Multifaceted Capsid Proteins: Multiple Interactions Suggest Multiple ...

MPMI Vol. 27, No. 12, 2014, pp. 1356–1369. http://dx.doi.org/10.1094/MPMI-07-14-0195-R

e -Xtra*

Multifaceted Capsid Proteins: Multiple Interactions Suggest Multiple Roles for Pepino mosaic virus Capsid Protein Matthaios M. Mathioudakis,1,2 Luis Rodríguez-Moreno,3 Raquel Navarro Sempere,3 Miguel A. Aranda,3 and Ioannis Livieratos1 Μediterranean Agronomic Institute of Chania, Department of Sustainable Agriculture, Alsylio Agrokepio, Chania 73100, Greece; 2Plant Pathology Laboratory, Faculty of Agriculture, Aristotle University of Thessaloniki, P.O.B. 269, Thessaloniki 54124, Greece; 3Departamento de Biología del Estrés y Patología Vegetal, Centro de Edafología y Biología Aplicada del Segura (CEBAS)-CSIC, PO Box 164, 30100 Espinardo, Murcia, Spain 1

Submitted 4 July 2014. Accepted 14 August 2014.

Pepino mosaic virus (PepMV) (family Alphaflexiviridae, genus Potexvirus) is a mechanically transmitted tomato pathogen that, over the last decade, has evolved from emerging to endemic worldwide. Here, two heat-shock cognate (Hsc70) isoforms were identified as part of the coat protein (CP)/Hsc70 complex in vivo, following full-length PepMV and CP agroinoculation. PepMV accumulation was severely reduced in Hsp70 virus-induced gene silenced and in quercetin-treated Nicotiana benthamiana plants. Similarly, in vitro–transcribed as well as virion RNA input levels were reduced in quercetin-treated protoplasts, suggesting an essential role for Hsp70 in PepMV replication. As for Potato virus X, the PepMV CP and triple gene-block protein 1 (TGBp1) self-associate and interact with each other in vitro but, unlike in the prototype, both PepMV proteins represent suppressors of transgene-induced RNA silencing with different modes of action; CP is a more efficient suppressor of RNA silencing, sequesters the silencing signal by preventing its spread to neighboring cells and its systemic movement. Here, we provide evidence for additional roles of the PepMV CP and host-encoded Hsp70 in viral infection, the first as a truly multifunctional protein able to specifically bind to a host chaperone and to counterattack an RNA-based defense mechanism, and the latter as an essential factor for PepMV infection. Pepino mosaic virus (PepMV) is a highly infectious potexvirus that, over the last 20 years, has become an endemic pathogen in tomato crops worldwide (Hanssen and Thomma 2010). Each of the four PepMV genotypes (i.e., original Peruvian [LP], European [EU], American [US1], and Chilean [CH2]) described to date can cause significant economic losses, inducing mild or severe yellowing or necrotic symptoms in tomato (Hanssen et al. 2010; Hasiow-Jaroszewska et al. 2013). The PepMV CH2 strain, which is the most widespread, has overtaken PepMV EU in Europe and the United States (Gómez et Corresponding author: I. Livieratos; E-mail: [email protected] * The e-Xtra logo stands for “electronic extra” and indicates that one supplementary table is published online and that Figures 2 through 6 appear in color online. © 2014 The American Phytopathological Society

1356 / Molecular Plant-Microbe Interactions

al. 2009; Ling et al. 2013). PepMV possesses a 6.4-kb singlestranded RNA genome, encoding the RNA-dependent RNA polymerase (RdRp, 164 kDa), three triple gene-block (TGB) proteins of 26 (TGBp1), 14 (TGBp2), and 9 (TGBp3) kDa, and the coat protein (CP) (Aguilar et al. 2002). PepMV cDNA- and agroinfectious clones from both the EU and CH2 genotypes are available (Duff-Farrier et al. 2011; HasiówJaroszewska et al. 2009; Sempere et al. 2011) to facilitate studies on symptom induction, resistance mechanisms, virus replication, translation, and movement. In addition, an in vitro transcriptionally active RdRp system has been set up, which, in combination with cDNA infectious clones, can assist the dissection of essential requirements for PepMV positive- and negative-strand synthesis (Osman et al. 2012). A transcriptome analysis of tomato seedlings inoculated with a mild or an aggressive PepMV isolate showed a differential expression of transcripts suggesting plant-virus interactions at multiple levels (Hanssen et al. 2011). For PepMV TGBp1 and CP, specific host-virus protein interactions have been reported, respectively, with the tomato catalase 1 (CAT1) and heat-shock cognate protein 70 (Hsc70) (Mathioudakis et al. 2012, 2013). The former interaction significantly elevates the H2O2 scavenging efficiency of CAT1 to assure high levels of virus accumulation (Mathioudakis et al. 2013). In the latter interaction, for which no biological role has yet been suggested, Hsc70 is up-regulated and comes into contact with PepMV virions (Mathioudakis et al. 2012). The multiple roles of cytosolic Hsp70 chaperones in various plant cellular processes have been thoroughly reviewed by Mayer and Bukau (2005). A role for Hsp70 was first described almost 20 years ago in terms of responsiveness to virus infection (Aranda et al. 1996) and, later, in relation to virus replication and movement and by interference with antiviral host responses (Aparicio et al. 2005; Chen et al. 2008; Hafren et al. 2010; Nagy et al. 2011; Verchot 2012; Whitham et al. 2003). For other potexviruses, Hsp70 is induced upon Potato virus X (PVX) infection (Chen et al. 2008) and, in the case of Bamboo mosaic virus (BaMV), a host Hsp90 has been reported to bind specifically the viral 3′ untranslated region (UTR) and RdRp, thus promoting viral replication (Huang et al. 2012). Apart from their structural functions, viral CP may be involved in virus transmission, translation, replication, movement, modulation, and the suppression of host responses (Ivanov and Makinen 2012). PVX CP forms complexes with viral RNA and TGBp1 that traffic towards plant plasmodesmata to

facilitate virus movement (Lough et al. 2006). PepMV CP, the elicitor of Rx resistance (Bendahmane et al. 1995; Candresse et al. 2010), was also found to affect the nature and severity of the induced symptoms irrespective of the viral isolate (Hasiow-Jaroszewska et al. 2013) and to be required for virus movement (Sempere et al. 2011) as shown for other potexviruses in conjunction with homologous and/or heterologous interactions with TGBp1 (Verchot-Lubicz et al. 2010). RNA silencing regulates gene expression in most eukaryotes, acting both at a transcriptional and posttranscriptional level, whereas in plants and invertebrates, the same pathway also functions directly in anti-viral defense by targeting virus RNA (Pumplin and Voinnet 2013). In RNA silencing, small interfering (si)RNAs (21 to 25 nt long) produced by the Dicerlike enzymes (DCL) (RNase type III group) are loaded by Argonaute proteins (AGO) onto an RNA-induced silencing complex (RISC) for cleavage or translational repression, or both, of the target RNA transcripts in a sequence-specific manner (Hamilton and Baulcombe 1999; Voinnet 2002). To counterattack, plant viruses express suppressors of RNA silencing. For non–TGBp encoding viruses, the CP may perform this function (Levy et al. 2008; Voinnet 2005), whereas, for several potexviruses, TGBp1 is the only suppressor identified to date (Senshu et al. 2009; Voinnet et al. 2000). In PepMV-infected plants, overexpression of DCL2/4 has been reported (Hanssen et al. 2011) and no PepMV-encoded suppressor has yet been identified. The essential contribution of conserved Hsp chaperones for viral infection is becoming increasingly apparent, while reports describing additional nonstructural functions of viral CP gradually increase (Ivanov and Makinen 2012; Nagy and Pogany 2012; Nagy et al. 2011; Verchot 2012). Here, the formation of the PepMV CP and heat shock chaperone complex was verified in vivo, its latter component was shown to have an essential role in PepMV infection and, moreover, PepMV CP self-

associates and interacts with TGBp1, both acting as suppressors of RNA silencing with diverse modes of function. This is the first report of a potexvirus-encoded CP acting as a suppressor of RNA silencing. RESULTS Specific CP-Hsp70 interaction in plants following virus infection and transient expression. In order to verify in planta the interaction between Hsc70 protein and PepMV CP (Mathioudakis et al. 2012), a commercial One-STrEP-tag (OST) was genetically fused to the CP of the PepMV-Sp13 infectious clone (Sempere et al. 2011). The infectivity and stability of the resulting recombinant clone PepMVSp13-OST-CP was evaluated at different timepoints (8, 12, and 15 days postinoculation [dpi]) both in tomato and Nicotiana benthamiana plants. In all cases, plants inoculated with PepMVSp13-OST-CP showed symptoms indistinguishable to those induced by the wild-type (WT) virus (data not shown), and the presence of the recombinant RNA was verified by reverse transcription-polymerase chain reaction (RT-PCR), using total RNA extracts (Fig. 1A). Following the stability validation, agroinfectious vectors corresponding to PepMV-Sp13-OST-CP (pBPepXL6-OST-CP) and PepMV-Sp13 (pBPepXL6) were used to inoculate tomato and N. benthamiana plants in order to identify by affinity chromatography the host proteins interacting with OST-CP. Crude protein extracts obtained 8 dpi from pBPepXL6-OST-CP or pBPepXL6 agroinoculated plants were passed through specific Strep-Tactin columns, and the eluted extracts were silver-stained following sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) separation. A specific band approximately 85 to 90 kDa in size was differentially observed in pBPepXL6-OST-CP–treated tomato (Fig. 1B) and N. benthamiana (data not shown) extracts. Mass spectrometry of the gel-extracted protein band as well as the eluted frac-

Fig. 1. Detection of the One-STrEP-tag coat protein (OST-CP) recombinant protein in tomato plants. A, Reverse transcription-polymerase chain reaction from total-RNA isolated following PepMV-SP13 (WT) and PepMV-SP13_OST-CP inoculation. B, Silver-stained acrylamide gel showing the eluted fractions (E2 to E4) following agroinoculation of tomato plants with pBPepXL6-OST-CP and pBPepXL6 12 days postinoculation. Broad-range protein molecular weight marker (Promega) (M) was included in the gel and the sizes of its proteins are shown in the right side of the panel. Vol. 27, No. 12, 2014 / 1357

tion yielded a set of 10 peptides covering approximately 20 to 25% of the Hsc70 amino acid sequence. The length of the peptides varied between 13 (KNALENYSYNMRN) and 25 (KSI NPDEAVAYGAAVQAAILSGEGNEKV) amino acids. Each of the 10 peptides was blasted against the three characterized Hsc70 isoforms of Solanum lycopersicum (Lin et al. 1991; Sun et al. 1996), and all existing Hsc70 sequences from the National Center for Biotechnology Information (NCBI) database (XM_004250911, XM_004250910, XM_004249526, XM_ 004246354, XM_004235839, XP_004235887). Two peptides (KEIAEAFLGSTVKN and RTTPSYVGFTDTERL) were specific for Hsc70 isoform 1 (GenBank X54029) and KNQVAM NPTNTVFDAKR peptide for isoform 3 (GenBank L41253). All seven remaining peptides showed 100% identity with at least two of the three isoforms, preventing unequivocal determination of whether more isoforms were also present in the complex. An unspecific protein of approximately 55 kDa was also analyzed by liquid chromatography tandem mass spectrometry (LCMS/MS), resulting in several peptides belonging to the ubiquitous ribulose 1, 5-bisphosphate carboxylase protein. An additional affinity chromatography experiment was carried out in N. benthamiana plants following transient expression of PepMV CP alone. The OST-CP fusion was cloned into a binary gateway expression vector (pGWB2-OST-CP) and coagroinfiltrated with the Tomato bushy stunt virus (TBSV) silencing suppressor p19 into 2-week-old N. benthamiana leaves. At 5 dpi, agroinfiltrated leaves were collected and crude protein extracts were passed through Strep-Tactin columns. Following gel silver staining, a band of approximately 70 kDa was confirmed by LC-MS/MS to correspond to Hsp70 (data not shown); whereas no additional proteins were detected. Knockdown of Hsp70 inhibits PepMV accumulation in N. benthamiana. To dissect the effect of Hsp70 on PepMV infection, Hsp70 mRNAs were silenced using a virus-induced gene silencing (VIGS) Tobacco rattle virus (TRV)-based agroinfiltration assay (Hayward et al. 2011). A 407-nt fragment from the 5′ end of the N. benthamiana Hsp70 gene (GenBank GU575116) (Hafren et al. 2010) was amplified and cloned into pTRV2 to generate the recombinant plasmid pTRV2-Nb-Hsp. This construct was coagroinfiltrated with the pTRV1 plasmid into N. benthamiana leaves, resulting in Hsp-silenced (TRV-Hsp) plants exhibiting a specific severe phenotype of curling leaves, dwarfing, and leaf necrosis (15 dpi) (Fig. 2A), as previously reported (Hafren et al. 2010; Wang et al. 2009). Co-agroinfiltration of pTRV1 with pTRV2-PDS (positive control of the VIGS assay) or pTRV2 (negative control) generated TRV-PDS and TRV-control (TRVC) plants. The phenotype in the TRV-PDS plants was fully developed 6 dpi (data not shown), when a set of upper leaves were mechanically inoculated with PepMV, followed by plant tissue collection from the inoculated (local) and next set of upper leaves (systemic) at 10 dpi to determine mRNA or protein levels for plant Hsp70 and viral CP and RdRp. A semiquantitative PCR assay confirmed high levels of silencing for the Hsp70 gene. The Hsp70 mRNA levels in systemic TRV-Hsp leaves were 19-fold lower and barely detectable after 30 cycles and gel overexposure when compared with TRV-C plants (Fig. 2B). The analysis of PepMV CP gene RNA levels indicated a 15-fold reduction, with detectable product observed only after 32 PCR cycles (Fig. 2C). In the case of PepMV RdRp genomic (g)RNA, the levels in TRV-Hsp plants compared with negative control plants reached detectable levels only when 2.5 times the initial template was used and followed by overexposure (Fig. 2C, PepMV RdRp II panels). The previous data was further supported by immunoblot analysis of the same samples. The Hsp70 expression levels of the TRV-Hsp plants were reduced by 18% 1358 / Molecular Plant-Microbe Interactions

in locally inoculated leaves, whereas systemically, the reduction of Hsp70 expression reached 75% of those in TRV-C plants (Fig. 2D). In agreement, PepMV CP levels were also reduced by 28% locally (Hsp70 silencing levels relatively lower) and could not be detected in systemic leaves reaching a 94% reduction compared with TRV-C plants (Fig. 2D). These data represent the outcome of three experiments using two plants per treatment, and remarkably, low levels of variability were observed among plants, within groups, and between experiments. No differences were observed in PepMV accumulation levels between TRV-C and WT (no TRV agroinfiltration) plants (data not shown), confirming that a PepMV/TRV mixed infection did not affect the accumulation of the former. Inhibition of Hsp70 expression by quercetin reduces PepMV accumulation in N. benthamiana plants and protoplasts. A pharmacological approach to investigate PepMV accumulation levels in the absence of the host gene was applied using quercetin, a flavonoid inhibitor that is known to downregulate Hsp70 mRNA expression (Hosokawa et al. 1990; Manwell and Heikkila 2007) and has been used in various studies with plant viruses (Hafren et al. 2010; Wang et al. 2009). N. benthamiana leaves were infiltrated with dimethyl sulfoxide (DMSO) in the presence or the absence of quercetin before PepMV mechanical inoculation. Plants infiltrated with DMSO and quercetin exhibited a few necrotic lesions 4 dpi (Fig. 3A) in contrast to negative control plants, which remained completely unaffected. At 4 dpi, plant tissue was collected from PepMV-inoculated leaves and the Hsp70 and CP protein levels were compared by immunoblot analysis. In quercetin-treated plants, Hsp70 protein levels were significantly reduced, compared with DMSOtreated plants, to 50 to 73% of the levels in the controls, and a corresponding decrease in PepMV CP accumulation was observed (65 to 92% reduction) (Fig. 3B). Both the VIGS and the pharmacological inhibition of Hsp70 expression in whole N. benthamiana plants strongly indicated an essential role of this host factor in PepMV infection. To further investigate the role of Hsp70 in PepMV replication or movement, we examined the effect of quercetin on PepMV RNA accumulation at a single-cell level. Quercetin dissolved in DMSO was added to isolated protoplasts prior and subsequently to polyethylene glycol (PEG)-mediated transfection with either two different in vitro T7–transcribed viral mRNA or virion RNA. DMSO treatment in the absence of quercetin (D) was used as a negative control, whereas protoplasts transfected with PepMV RNAs (called pPepXL6) without DMSO or quercetin served as an additional negative control (–) of the transfection method. Total RNA extracted from PepMV-infected N. benthamiana plants was used as a control of the Northern blot and hybridization assay. The results clearly showed that the effect of quercetin (Q) (Fig. 3C) reduced PepMV gRNA accumulation by approximately 83 to 95% for both RNA inputs. Western blot analysis of protoplast protein extracts also demonstrated the reduction of the host protein expression levels (Fig. 3D) in the quercetin-treated samples, in agreement with the previous results. Treatment with DMSO alone had no affect on PepMV replication for either of the two RNA inputs (Fig. 3C). These data were the outcome of three experiments with two replicates for each RNA transfection, suggesting an essential role for Hsp70 at a particular stage of PepMV replication rather than virus movement. PepMV TGBp1 and CP suppress RNA silencing in a diverse manner. To identify potential PepMV-encoded suppressors of RNAsilencing TGBp1, TGBp2, TGBp3, and CP were expressed

using the Agrobacterium-mediated transient expression system (Voinnet et al. 2000) in WT or green fluorescent protein (GFP)-transgenic (line 16c) N. benthamiana plants. The first two sets of experiments tested whether each of the four PepMVencoded proteins was able to suppress initiation of the transgene-induced sense-posttransciptional gene silencing (S-PTGS). Leaves of N. benthamiana WT plants were co-agroinfiltrated with pBIN/35S-mGFP4 and each of the four PepMV pGreen constructs (pGR-TGBp1, pGR-TGBp2, pGR-TGBp3, pGRCP) and was used to test the effect of the candidate suppressor on S-PTGS induced by overexpression of an infiltrated GFP transgene (Fig. 4A). At 10 dpi, GFP silencing was apparent as

the absence of fluorescence in those patches infiltrated with the pGreen empty vector (pGR[–]) and the TGBp2-3 treatments, but fluorescence was maintained in the areas in which PepMV TGBp1 or CP were expressed (Fig. 4A) for 15 and 17 dpi, respectively (data not shown). S-PTGS suppression by CP was more efficient as assessed macroscopically under UV light (GFP fluorescence intensity) and Western blot analysis (Fig. 4B). To confirm the ability of the candidate protein to suppress the S-PTGS of a stably expressed transgene, a second type of experiment was conducted using N. benthamiana 16c transgenic plants, using the same transient expression system (Fig. 4C). Over a period of 25 days, GFP fluorescence peaked at 3 dpi

Fig. 2. Knockdown of Hsp70 plants by a virus-induced gene silencing (VIGS) Tobacco rattle virus (TRV)-based assay reduces the Pepino mosaic virus (PepMV) accumulation in Nicotiana benthamiana plants. A, Top panel: Phenotypes of N. benthamiana plants 5 days (left) after Hsp70 silencing by the TRVVIGS system. The photographs were taken 1 to 2 days before PepMV inoculation of the upper leaves. At 17 days after TRV infection, the Hsp70-silenced plants died (right). Bottom panel: Phenotypes of N. benthamiana-TRV control plants (TRV-C; left) and the Hsp70-silenced (TRV-Hsp; right) plants after 10 days of TRV infection and 4 days of PepMV inoculation. The photographs were taken after the collection of plant tissue for mRNA and protein analysis. 1, 2, and 3 indicate the TRV-agroinfiltrated, PepMV-mechanically inoculated (local), and PepMV-systemically infected leaves, respectively. B, Quantification of Hsp70 mRNA levels by semiquantitative polymerase chain reaction (PCR) in PepMV inoculated N. benthamiana TRV-C and TRV-Hsp plants, as indicated. The amplification cycles are indicated above the panels. C, Quantification of the coat protein (CP) and RNA-dependent RNA polymerase (RdRp) subgenomic and genomic mRNA levels by semiquantitative PCR in PepMV-inoculated N. benthamiana TRV-C and TRV-Hsp plants, as indicated. In the PepMV RdRp II panel, 2.5-fold times more template of the initial template amount (PepMV RdRp I) was used. Amplification cycles are indicated above the panels. D, Western blotting in systemic leaves of N. benthamiana TRV-C and TRV-Hsp plants, 4 days after PepMV infection, using α-Hsp70 (top panel) and αPepMV CP (middle panel) antibodies. The small unit of Rubisco protein (LC; bottom panel) stained with Coomassie brilliant blue served as protein loading control. Vol. 27, No. 12, 2014 / 1359

and decreased thereafter, completely disappearing by 7 dpi for the negative control, TGBp2, and TGBp3 treatments, as a result of the induction of S-PTGS (Fig. 4C). In tissues where TGBp1 and CP were co-expressed with 35S-mGFP4, fluorescence was maintained for 12 and 16 dpi for TGBp1 and CP, respectively, with the latter exhibiting the highest levels of GFP intensity (Fig. 4C). Western blot analysis at 8 dpi (Fig. 4D), in full agreement with the phenotypic analysis of the agroinfiltrated patches, confirmed the ability of CP and TGBp1 to act as local suppressors of S-PTGS. In a third type of experiment, the ability of TGBp1 and CP suppressors to effectively act downstream of RdR polymerase activity through an inverted repeat transgene-induced

RNA silencing pathway was investigated. N. benthamiana WT leaves were co-agroinfiltrated with a mixture of 35S-mGFP4 (expressing sense GFP), 35S-hpGFP (hairpin construct expressing double-stranded [ds]RNA GFP), in addition to TGBp1, TGBp2, TGBp3, or CP. The phenotypic analysis of fluorescence over a period of 25 days was as described above. Green fluorescence peaked 3 dpi and was completely silenced at 6 dpi, when maximal suppression or no fluorescence was observed (Fig. 4E). No inhibition of silencing was observed for TGBp2 or TGBp3 in patches where they were infiltrated together with 35S-mGFP4 plus dsRNA GFP. However TGBp1 or CP acted as local suppressors of the inverted repeat PTGS (IR-PTGS) pathway, as their presence resulted

Fig. 3. Inhibition of Hsp70 mRNA expression by quercetin treatment reduces the Pepino mosaic virus (PepMV) accumulation in Nicotiana benthamiana plants and protoplasts. A, Phenotypes of either dimethyl sulfoxide (DMSO)- or quercetin-treated N. benthamiana plants 4 days after PepMV inoculation. The arrows indicate the DMSO- or quercetin-treated leaves. B, Western blotting of PepMV-inoculated leaves treated either with DMSO (lane 1) or quercetin (lanes 2 to 4, corresponding to different plants) 4 days after inoculation, using α-Hsp70 (top panel) and α-PepMV coat protein (CP) (second panel) antibodies. The third panel is an overexposure of the second one and the asterisk indicates the faint CP band. C, Northern blotting of total RNA samples prepared from N. benthamiana protoplasts treated either with DMSO or quercetin (labeled as D and Q, respectively) 24 h posttransfection, using either two different in vitro–transcribed PepMV RNAs (pPepXL6 clone) or RNA extracted from purified PepMV virions. (–) and – represent total RNAs from protoplasts transfected either with PepMV RNA without any treatment or without viral RNA (mock), respectively; + represent total RNA from PepMV infected N. benthamiana leaves used as control of the Northern assay. Viral genomic RNA bands are indicated by an arrow. The ethidium-bromide stained gel (bottom panel) shows rRNA from protoplasts samples. D, Western blotting of N. benthamiana protoplasts transfected with PepMV and treated either with DMSO, quercetin, or untreated 24 h posttransfection, using α-Hsp70 antibodies. The last lane represents total protein extract from protoplasts without viral transfection. In B and D, the small unit of Rubisco protein (LC; bottom panel) stained with Coomassie Brilliant Blue served as protein loading control. 1360 / Molecular Plant-Microbe Interactions

in the maintenance of fluorescence for 11 and 15 dpi, respectively (Fig. 4E). These results are at variance with those reported for other potexviruses (Senshu et al 2009). As described previously in S-PTGS experimentation, the CP-maintained fluorescence was stronger than that of TGBp1, with higher GFP accumulation levels as verified by Western blot analysis (Fig. 4F). To our knowledge, this is the first report of CP-mediated suppression of RNA silencing among members of the genus Potexvirus.

The ability of PepMV CP and TGBp1 to reverse the RNA silencing mechanism and restore the expression of a transgene in already silenced tissue was also tested. Leaves of transgenic N. benthamiana 6.4 plants with established silencing of GFP (Tournier et al. 2006) were individually agroinfiltrated with an empty pGreen vector or with the same vector expressing the Tobacco etch virus (TEV) HcPro (positive control), PepMV TGBp1, or CP. GFP silencing in N. benthamiana 6.4 plants was found not to be 100% complete, as GFP was detected at

Fig. 4. Pepino mosaic virus (PepMV) TGBp1 and coat protein (CP) proteins suppress RNA silencing of green fluorescent protein (GFP) in Nicotiana benthamiana plant species. A, Suppression of single-stranded (ss)RNA-induced RNA silencing of GFP in N. benthamiana wild-type plants. Leaves were infiltrated with mixtures of Agrobacterium cultures harboring the 35S-mGFP4 construct either in combination with the pGreen empty vector [pGR(–); negative control] or with the pGreen constructs expressing the PepMV TGBp1 (pGR-TGBp1), TGBp2 (pGR-TGBp2), TGBp3 (pGR-TGBp3), CP (pGR-CP), and Tomato chlorosis virus (ToCV) p22 (positive control). UV light images were taken 10 days postinoculation (dpi). B, Western blot analysis of GFP protein levels extracted from the infiltrated patches as indicated above each lane at 10 dpi, using α-GFP antibodies (top panel). C, Suppression of ssRNA-induced RNA silencing of GFP in N. benthamiana 16c plants. Leaves were infiltrated with mixtures of Agrobacterium cultures harboring the 35S-mGFP4 construct either in combination with the pGR(–) or with pGR-TGBp1, pGR-TGBp2, pGR-TGBp3, pGR-CP, and ToCV p22. UV light images were taken at 8 dpi. D, Western blot analysis of GFP protein levels extracted from the infiltrated patches as indicated above each lane at 8 dpi, using α-GFP antibodies (top panel). The first line represents protein extract from a patch only infiltrated with GFP, whereas the last line represents a protein extract sample from a noninfiltrated patch. The one asterisk indicates endogenous GFP and two asterisks the transiently expressed GFP. E, Suppression of double-sranded RNA–induced RNA silencing of GFP in N. benthamiana wildtype plants. Leaves were infiltrated with mixtures of Agrobacterium cultures harboring the 35S-mGFP4 and 35S-hpGFP constructs, either in combination with the pGR(–) or with pGR-TGBp1, pGR-TGBp2, pGR-TGBp3, pGR-CP, and ToCV p22. UV light images were taken 6 dpi. F, Western blot analysis of GFP protein levels extracted from the infiltrated patches as indicated above each lane at 8 dpi, using α-GFP antibodies (top panel). The first line represents protein extract from a patch only infiltrated with GFP, whereas the last line represents protein extract samples from a noninfiltrated patch. In B, D, and F, the small unit of Rubisco protein (LC; bottom panel) stained with Coomassie brilliant blue served as protein loading control. Vol. 27, No. 12, 2014 / 1361

very low levels in the negative controls. The restoration of GFP expression, as assessed by the UV light examination of infiltrated patches was not observed up to 15 dpi, both for TGBp1 and CP, as compared with the positive control HcPro (7 dpi) (Fig. 5A) and was confirmed by Western blot analysis (Fig. 5B).

The ability of PepMV CP and TGBp1 to interfere with the cell-to-cell or systemic spread of the RNA silencing signal was examined. GFP expression was monitored in the neighboring cells of infiltrated patches and in systemic leaves. To examine the first, N. benthamiana 16c plants were co-agroinfiltrated with 35S-mGFP4 plus either pGreen empty vector or pGreen

Fig. 5. Pepino mosaic virus (PepMV) TGBp1 and coat protein (CP) suppressors are functionally divergent. A, Effect of PepMV TGBP1 and CP in restoration of green flourescent protein (GFP) expression in already silenced tissue (reversal silencing assay). Leaves of Nicotiana benthamiana 6.4 transgenic line (established GFP silencing) were infiltrated individually with Agrobacterium cultures of the pGreen empty vector [pGR(–); negative control] or the pGreen constructs expressing the PepMV TGBp1 (pGR-TGBp1), TGBp2 (pGR-TGBp2), TGBp3 (pGR-TGBp3), CP (pGR-CP), and Tobacco etch virus Hc-Pro (positive control). UV light images were taken 7 days postinoculation (dpi). B, Western blot analysis of GFP protein levels extracted from infiltrated patches with Hc-Pro (1), pGR-TGBp1 (2), pGR-CP (3), and pGR(-) (4) at 10 dpi, using α-GFP antibodies (top panel). The small unit of Rubisco protein (LC; bottom panel) stained with Coomassie brilliant blue served as protein loading control. C and D, Interference of PepMV TGBp1 and CP with the cell-to-cell movement of the silencing signal of GFP. Leaves from N. benthamiana 16c plants were infiltrated mixtures of Agrobacterium cultures harboring the 35S-mGFP4 construct either in combination with the pGR(–) or with pGR-TGBp1, pGR-CP, Tomato chlorosis virus (ToCV) p22, and Cymbidium ringspot virus (CymRSV) p19. Arrows indicate a red fluorescent ring around the infiltrated patch corresponding to the exit of the silencing signal. UV light images were taken 10 dpi. E, Interference of PepMV TGBp1 and CP with the systemic (long-distance) spread of the silencing signal of GFP. Leaves from N. benthamiana 16c plants were infiltrated as described in C and D. UV light images of the plants were taken at 12 and 30 dpi. 1362 / Molecular Plant-Microbe Interactions

expressing either Tomato chlorosis virus (ToCV) p22, TGBp1, or CP. The formation of red-fluorescent borders around the infiltrated patches corresponding to the exit of the DCL4-generated siRNA 21nt silencing signal (Dunoyer et al. 2005; Himber et al. 2003) was observed by 8 dpi in the case of pGreen empty vector. This cell-to-cell spread of the silencing signal and its rapid systemic induction was also observed for ToCV p22 (Fig. 5C) (Canizares et al. 2008). A border was also seen for TGBp1 at 10 dpi, indicating that TGBp1 could not sequester 21nt siRNAs and therefore prevent the movement of the silencing signal toward the neighboring cells (Fig. 5C). On the contrary, and similarly to the Cymbidium ring spot virus (CymRSV) p19 suppressor (Fig. 5D) (Himber et al. 2003; Silhavy et al. 2002), short-distance silencing spread as monitored by the formation of the red ring front did not take place in patches in which 35S-mGFP4 and CP infiltration took place (Fig. 5C to D), demonstrating the interference of CP with the cell-to-cell spread of the silencing signal. To examine the role of TGBp1 and CP in the systemic spread of the RNA silencing, GFP expression was monitored over a period of 40 dpi in the upper noninfiltrated leaves. At 11 dpi, systemic silencing was observed in N. benthamiana 16c plants co-agroinfiltrated

with 35S-mGFP4 and pGreen empty vector similarly to TGBp1 (12 dpi; Fig. 5E). At 30 dpi, the systemic silencing reached the upper leaves and the flowers in both cases (Fig. 5E) and the faint fluorescence in the petals was completely lost at 35 dpi (data not shown). By this time (either the starting point of systemic silencing at 10 to 12 dpi or at 30 dpi, when the silencing was complete in whole plants), the upper leaves and flowers of infiltrated plants with 35S-mGFP4 and CP maintained the green fluorescence (as in noninfiltrated N. benthamiana 16c plants) as showed also for the CymRSV p19 (Fig. 5E). Taken all together, these results demonstrate that TGBp1 and CP cannot reverse established silencing and that, while TGBp1 can efficiently suppress local RNA silencing, it is not able to prevent the short- or long-distance spread of the silencing signal, while CP is able to function in both manners. PepMV CP and TGBp1 self-associate and interact with each other. To assess potential homologous and heterologous interactions in planta and their subcellular localization between the two identified PepMV viral suppressors, a bimolecular fluorescent complementation (BiFC) assay was applied by agroinfil-

Fig. 6. In planta subcellular localization of Pepino mosaic virus (PepMV) viral-viral interactions by bimolecular fluorescent complementation (BiFC) in Nicotiana benthamiana cells. Reconstitution of yellow fluorescent protein (YFP) was visualized by confocal laser scanning microscopy after co-expression of the fusion proteins. A, Co-infiltration of pCYFP-TGBp1 and pNYFP-CP revealed their interaction in the cytoplasm and nucleus but not the nucleolus, using YFP and 4′,6-diamidino-2-phenylindole (DAPI) filters. B, Co-infiltration of pCYFP-CP with pNYFP-CP (upper panel) and pCYFP-TGBp1 with pNYFP-TGBp1 (lower panel) revealed their self-interactions in the cytoplasm and nucleus. In A and B, the third column (right) represents the overlay image generated from YFP and DAPI filters. C, Co-infiltrations of the pairwise combinations pCYFP-TGBp1 with pNYFP, pCYFP with pNYFP-TGBp1, pCYFPCP with pNYFP, and pCYFP with pNYFP-CP, all representing negative controls. Bars: denote 75 mm; c = cytoplasm; n = nucleus. Vol. 27, No. 12, 2014 / 1363

tration in N. benthamiana plants (Walter et al. 2004). PepMV TGBp1 and CP were fused with the C′-terminal fragment of a yellow fluorescent protein (YFP; pCYFP-TGBp1, pCYFP-CP) and were used in all combinations with the pNYFP-TGBp1 and pNYFP-CP constructs (Mathioudakis et al. 2012, 2013). The expression of TGBp1 and CP in infiltrated tissues was confirmed using α-HA (hemagglutinin) and α-c-myc antibodies in Western blot assays (data not shown). Co-expression of pCYFP-TGBP1 and pNYFP-CP induced the reconstitution of fluorescence, demonstrating their in planta interaction, localized throughout the cytoplasm and the nucleus (Fig. 6A). YFP fluorescence also was the outcome of pairwise co-expression of each protein, fused either with the C′- or N′-terminal YFP fragments displaying their self-interactions (Fig. 6B). The selfinteractions were localized in the cytoplasm and nucleus, evidencing no movement of either protein during their interaction with each other. No fluorescence signal was observed in all pairwise TGBp1 and CP combinations with the empty N′- and C′-YFP vectors (Fig. 6C). DISCUSSION Highly conserved Hsp70/Hsc70 chaperones function in plant cells and assist protein (re)folding, import, and translocation across membranes, complex assembly, and receptor signaling (Mayer and Bukau 2005). During infection by positivestranded plant RNA viruses, numerous essential roles have been attributed to Hsp70/Hsc70 as a result of their specific binding to viral proteins (including CP), RNAs, or both (Ivanov and Makinen 2012; Nagy and Pogany 2012; Nagy et al. 2011; Whitham et al. 2006). One important example of their involvement in viral infections is their utilization by closteroviruses to facilitate virion assembly and intercellular movement (Peremyslov et al. 1999; Satyanarayana et al. 2000). Nonspecific Hsp70 induction has also been reported as a general response to positive-stranded RNA plant virus infections (Aparicio et al. 2005). Previously, screening a tomato cDNA library using PepMVencoded CP in the yeast two-hybrid system was complemented by BiFC, full-length gene-to-gene yeast-two hybrid assays, immuno-gold labeling electron microscopy, and time-course analyses of mRNA and proteins to suggest that elevated levels of Hsc70.3 accumulate and form a complex with either CP, virions, or both in PepMV-infected plant cells (Mathioudakis et al. 2012). Here, we confirmed the formation of this complex in planta and attempted to identify one or more exact Hsp70 isoforms participating in the complex. Agroinoculation of an infectious, OST-tagged full-length PepMV RNA in tomato plants showed that, at least, the Hsc70.3 and Hsc70.1 isoforms participate in the complex. The actual elution of a Hsp70 protein following PepMV CP transient expression in N. benthamiana indicates that complex formation is independent of the presence of any other PepMV-encoded protein, whereas the host contributes no detectable additional proteins, without entirely excluding the possibility that other factors, such as cochaperones, might also participate. Similarly, a specific CPHsp70.3 interaction has been described for Potato virus A in N. benthamiana, in which Hsp70.3 together with its co-chaperone CPIP prevents particle assembly in favor of viral replication and translation (Hafren et al. 2010). In the follow-up reverse genetics experiments, a conserved region from the 5′ end of the N. benthamiana Hsp70 gene was selected to VIGS-silence its homologues. In N. benthamiana plants, Hsp70 levels were effectively reduced (18% local, 75% systemic) with a concomitant strong inhibition in PepMV RNA and CP accumulation (28% local, 94% systemic), whereas an additional gentler (pharmacological) treatment 1364 / Molecular Plant-Microbe Interactions

with quercetin reduced Hsp70 mRNA levels (by 50 to 73%) followed by a corresponding negative effect on the PepMV accumulation (65 to 92% reduction). The strong suggestion of an essential role of Hsp70 for efficient PepMV accumulation at the whole-plant level prompted the examination of its role in N. benthamiana protoplasts, an approach that would exclude any potential involvement in virus movement. Here, the addition of quercetin dramatically reduced PepMV RNA levels, both in the case of in vitro–transcribed viral and virion RNA. Overall, these data support an essential role for Hsp70 in PepMV replication, while they do not exclude an additional role for one or more Hsp70 isoforms during temporally and spatially diverse stages of virus infection and cannot unequivocally explain the role of a CP and Hsp70 complex. Bearing in mind that PepMV infectious clones in which CP was substituted by GFP retained their replication competence in protoplasts and that, on the other hand, for several CP-deficient potexvirus clones, including PepMV, the amount of positivesense RNA accumulation was reduced, an enhancing rather than essential role of the complex in replication of PepMV and other potexviruses seems plausible (Chapman et al. 1992; Forster et al. 1992; Lee et al. 2011; Lough et al. 2000; Sempere et al. 2011). In the paradigm of TBSV, host Hsp70 facilitates the insertion of viral replication proteins into intracellular membranes and promotes folding and stability of the replication complex (RC) (Nagy and Pogany 2012; Wang et al. 2009). Arabidopsis Hsc70-3 also comprises one component of the membranebound RC within the endoplasmic reticulum (ER)-derived vesicles, in which interaction with the Turnip yellow mosaic potyvirus RdRp and a poly(A) binding protein takes place (Dufresne et al. 2008). Similarly, for Tomato mosaic virus, affinity-purified replicase, as one part of the membrane-bound RC, is associated with the Hsp70, eEF1A, TOM1, and TOM2A proteins (Nishikiori et al. 2006). In yeast, Brome mosaic virus replicase associates with Hsp70 proteins to enhance viral RNA accumulation (Tomita et al. 2003). Beyond aiding assembly of viral RC, Hsp70 may contribute to virion assembly and cell-to-cell spread, as in the case of poty- and pomoviruses (Haupt et al. 2005; Hofius et al. 2007). Specific interactions of potexviruses with their host-encoded proteins, including chaperones, have also been reported (Verchot 2012; Verchot-Lubicz et al. 2007) and, recently, it was suggested that a Hsp90/RdRp/RNA 3′-end complex enhances BaMV replication during the initiation of negative-strand RNA synthesis (Huang et al. 2012). The J-domain proteins are the most common co-factors of Hsp70 homologues, which identify and recruit substrates to Hsp70 through direct interactions. Experiments in silenced and overexpressing NbDnaJ plants suggested that the latter is a negative regulator of PVX replication and movement through its interaction with CP and SL1 RNA (Cho et al. 2012). PVX has been, for decades, the main source of information on the pathogenesis, cell biology, and replication of potexviruses. It is known that potexvirus CP are essential for genome encapsidation, translational activation, cell-to-cell movement, and in the case of PVX and PepMV, elicitors of Rx resistance (Bendahmane et al. 1995; Verchot-Lubicz 2005). Here, similarly to PVX and other potexviruses (Leshchiner et al. 2008; Lu et al. 2009; Samuels et al. 2007; Wu et al. 2011), PepMV CP and TGBp1 were found to self-associate and interact with each other, possibly to support virus movement, since CP is indispensable for PepMV cell-to-cell and long-distance movement (Sempere et al. 2011). Increasing evidence supporting diversification of different potexviruses is primarily highlighted by the replication of PVX and BaMV, in the ER and chloroplasts of infected plants, respectively (Doronin and Hemenway

1996; Lin et al. 2007). Potexvirus movement has been proposed to depend on a number of different functions, one being TGBp1 RNA silencing suppressor activity (Bayne et al. 2005) and its localization (Lim et al. 2010a and b), the former apparently exhibiting remarkable variability between different potexviruses (Senshu et al. 2009). In addition to the welldocumented siRNA sequestration and AGO inactivation by suppressors active against S- and IR-PTGS, Plantago asiatica mosaic potexvirus TGBp1 (exclusively involved in S-PTGS) targets SGS3/RDR6-mediated dsRNA synthesis and, therefore, extends further the reported divergence of potexvirus TGBp1 range of action (Okano et al. 2014). PepMV-encoded TGBp1 was recently proposed to interact with tomato CAT1 to regulate plant homeostasis and oxidative stress–induced plant defense to maintain high levels of the virus during infection (Mathioudakis et al. 2013), and the data we present here show that TGBp1 also functions to counterattack RNA silencing. For PepMV, a variation in the sense of a “dual and complementary strategy” is shown to be implemented blocking local and systemic host antiviral RNA silencing. Both TGBp1 and CP are able to mediate local (intracellular) suppression of two different silencing mechanisms, the initiation of S- as well as IR-RNA silencing, with CP in both cases being the most effective, acting also intercellularly and systemically. To our knowledge, among all TGB-encoding plant viruses, only Potato virus M encodes an additional and distinct from TGBp1 suppressor of RNA silencing (a cysteinerich protein; Senshu et al. 2011). Overall, PepMV CP emerges as a truly multifunctional protein. Here, its specific complex formation with a PepMV replication-essential host chaperone suggests one or more additional roles in PepMV infection that may relate to its role as an RNA silencing suppressor. The recent report of chaperone-mediated assembly of the RISC (Iwasaki et al. 2010) should be borne in mind. The multiple PepMV CP interactions identified to date, not only suggest additional roles for this multifaceted protein but also support the existence of significant variation among members of the genus Potexvirus. MATERIALS AND METHODS Plant materials and growth conditions. Three lines of N. benthamiana plants were used for the experiments of this work, the WT, the 16c line that constitutively expresses the GFP transgene (Hamilton et al. 2002), and a 6.4 transgenic line in which GFP gene silencing has already been established (Tournier et. al. 2006). N. benthamiana seeds were sown on Murashige and Skoog medium to germinate for 10 days at 25°C and a 16-h light and 8-h dark cycle. N. benthamiana and tomato seedlings were grown under standard greenhouse conditions in growth chambers. Construction of full-length PepMV- and CP-tagged mutant plasmids. Mutant PepMV-Sp13_OST-CP was constructed using standard overlapping PCR and molecular cloning protocols based on the pT7PepXL6 construct (Sempere et al. 2011). For the construction of pBPepXL6-OST-CP, three overlapping DNA fragments (PCR1, PCR2, PCR3) were separately amplified. For PCR1, a DNA fragment containing the TGB genes, the first 36 nt of the CP, which included a modified AGG starting triplet codon of the PepMV CP gene, was amplified from pT7PepXL6agg (Sempere et al. 2011), using primers Pep-303 and CE921 (GGATGACTCCATGCGCTCATGGTGGCACTTGAAG TGGCAGCAAC), primer CE-921 also including a Kozac sequence (underlined), a new start codon (bold), and part of the OST sequence (italics). For PCR2, a DNA fragment containing

part of the OST, the CP, and the 3′ UTR was amplified from pBPepPDS2a (Sempere et al. 2011) with primers CE-43 and CE-920 (CAGTTCGAAAAATCCGGAATGCCTGACACtACtCC aGTgG), which included silent mutations (lower case) to avoid the instability of the duplicated CP subgenomic promoter. For PCR3, the complete sequence of OST and the flanking sequence were amplified with CE-918 (reverse complement of CE-921) and CE-919 (reverse complement of CE-920) primers. The PCR2 and PCR3 fragments were mixed and amplified in a fourth PCR step to produce a partial overlapped DNA fragment using primers CE-918 and CE-43. Finally, the PCR1 fragment was mixed and amplified with the PCR2-3 fragment, using the Pep-303 and CE-43 primers to produce the complete overlapping fragment containing the TGB genes, the OST-CP, and the 3′ UTR of PepMV. The resulting PCR fragment was either inserted into pT7PepXL6 using the XmnI-XhoI sites to produce pTPepXL6_OST-CP, followed by subcloning into the BamHIXmaI sites of pBPepXL6 to obtain pBPepXL6-OST-CP. For transient expression experiments, the recombinant OSTCP sequence was PCR-amplified using primers CE-1295 (GG GGACAAGTTTGTACAAAAAAGCAGGCTTCGCCACCAT GAGCGATGGAGTCATCC) and CE-1296 (GGGGACCAC TTTG TACAAGAAAGCTGGGTCTTAAAGTTCAGGGGG TGCGTCTATCGCG) and was cloned into the pGWB2 gateway binary vector (Nakagawa et al. 2007). A PCR fragment containing the att sites was recombined into the pDONR221 vector and, subsequently, the pDONR221-OST-CP vector was LR recombined into the pGWB2 destination vector resulting in the pGWB2-OST-CP DNA construct. In planta pull-down assays and mass spectrometry. Upper, noninoculated leaves from tomato and N. benthamiana plants agroinoculated with pBPepXL6-OST-CP, pBPepXL6, pGWB2-OST-CP/pBP19, or pBP19 recombinant constructs were collected and were crushed in liquid nitrogen before the addition of extraction buffer (25 mM Tris-HCl at pH 7.5, 10% glycerol, 1 mM EDTA, 150 mM NaCl, 10 mM dithiothreitol, 2% polyvinylpolypyrrolidone, 0.1% Tween-20 and Roche protease inhibitor cocktail). Following centrifugation at 14,000 rpm (Heraeus Biofuge Stratos) for 10 min, the supernatant was gently incubated with 15 μg of avidin per milliliter for 1 h at 4°C. Extracts were passed through a StrepTactin MacroPrep column according the manufacturer’s instructions, and the recombinant OST-CP fusion protein was eluted in six aliquots (E1 to E6) of 100 l in volume. Samples from E2, E3, and E4 were loaded in 10% SDS-PAGE gels to separate the recombinant from the interacting proteins, and silverstained bands were excised and were destained before downstream HPLC-MS/MS analysis. The separation and analysis of the tryptic digests of the samples were performed with a HPLC-MS system consisting of an Agilent 1100 Series HPLC (Agilent Technologies) equipped with a -well plate autosampler and a capillary pump connected to an Agilent Ion Trap XCT Plus Mass Spectrometer (Agilent Technologies) using an electrospray (ESI) interface. Data processing was performed using the Data-Analysis program for LC/MSD Trap Version 3.3 (Bruker Daltonik, GmbH) and Spectrum Mill MS Proteomics Workbench (Rev A.03.02.060B, Agilent Technologies). The MS/MS search against the appropriate NCBI database was performed with the following criteria: identity search mode; tryptic digestion with 2 maximum missed cleavages; carbamidomethylated cysteines; peptide charge +1, +2, +3; mono-isotopic masses; peptide precursor mass tolerance 2.5 Da; product ion mass tolerance 0.7 amu; ESI ion trap instrument; minimum matched peak intensity 50%; STY phosphorylation, oxidized methionine, and N-terminal glutamine conversion to pyroglutamic acid as variable modifications. Vol. 27, No. 12, 2014 / 1365

Silencing Hsp70 by VIGS and quercetin. To study the biological role of the PepMV CP and Hsp70 interaction in viral infection, the Hsp70 homologue genes were silenced using the previously described pTRV1 and pTRV2 vectors (Liu et al. 2002; provided by S. Dinesh-Kumar, University of California, Davis, U.S.A.). For this purpose, a 407bp fragment (93% amino acid identity with the tomato Hsc70.3) from the 5′ end of the N. benthamiana Hsp70 gene (GenBank GU575116) was PCR-amplified from total RNA extracts and with the primers listed in Supplementary Table 1. The DNA amplicon was cloned in the pTRV2 vector via BamHI-XhoI, to generate the plasmid pTRV2-Nb-Hsp). The pTRV2-PDS construct was used as a silencing control (provided by S. P. Dinesh-Kumar). All of the constructs were introduced into Agrobacterium sp. strain GV2260 cells and were infiltrated into young third and fourth leaves of N. benthamiana, as described previously (Hayward et al. 2011). The sampling and testing methodology performed in previous work about the biological role of the catalase-TGBp1 interaction (Mathioudakis et al. 2013) was also applied herein. Briefly, the systemic leaves six days after the TRV agroinfiltration were mechanically inoculated by PepMV and total RNAs and protein extracts were obtained from the inoculated and systemically PepMV-infected leaves 4 days after PepMV inoculation, for the estimation of the protein and mRNA levels of Hsp70, CP, and RdRp by Western blotting and semiquantitative PCR. In parallel with the Hsp70 VIGS-silencing, a second assay was applied with the use of quercetin, a Hsp70 protein inhibitor. N. benthamiana plants were first infiltrated with 1 mM quercetin in DMSO, and after 1 h, the plants were mechanically inoculated with PepMV inoculum, as previously described (Hafren et al. 2010; Wang et al. 2009). DMSO-infiltrated plants were inoculated with PepMV and they were the negative controls. The Hsp70 and virus accumulation levels were analyzed on local leaves by immunoblot analysis 4 days after quercetin application. PepMV virion and in vitro-transcribed RNA preparation for protoplast transfection. Preparation of PepMV purified virions was previously described (Mathioudakis et al. 2012). The infectious PepMV cDNA full-length clone pT7PepXL6 (Sempere et al. 2011) was linearized by KpnI and in vitro-transcribed in the presence of cap analogue, using the mMessage mMachine kit (Ambion) according to the manufacturer’s instructions. N. benthamiana mesophyll protoplasts isolation was carried out according to standard protocols, and approximately 106 protoplasts were PEG-mediated transfected using either 10 or 5 g of the in vitro-transcribed or virion RNA, respectively, as previously reported by Navas-Castillo and associates (1997). Protoplasts transfected with no viral RNA represented the mock control. The quercetin inhibitor dissolved in DMSO was added to the protoplasts at a concentration of 200 M 30 min prior to as well as after PEG transfection with PepMV RNAs, whereas protoplasts treated with the same concentration of DMSO were used as control. Protoplasts were incubated at 25°C under continuous light and were harvested 24 h posttransfection for RNA analysis. Screening for RNA-silencing suppressors and their functional studies. The full-length coding sequences of PepMV TGBp1, TGBp2, TGBp3, and CP open reading frames were PCR-amplified, using the pLMPepMV15 construct (Aguilar et al. 2002) as template and specific primers. PCR-amplified DNA products were first cloned into the pGEM-T Easy vector and 1366 / Molecular Plant-Microbe Interactions

were subsequently subcloned into the binary vector pGreen300 (35S-BI/GST), using the BamHI-XhoI sites. The four pGreen constructs pGR-TGBp1, pGR-TGBp2, pGR-TGBp3, and pGR-CP were transformed into A. tumefaciens AGL-1 cells by electroporation. The AGL-1 cells contained the plasmid combination pSoup, providing replication functions in trans for 35S-BI/GST (Hellens et al. 2000). The commonly used A. tumefaciens–mediated transient gene expression of the candidate suppressor and the reporter gene was used to study the PTGS phenomenon (Johansen and Carrington 2001; Llave et al. 2000; Voinnet et al. 2000). This assay involves the co-infiltration of N. benthamiana leaves with a mixture from individual agrobacterium cell suspension of the GFP reporter gene together with putative suppressor candidates and showing preservation of GFP expression, according to the suppressor activity of the candidate protein. Three individual experiment sets were carried out, each one in three replicates, as described previously (Kataya et al. 2009). Briefly, N. benthamiana WT and transgenic 16c leaves were co-agroinfiltrated with the pairwise combination of 35SmGFP4 construct (expressing the GFP) (Haseloff et al. 1997) and each of the pGR plasmids indicated above to study the SPTGS mechanism, whereas N. benthamiana WT leaves coagroinfiltrated with the pairwise combination of each PepMV protein together with 35S-mGFP4 and a hp-GFP construct (producing dsRNA-GFP molecules) (Koscianska et al. 2005) were used for the IR-PTGS study. The pBIN/35S-mGFP4 and pFGC5941/35S-hpGFP plasmids were provided by J. Haseloff (Cambridge University, U.K.) and K. Kalantidis (University of Crete, Greece), respectively. As positive control, the ToCV p22 (pGR-p22) suppressor (Cañizares et al. 2008) was used, whereas the empty pGreen300 vector served as negative control. Daily observations were undertaken for GFP fluorescence by long-wavelength UV light (Sylvania H44GS, 100 W), whereas images were taken with a PENTAX digital camera with an UV filter. To study the involvement of the candidate suppressors in cell-to-cell and long-distance spread of the RNA silencing signal, N. benthamiana 16c plants were co-agroinfiltrated with the 35S-mGFP4 plus either the pGR(–), pGR-p22 ToCV, pGRp19 of CymRSV, pGR-CP, or pGR-TGBp1. GFP expression was observed under the UV light for a period of 9 to 35 dpi. Some RNA silencing suppressors like TEV HcPro have the ability to reverse silencing phenomena and to restore GFP expression in already-silenced tissue of the tested transgene. In the present study, we individually agroinfiltrated sGFP-expressing transgenic N. benthamiana 6.4 plant leaves (Tournier et al. 2006) with pGR-HCPro (provided by J. J. Lopez-Moya, Consejo Superior de Investigaciones Científicas (CSIC), Barcelona, Spain), pGR-CP, pGR-p26, or the pGreen empty vector, and GFP expression was monitored for 7 days. BiFC assay. To study in planta homologous and heterologous interactions of PepMV CP and TGp1, binary vectors pSPYNE-35S and pSPYCE-35S, allowing the expression of proteins of interest as fusion to the N′- (NYFP) or C′-terminal half (CYFP) of YFP together with a c-myc (pSPYNE-35S) or HA (pSPYCE35S) affinity tag (Walter et al. 2004) were used. N. benthamiana WT fully expanded leaves were co-agroinfiltrated with the following pairwise combinations: pNYFP-TGBp1 and pCYFP-TGBp1, pNYFP-CP and pCYFP-CP, pNYFP-CP and pCYFP-TGBp1 constructs together with the TBSV p19 RNAsilencing suppressor, as described previously (Mathioudakis et al. 2012). To generate the pCYFP-CP and pCYFP-TGBp1 constructs, the full-length coding sequences of CP and TGBp1 genes were subcloned from pG-YFP-CP (A/S) and pG-YFP-

p26 (S/S) constructs (Mathioudakis et al. 2012; 2013), in frame into the binary vector pSPYCE-35S via AscI-SalI and SpeI-SalI sites, respectively. The bZIP63 transcription factor was used as positive control (Walter et al. 2004), whereas combinations of pSPYNE-35S (pNYFP) and pSPYCE-35S (pCYFP) plasmids with the viral-constructs were used as negative controls. Images were taken from the epidermal cell layers 3 to 4 dpi, as described previously (Mathioudakis et al. 2012). Protein and RNA analysis and semiquantitative RT-PCR. For PepMV mechanical inoculations, identical volumes of virus inoculum were used, whereas in control plants the plant sap of a healthy plant was used. Total proteins were extracted from 0.1 g from either PepMV-infected or agroifiltrated plant tissue, as described previously (Mathioudakis et al. 2012). Proteins from protoplasts were isolated using the Trizol reagent (Invitrogen), using the manufacturer’s instructions. Immunoblot analysis was used to study the GFP accumulation in the suppressor experiments and the Hsp70 and PepMV CP accumulation levels in VIGS assays, using anti-GFP (Abcam), antiHsp70 (Stressgen), and anti-PepMV CP (Neogen) antibodies. Other specific proteins were detected by Western blotting, using anti-HA rat polyclonal (Roche; pSPYCE-35S constructs) and anti-c-myc mouse monoclonal antibodies (Roche; pSPYNE-35S constructs), respectively. All the primary antibodies were conjugated to alkaline phosphatase, and the products were visualized using nitroblue tetrazolium–5-bromo-4chloro-3-indolyl phosphate substrates (Promega). Total RNA was extracted from leaf tissue or protoplasts, using the Trizol reagent according to the manufacturer’s instructions. Northern blot analysis using a digoxigenin-labeled PepMV CP probe was performed as described previously (Sempere et al. 2011). Chemiluminescent detection was carried out using the DIG-labeling kit (Roche). RNA extraction from PepMV virus particles was performed as previously described (AbouHaidar et al. 1998). RNA concentrations were estimated by a NanoDrop spectrophotometer. A semiquantitative RT-PCR was applied in VIGS experiments on the systemic leaves, using specific primer pairs amplifying a partial fragment of the Hsp70, CP, and RdRp genes, as previously described (Mathioudakis et al. 2012). The PCR DNA and protein bands were visualized using the Gel Doc XR imager system, and their intensities were quantified as absorbance units, using Quantity One analysis software (BioRad Laboratories). ACKNOWLEDGMENTS M. M. Mathioudakis is a recipient of an Onassis Foundation PhD scholarship. Work in M. A. Aranda’s lab was supported by grant AGL201237390 from Ministerio de Economía y Competitividad (Spain). We thank C. Owen for critically reading the manuscript and T. Canto (CSIC) for technical assistance with the BiFC assays.

LITERATURE CITED AbouHaidar, M. G., Xu, H. M., and Hefferon, K. L. 1998. Potexvirus isolation and RNA extraction. Plant Virol. Protoc. 81:131-143. Aguilar, J. M., Hernandez-Gallardo, M. D., Cenis, J. L., Lacasa, A., and Aranda, M. A. 2002. Complete sequence of the Pepino mosaic virus RNA genome. Arch. Virol. 147:2009-2015. Aparicio, F., Thomas, C. L., Lederer, C., Niu, Y., Wang, D. W., and Maule, A. J. 2005. Virus induction of heat shock protein 70 reflects a general response to protein accumulation in the plant cytosol. Plant Physiol. 138:529-536. Aranda, M. A., Escaler, M., Wang, D., and Maule, A. J. 1996. Induction of HSP70 and polyubiquitin expression associated with plant virus replication. Proc. Natl. Acad. Sci. U.S.A. 93:15289-15293. Bayne, E. H., Rakitina, D. V., Morozov, S. Y., and Baulcombe, D. C. 2005. Cell-to-cell movement of Potato potexvirus X is dependent on suppression of RNA silencing. Plant J. 44:471-482.

Bendahmane, A., Kohm, B. A., Dedi, C., and Baulcombe, D. C. 1995. The coat protein of Potato virus X is a strain-specific elicitor of Rx1-mediated virus resistance in potato. Plant J. 8:933-941. Candresse, T., Marais, A., Faure, C., Dubrana, M. P., Gombert, J., and Bendahmane, A. 2010. Multiple coat protein mutations abolish recognition of Pepino mosaic potexvirus (PepMV) by the potato Rx resistance gene in transgenic tomatoes. Mol. Plant-Microbe. Interact. 23:376-383. Canizàres, M. C., Navas-Castillo, J., and Moriones, E. 2008. Multiple suppressors of RNA silencing encoded by both genomic RNAs of the Crinivirus, Tomato chlorosis virus. Virology 379:168-174. Chapman, S., Hills, G., Watts, J., and Baulcombe, D. 1992. Mutational analysis of the coat protein gene of Potato virus X: Effects on virion morphology and viral pathogenicity. Virology 191:223-230. Chen, Z. R., Zhou, T., Wu, X. H., Hong, Y., Fan, Z. F., and Li, H. F. 2008. Influence of cytoplasmic heat shock protein 70 on viral infection of Nicotiana benthamiana. Mol. Plant Pathol. 9:809-817. Cho S. Y., Cho W. K., Sohn S. H., and Kim K.H. 2012. Interaction of the host protein NbDnaJ with Potato virus X minus-strand stem-loop 1 RNA and capsid protein affects viral replication and movement. Biochem. Biophys. Res. Commun. 417:451-456. Doronin, S. V., and Hemenway, C. 1996. Synthesis of Potato virus X RNAs by membrane-containing extracts. J Virol 70:4795-4799. Duff-Farrier, C., Boonham, N., and Foster, G. R. 2011. The generation of Pepino mosaic virus infectious clones; investigating the link between genotype and phenotype. Phytopathology 101:S46. Dufresne, P. J., Thivierge, K., Cotton, S., Beauchemin, C., Ide, C., Ubalijoro, E., Laliberté, J. F., and Fortin, M. G. 2008. Heat shock 70 protein interaction with Turnip mosaic virus RNA-dependent RNA polymerase within virus induced membrane vesicles. Virology 374:217-227. Dunoyer, P., Himber, C., and Voinnet, O. 2005. Dicer-Like 4 is required for RNA interference and produces the 21-nucleotide small interfering RNA component of the plant cell-to-cell silencing signal. Nat. Genet. 37:1356-1360. Forster, R. L. S., Beck, D. L., Guilford, P. J., Voot, D. M., van Dolleweerd, C. J., and Andersen, M. T. 1992. The coat protein of White clover mosaic potexvirus has a role in facilitating cell-to-cell transport in plants. Virology 191:480-484. Gómez, P., Sempere, R. N., Elena, S. F., and Aranda, M. A. 2009. Mixed infections of Pepino mosaic virus strains modulate the evolutionary dynamics of this emergent virus. J. Virol. 83:12378-12387. Hafrén, A., Hofius, D., Rönnholm, G., Sonnewald U., and Mäkinen K. 2010. HSP70 and its co-chaperone CPIP promote potyvirus infection in Nicotiana benthamiana by regulating viral coat protein functions. Plant Cell 22:523-535. Hamilton, A. J., Baulcombe, D. C. 1999. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286:950952. Hamilton, A., Voinnet, O., Chappell, L., and Baulcombe, D. 2002. Two classes of short interfering RNA in RNA silencing. EMBO (Eur. Mol. Biol. Organ.) J. 21:4671-4679. Hanssen, I. M., and Thomma, B. P. H. J. 2010. Pepino mosaic virus: A successful pathogen that rapidly evolved from emerging to endemic in tomato crops. Mol. Plant Pathol. 11:179-189. Hanssen I. M, and Lapidot, M., and Thomma, B. P. H. J. 2010. Emerging viral diseases of tomato crops. Mol. Plant Microbe Interact. 23:539548. Hanssen, I. M., Peter van Esse, H., Ballester, A. R., Hogewoning, S. W., Parra, N. O., Paeleman, A., Lievens, B., Bovy, A. G., and Thomma, B. P. H. J. 2011. Differential tomato transcriptomic response induced by Pepino mosaic virus isolates with differential aggressiveness. Plant Physiology 156:301-318. Haseloff, J., Siemering, K. R., Prasher, D. C., and Hodge, S. 1997. Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proc. Natl. Acad. Sci. U.S.A. 94:2122-2127. Hasiów-Jaroszewska, B., Borodynko, N., and Pospieszny, H. 2009. Infectious RNA transcripts derived from cloned cDNA of a Pepino mosaic virus isolate. Arch. Virol. 154:853-856. Hasiów-Jaroszewska, B., Paeleman, A., Ortega-Parra, N., Borodynko, N., Minicka, J., Czerwoniec, A., Thomma, B. P. H. J., and Hanssen, I. N. 2013. Ratio of mutated versus wild-type coat protein sequences in Pepino mosaic virus determines the nature and severity of yellowing symptoms on tomato plants. Mol. Plant Pathol. 14:923-933. Haupt, S., Cowan, G. H., Ziegler, A., Roberts, A. G., Oparka, K. J., Torrance, L. 2005. Two plant-viral movement proteins traffic in the endocytic recycling pathway. Plant Cell 17:164-181. Hayward, A., Padmanabhan, M., and Dinesh-Kumar, S. P. 2011. Virusinduced gene silencing in Nicotiana benthamiana and other plant species. Methods Mol. Biol. 678:55-63. Hellens, R. P., Edwards, E. A., Leyland, N. R., Bean, S., Mullineaux, P. M. Vol. 27, No. 12, 2014 / 1367

2000. pGreen: A versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Mol. Biol. 42 819-832. Himber, C., Dunoyer, P., Moissiard, G., Ritzenthaler, C., and Voinnet, O. 2003. Transitivity dependent and -independent cell-to-cell movement of RNA silencing. EMBO (Eur. Mol. Biol. Organ.) J. 22, 4523-4533. Hofius, D., Maier, A. T., Dietrich, C., Jungkunz, I., Bornke, F., Maiss, E., and Sonnewald, U. 2007. Capsid protein-mediated recruitment of host DnaJ like proteins is required for Potato virus Y infection in tobacco plants. J. Virol. 81:11870-11880. Hosokawa, N., Hirayoshi, K., Nakai, A., Hosokawa, Y., Marui, N., Yoshida, M., Sakai, T., Nishino, H., Aoike, A., and Kawai, K. 1990. Flavonoids inhibit the expression of heat shock proteins. Cell Struct. Funct. 15:393401. Huang, Y. W., Hu, C. C., Liou, M. R., Chang, B. Y., Tsai, C. H., Meng, M., Lin, N. S., and Hsu, Y. H. 2012. Hsp90 interacts specifically with viral RNA and diffentially regulates replication initiation of Bamboo mosaic virus and associated satellite RNA. PLoS Pathog. 8:e1002726. Ivanov K. I, and Mäkinen, K. 2012. Coat proteins, host factors and plant viral replication. Curr. Opin. Virol. 6:712-718. Iwasaki, S., Kobayashi, M., Yoda, M., Sakaguchi, Y., Katsuma, S., Suzuki, T., and Tomari, Y. 2010. Hsc70/Hsp90 chaperone machinery mediates ATP-dependent RISC loading of small RNA duplexes. Mol. Cell 39:292-299. Johansen, L. K., and Carrington, J. C. 2001. Silencing on the spot. Induction and suppression of RNA silencing in the Agrobacterium-mediated transient expression system. Plant Physiol. 126:930-938. Kataya, A. M. R., Mohamed N. S.,Kalantidis, K., and Livieratos, I. C. 2009. Cucurbit yellow stunting disorder virus p25 is a suppressor of post-transcriptional gene silencing. Virus Res., 145:48-53. Koscianska, E., Kalantidis, K., Wypijewski, K., Sadowski, J., and Tabler, M. 2005. Analysis of RNA silencing in agroinfiltrated leaves of Nicotiana benthamiana and Nicotiana tabacum. Plant Mol. Biol. 59:647-661. Lee, C. C., Ho, Y. N., Hu, R. H., Yen, Y. T., Wang, Z. C., Lee, Y. C., Hsu, Y. H., and Meng, M. 2011. The interaction between Bamboo mosaic virus replication protein and coat protein is critical for virus movement in plant hosts. J. Virol. 85:12022-12031. Levy, A., Dafny-Yelin, M., and Tzfira, T. 2008. Attacking the defenders: Plant viruses fight back. Trends Microbiol. 16:194-197. Leshchiner, A. D., Minina, E. A., Rakitina, D. V., Vishnichenko, V. K., Solovyev, A. G., Morozov, S. Y., and Kalinina, N. O. 2008. Oligomerization of the Potato virus X 25-kD movement protein. Biochemistry 73:50-55. Lim, H. S., Vaira, A. M., Reinsel, M. D., Bae, H., Bailey, B. A., Domier L. L., and Hammond, J. 2010a. Pathogenicity of Alternanthera mosaic virus is affected by determinants in RNA-dependent RNA polymerase and by reduced efficacy of silencing suppression in a movement-competent TGB1. J. Gen. Virol. 91:277-287. Lim, H. S., Vaira, A. M., Domier, L. L., Lee, S. C., Kim, H. G., and Hammond, J. 2010b. Efficiency of VIGS and gene expression in a novel bipartite potexvirus vector delivery system as a function of strength of TGB1 silencing suppression. Virology 402:149-163. Lin, J. W., Ding, M. P., Hsu, Y. H., and Tsai, C. H. 2007. Chloroplast phosphoglycerate kinase, a gluconeogenetic enzyme, is required for efficient accumulation of Bamboo mosaic virus. Nucleic Acids Res. 35:424-432. Lin, T. Y., Duck, N. B., Winter, J., and Folk, W. R. 1991. Sequences of two hsc 70 cDNAs from Lycopersicon esculentum. Plant Mol. Biol. 16:475478. Ling, K. S., Li, R., and Bledsoe, M. 2013. Pepino mosaic virus genotype shift in North America and development of a loop-mediated isothermal amplification for rapid genotype identification. Virology J. 10:117. Liu, Y., Schiff, M., Marathe, R., and Dinesh-Kumar, S. P. 2002. Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N-mediated resistance to Tobacco mosaic virus. Plant J. 30:415-429. Llave, C., Kasschau, K. D., and Carrington, J. C. 2000. Virus-encoded suppressor of posttranscriptional gene silencing targets a maintenance step in the silencing pathway. Proc. Natl. Acad. Sci. U.S.A. 97:1340113406. Lough, T. J., Netzler, N. E., Emerson, S. J., Sutherland, P., Carr, F., Beck, D. L., Lucas, W. J., and Forster, R. L. 2000. Cell-to-cell movement of Potexviruses: Evidence for a ribonucleoprotein complex involving the coat protein and first triple gene block protein. Mol. Plant-Microbe Interact. 13:962-974. Lough, T. J., Lee, R. H., Emerson, S. J., Forster, R. L., and Lucas, W. J. 2006. Functional analysis of the 5′ untranslated region of Potexvirus RNA reveals a role in viral replication and cell-to-cell movement. Virology 351:455-465. Lu, H. C., Chen, C. E., Tsai, M. H., Wang, H. I., Su, H. J., and Yeh, H. H. 2009. Cymbidium mosaic potexvirus isolate-dependent host movement systems reveal two movement control determinants and the coat protein is the dominant. Virology 388:147-159. 1368 / Molecular Plant-Microbe Interactions

Manwell, L. A., and Heikkila, J. J. 2007. Examination of KNK437- and quercetin-mediated inhibition of heat shock-induced heat shock protein gene expression in Xenopus laevis cultured cells. Comp. Biochem. Physiol. A 148521-148530. Mathioudakis, M. M, Veiga, R., Ghita, M., Tsikou, D., Medina, V., Canto, T., Makris, A. M., and Livieratos, I. C. 2012. Pepino mosaic virus capsid protein interacts with a tomato heat shock protein cognate 70 in yeast, in planta and in vivo. Virus Res. 163:28-39. Mathioudakis, M. M., Veiga, R., Canto, T., Medina, V., Mossialos, D., Makris, A. M., and Livieratos, I. 2013. Pepino mosaic virus triple gene block protein 1 (TGBp1) interacts with and increases tomato catalase 1 activity to enhance virus accumulation. Mol. Plant Pathol. 14:589-601. Mayer, M. P., and Bukau, B. 2005. Hsp70 chaperones: Cellular functions and molecular mechanism. Cell. Mol. Life Sci. 62:670-684. Nakagawa, T., Kurose, T., Hino, T., Tanaka, K., Kawamukai, M., Niwa, Y., Toyooka, K., Matsuoka, K., Jinbo, T., and Kimura, T. 2007. Development of series of Gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation. J. Biosc. Bioeng. 104:31-41. Nagy, P. D., and Pogany, J. 2012. The dependence of viral RNA replication on co-opted host factors. Nat. Rev. Microbiol. 10:137-149. Nagy, P. D., Wang, R. Y., Pogany, J., Hafrén, A., and Mäkinen, K. 2011. Emerging picture of host chaperone and cyclophilin roles in RNA virus replication. Virology 411:374-382. Navas-Castillo, J., Albiach-Martí, M. R., Gowda, S., Hilf, M. E., Garnsey, S. M., and Dawson, W. O. 1997. Kinetics of accumulation of Citrus tristeza virus RNAs. Virology 228:92-97. Nishikiori, M., Dohi, K., Mori, M., Meshi, T., Naito, S., and Ishikawa., M. 2006. Membrane-bound Tomato mosaic virus replication proteins participate in RNA synthesis and are associated with host proteins in a pattern distinct from those that are not membrane bound. J. Virol. 80:8459-8468. Okano, Y., Senshu, H., Hashimoto, M., Neriya, Y., Netsu, O., Minato, M., Yoshida, T., Maejima, K., Oshim, K., Komatsu, K., Yamaji, Y., and Namba, S. 2014. In planta recognition of a double-stranded RNA synthesis protein complex by a potexviral RNA silencing suppressor. Plant Cell, in press http://dx.doi.org/10.1105/tpc.113.120535. Osman, T., Olsthoorn, R. C. I., and Livieratos, I. C. 2012. In vitro templatedependent synthesis of Pepino mosaic virus positive- and negativestrand rna by its rna-dependent rna polymerase. Virus Res. 167:267272. Peremyslov, V. V., Hagiwara, Y., and Dolja V. V. 1999. HSP70 homolog functions in cell-to-cell movement of a plant virus. Proc. Natl. Acad. Sci. U.S.A. 96:14771-14776. Pumplin N., and Voinnet O. 2013. RNA silencing suppression by plant pathogens: Defence, counter-defence and counter-counter-defence. Nat. Rev. Microbiol. 11:745-760. Samuels, T. D., Ju, H. J., Ye, C. M., Motes, C. M., Blancaflor, E. B., and Verchot-Lubicz, J. 2007. Subcellular targeting and interactions among the Potato virus X TGB proteins. Virology 367:375-389. Satyanarayana, T., Gowda, S., Mawassi, M., Albiach-Marti, M. R., Ayllon, M. A., Robertson, C., Garnsey, S. M., and Dawson, W. O. 2000. Closterovirus encoded HSP70 homolog and p61 in addition to both coat proteins function in efficient virion assembly. Virology 278:253-265. Sempere, R. N., Gómez, P., Truniger, V., and Aranda, M. A. 2011. Development of expression vectors based on Pepino mosaic virus. Plant Methods 7:6. Senshu, H., Ozeki, J., Komatsu, K., Hashimoto, M., Hatada, K., Aoyama, M., Kagiwada, S., Yamaji, Y., and Namba, S. 2009. Variability in the level of RNA silencing suppression caused by triple gene block protein 1 (TGBp1) from various potexviruses during infection. J. Gen.Virol. 90:1014-1024. Senshu, H., Yamaji, Y., Minato, N., Shiraishi, T., Maejima, K., Hashimoto M., Miura, C., Neriya, Y., and Namba S. 2011. A dual strategy for the suppression of host antiviral silencing: Two distinct suppressors for viral replication and viral movement encoded by Potato virus M. J. Virol. 85:10269-10278. Silhavy, D., Molnar, A., Lucioli, A., Szittya, G., Hornyik, C., Tavazza, M., and Burgyan, J. 2002. A viral protein suppresses RNA silencing and binds silencing-generated, 21- to 25-nucleotide double-stranded RNAs. EMBO (Eur. Mol. Biol. Organ.) J. 21:3070-3080. Sun, S. W., Chung, M. C., and Lin, T. Y. 1996. The structure and expression of an hsc70 gene from Lycopersicon esculentum. Gene 170, 237241. Tomita, Y., Mizuno, T., Diez, J., Naito, S., Ahlquist, P., and Ishikawa, M. 2003. Mutation of host DnaJ homolog inhibits Brome mosaic virus negative-strand RNA synthesis. J. Virol. 77:2990-2997. Tournier, B., Tabler, M., and Kalantidis, K. 2006. Phloem flow strongly influences the systemic spread of silencing in GFP Nicotiana benthamiana plants. Plant J. 47:383-394.

Verchot, J. 2012. Cellular chaperones and folding enzymes are vital contributors to membrane bound replicaiton and movement complexes during RNA virus infection. Front. Plant Sci. 3:275. Verchot-Lubicz, J. 2005. A new model for cell-to-cell movement of potexviruses. Mol. Plant-Microbe Interact. 18:283-290. Verchot-Lubicz, J., Ye, C. M., and Bamunusinghe, D. 2007. Molecular biology of potexviruses: Recent advances. J. Gen. Virol. 88:1643-1655. Verchot-Lubicz, J., Torrance, L., Solovyev A. G., Morozov, S. Y., Jackson, A. O., and Gilmer, D. 2010. Varied movement strategies employed by triple gene block-encoding viruses. Mol. Plant-Microbe Interact. 23:1231-1247. Voinnet, O. 2002. RNA silencing: Small RNAs as ubiquitous regulators of gene expression. Curr. Opin. Plant Biol. 5:444-451. Voinnet, O. 2005. Induction and suppression of RNA silencing: Insights from viral infections. Nat. Rev. Gen. 6:206-220. Voinnet, O., Lederer, C., and Baulcombe, D. C. 2000. A viral movement protein prevents spread of the gene silencing signal in Nicotiana benthamiana. Cell 10:157-167.

Walter, M., Chaban, C., Schutze, K., Batistic, O., Weckermann, K., Nake, C., Blazevic, D., Grefen, C., Schumacher, K., Oecking, C., Harter, K., and Kudla, J. 2004. Visualization of protein interactions in living plant cells using bimolecular fluorescence complementation. Plant J. 40:428438. Wang, R. Y., Stork, J., and Nagy, P. D. 2009. A key role for heat shock protein 70 in the localization and insertion of Tombusvirus replication proteins to intracellular membranes. J. Virol. 83:3276-3287. Whitham, S. A., Quan, S., Chang, H. S., Cooper, B., Estes, B., Zhu, T., Wang, X., and Hou, Y. M. 2003. Diverse RNA viruses elicit the expression of common sets of genes in susceptible Arabidopsis thaliana plants. Plant J. 33:271-283. Whitham, S. A., Yang, C., and Goodin, M. M. 2006. Global impact: Elucidating plant responses to viral infection. Mol. Plant-Microbe Interact. 19:1207-1215. Wu, C. H., Lee, S. C., and Wang, C. W. 2011. Viral protein targeting to the cortical endoplasmic reticulum is required for cell-cell spreading in plants. J. Cell Biol. 193:521-535.

Vol. 27, No. 12, 2014 / 1369