was stopped by the addition of 10 ml of SDS sample buffer. The samples were subjected to western blot. In vitro kinase assay was performed as described previously (Yu et al., 2011). Briefly, recombinant Flag-p300 or purified GSTp300C was incubated with recombinant mTORC1 in 50 ml reaction mixture at 37 C for 30 min. The reaction mixture contained


1 3 mTORC1 kinase buffer, protease inhibitors, 2 mM DTT, 10 mM ATP, 1 mg Flag-p300 or purified GST-p300C, and 250 ng mTORC1. The reaction was stopped by the addition of 16 ml of SDS sample buffer. The samples were subjected to western blot. Phosphorylation-acetylation coupled reaction. After the in vitro kinase assay, Flag-p300 was immunoprecipitated and washed with acetylation reaction buffer. Then the immunoprecipitated Flag-p300 was subjected to in vitro acetylation assay. In Vitro Pull-Down Assay For pull-down assay, purified GST, GST-p300BRP, or GST-p300BRPDRING proteins were incubated with purified p300HC, p300HC-4SA, or p300HC-4SD for 4 hr at 4 C. Then glutathione-Sepharose 4B beads were added to the mixture, followed by further incubation for 2 hr at 4 C. Immunocomplexes were washed and subjected to western blot. Lysosomes Isolation Lysosomes were isolated with some modifications as described previously (Chu et al., 2015). Briefly, HeLa cells transiently transfected with LAMP1-GFP and RFP-Raptor were harvested, washed, and homogenized in extraction buffer (5 mM MOPS, pH 7.65, 0.25 M sucrose, 1 mM EDTA, 0.1% ethanol, and protease inhibitors). The lysates were mixed with a specific GFP antibody at 4 C for 4 hr, followed by the addition of protein A agarose beads for 2 hr. The bound lysosomes were washed using extraction buffer for four times and subjected to western blot or immunostaining. Cell Fractionation Cells were washed with iced PBS and scraped into hypotonic buffer (10 mM HEPES, pH 8.0, 10 mM KCl, 3 mM MgCl2, 0.5 mM DTT, and protease inhibitors). Cell lysates were incubated on ice for 10 min and Triton X-100 was added to a final concentration of 0.3% (w/ v). After centrifugation at 500 g for 5 min at 4 C, the supernatant was used as the cytoplasmic fraction. The pellet was washed twice with hypotonic buffer and reconstituted in RIPA buffer (100 mM Tris-HCl, pH 8.0, 1% Triton X-100, 100 mM NaCl, 0.5 mM EDTA, and protease inhibitors). After centrifugation at 15,000 g for 10 min, the resulting supernatant was used as the nuclear fraction. For immunoprecipitation between mTORC1 and p300, Raptor was immunoprecipitated from nuclear or cytoplasmic fraction using anti-Raptor. The immunocomplexes were washed with high-salt CHAPS buffer (0.5 M NaCl) and subjected to western blot. For in vitro kinase assay, mTORC1 from nuclear or cytoplasmic fraction was immunoprecipitated using anti-Raptor and washed with 1 3 mTORC1 kinase buffer. Then the precipitates were subjected to in vitro kinase assay using recombinant Flag-p300 as the substrate with or without ATP. Fluorometric p300 Activity Assay Endogenous p300 or p300-Flag was immunoprecipitated from cells. The immunoprecipitated proteins were incubated with acetylCoA and peptide substrate p53 peptide (aa 368-386) at 37 C for 15 min according to the manufacturer’s instructions. The reaction was stopped with Stop Solution, followed by further incubation with Developer Solution for 30 min at room temperature. The activity of p300 was assessed by measuring the fluorescent emission at 513 nm following excitation at 389 nm. Fluorometric Acetyl-CoA Quantitation Assay Intracellular acetyl-CoA levels were measured using an acetyl-CoA assay kit according to the manufacturer’s instructions. Briefly, cells were harvested and sonicated. After centrifugation at 15,000 g for 15 min at 4 C to remove the insoluble materials, the samples were deproteinized and incubated with Reaction Mix at 37 C for 10 min. The intracellular acetyl-CoA level was assessed by measuring the fluorescent emission at 587 nm following excitation at 535 nm. After correcting the background from all readings, values for each sample were determined and normalized by protein concentration of each sample. Oil Red O Staining Oil Red O staining was performed as described previously (Lin et al., 2007). In brief, HepG2 cells were washed three times with iced PBS and fixed with 4% formaldehyde. Then the cells were washed and stained with Oil Red O solution (stock solution: 3 mg/ml isopropanol; working solution: 60% Oil Red O stock solution and 40% distilled water) for 1 hr at room temperature. After staining, cells were washed to remove unbound dye. The nucleus was stained with hematoxylin staining solution (Sangon Biotech). To quantify Oil Red O content levels, isopropanol was added to each sample shaken at room temperature for 5 min, and each sample was assessed spectrophotometrically at 510 nm. Fluorometric Free Fatty Acid Quantitation Assay Intracellular fatty acid levels were measured using a free fatty acid quantitation assay kit according to the manufacturer’s instructions. Briefly, Cells were harvested and homogenized in chloroform/Triton X-100 (1% Triton X-100 in pure chloroform). After centrifugation at 15,000 g for 10 min at room temperature, collect organic phase (lower phase), air dry to remove chloroform, and dissolve the dried lipids in Fatty Acid Assay Buffer. Then the samples were incubated with ACS Reagent for 30 min, and incubated with Reaction Mix protected from light for another 30 min at 37 C. The intracellular free fatty acid level was assessed by measuring the fluorescent emission at 587 nm following excitation at 535 nm. After correcting the background from all readings, values for each sample were determined and normalized by protein concentration of each sample.


RNA Isolation and Real-Time PCR Total RNA was isolated using TRIzol from cultured HepG2 cells and reverse transcribed using Oligo (dT), dNTPs and M-MLV reverse transcriptase (Promega). The resulting cDNA was subjected to real-time PCR analysis with gene-specific primers in the presence of SYBR Green PCR Master Mix (Takara) and the ABI7500 real-time PCR system. The primers used, FASN forward, GCAGCCTTCTCAGCCAGCACAAA, FASN reverse, AGACGATGAGCACCAACGACACGA; SCD forward, CCAGGTTTGTAGTACC TCCTCTG, SCD reverse, TGATGTCTATGAATGGGCTCG; ELOVL6 forward, CCTAGTTCGGGTGCTTTGCTT, ELOVL6 reverse, TTTTCTGCTCTGTATGCTGCCTTTA; ACTB forward, TTGCGTTACACCCTTTCTTG, ACTB reverse, CACCTTCACCGTTCCAGTTT. Chromatin Immunoprecipitation Assay Chromatin immunoprecipitation (ChIP) assay was performed as described previously (Xu et al., 2016). Briefly, HepG2 cells were cross-linked using formaldehyde, and lysed with SDS lysis buffer (50 mM Tris-HCl, pH 8.1, 10 mM EDTA, pH 8.0, 1% SDS) containing protease inhibitors, then subjected to sonication. The cross-linked, sonicated chromatin was cleaned and incubated with the indicated antibodies and rotated at 4 C overnight. After extensive washes, immunocomplexes were treated with proteinase K (Beyotime) and decrosslinked. Bound DNA in the precipitates, as well as input DNA, was extracted, purified, and subjected to real-time PCR analysis using primers corresponding to the promoter region of FASN. The forward primer was GAGGGAGCCAGAGAGACGGC, and the reverse primer was CCGGCTGCTCGTACCTGG. HPLC/MS/MS in an LTQ Mass Spectrometer To prepare samples for mass spectrometric analysis of phosphorylation site(s) of p300 by mTORC1, recombinant Flag-p300 was incubated with recombinant mTORC1 in the presence of ATP, and then separated by SDS-PAGE and depicted with colloidal Coomassie blue staining. Following reduction and alkylation, in-gel digestion of p300 was performed with MS-grade modified trypsin (Promega) at 37 C overnight. The peptides were extracted twice with 1% trifluoroacetic acid in 50% acetonitrile aqueous solution. The extracts were then combined and dried in a Speedvac. For LC-MS/MS analysis, the tryptic digested peptides were directly loaded onto an in-house packed capillary reverse-phase C18 column (150 mm length, 360 mm OD 3 75 mm ID, 2.5 mm particle, 100 A˚ pore diameter) connected to an Agilent HPLC1260 system (Agilent Technology) and then desalted online for 60 min. The samples were analyzed with a 180 min-HPLC gradient from 0% to 100% of 0.1% formic acid in acetonitrile at a flow rate of 300 nl/min. The eluted peptides were ionized and directly introduced into a Q-Exactive mass spectrometer (Thermo Fisher Scientific) using a nano-spray source. Survey full-scan MS spectra (m/z 300–1800) were acquired in the Orbitrap analyzer with resolution r = 70,000 at m/z 400. QUANTIFICATION AND STATISTICAL ANALYSES All the statistical data are presented as mean ± SEM. The statistical significance of differences was determined using Student’s t test. p < 0.05 was considered to be statistically significant.
