RESEARCH ARTICLE
Multilocus sequence typing (MLST) and M13 PCR fingerprinting revealed heterogeneity amongst Cryptococcus species obtained from Italian veterinary isolates Patrizia Danesi1,2, Carolina Firacative3,4, Massimo Cogliati5, Domenico Otranto2, Gioia Capelli1 & Wieland Meyer3 1
Istituto Zooprofilattico Sperimentale delle Venezie, Legnaro, Italy; 2Department of Veterinary Medicine, University of Bari, Bari, Italy; 3Molecular Mycology Research Laboratory, Centre for Infectious Diseases and Microbiology, Sydney Medical School - Westmead Hospital, Marie Bashir Institute for Infectious Diseases and Biosecurity, The University of Sydney, Westmead Millennium Institute, Sydney, NSW, Australia; 4Grupo de Microbiologıa,Instituto Nacional de Salud, Bogota, Colombia; and 5Laboratorio di Micologia Medica, Istituto di Igiene e Medicina Preventiva, University of Milan, Milan, Italy
Correspondence: Patrizia Danesi, Viale dell’Industria 10, Padova 35020, Legnaro, Italy. Tel.: +39 049 8084166/374; fax: +39 049 8830277; e-mail:
[email protected] Received 10 April 2014; revised 16 June 2014; accepted 26 June 2014. Final version published online 21 July 2014. DOI: 10.1111/1567-1364.12178 Editor: Richard Calderone
YEAST RESEARCH
Keywords multilocus sequence type; Cryptococcus isolates; animal sources; M13 PCR fingerprinting; heterogeneity.
Abstract Cryptococcosis represents a fungal disease acquired from the environment with animals serving as host sentinels for human exposure. The aim of this study was to investigate the genetic characteristics of Cryptococcus isolates from veterinary sources (cats, dogs and birds) to understand their epidemiology and the genetic variability of the casual isolates. Mating-type PCR in connection with MLST analysis using the ISHAM consensus MLST scheme for the C. neoformans/C. gattii species complex was used to genotype 17 C. neoformans isolates. In the absence of an MLST typing scheme Cryptococcus adeliensis, C. albidus, C. aureus, C. carnescens, C. laurentii, C. magnus and C. uniguttulatus strains were typed using M13 PCR fingerprinting. All C. neoformans isolates were MATa mating type, but hybrids possessed aADa and aADa mating and serotypes. Two C. neoformans molecular types VNI, VNIV and VNIII and VNII/ VNIV hybrids were identified. Amongst the 66 non-C. neoformans strains investigated 55 M13 PCR fingerprinting types were identified. The wide variety of MLST types of C. neoformans and the occurrence of aADa and aADa hybrids in our study supports the notion of genetic recombination in the area studied. The heterogeneity of the non-C. neoformans isolates remains open to further investigations and should be taken into consideration when identifying emergent pathogens.
Introduction Cryptococcosis is a life-threatening systemic mycosis affecting a wide range of animals and humans (Lazera et al., 2002; Kwon-Chung et al., 2002; Stephen et al., 2002; Grover et al., 2007; Nielsen et al., 2007; Sykes & Malik, 2012). Cryptococcus species are widely distributed in nature and can be isolated from various environmental sources such as air, soil, bird excreta, water, animals and decomposing wood (Wuczkowski et al., 2005; Pedroso et al., 2009a; Leite et al., 2012). The infection is usually acquired from the environment via the inhalation of basidiospores. Animals show rarely FEMS Yeast Res 14 (2014) 897–909
clinical disease, with Cryptococcus carriage in different animal sites (like nasal cavities in cats and cloaca in birds) is usually asymptomatic (Malik et al., 1997; Duncan et al., 2005; Cafarchia et al., 2006a). Thus, they might be environmental samplers (like cats living in a limited home range) and might also be environmental dispersers (like migratory birds) of fungal spores. Amongst the Cryptococcus species, only a few are considered medically important, which is likely due to the presence of specific characteristics that confer virulence (Petter et al., 2001). Thus, Cryptococcus neoformans and C. gattii are the species mainly responsible for disease in humans and animals (Casadevall & Perfect, 1998), and other species ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
898
(such as C. albidus, C. carnescens, C. laurentii, C. luteolus, C. magnus, C. uniguttulatus, etc.) have been traditionally considered saprophytes. However, in recent years, an increased incidence (almost 50 cases) of human and animal infections caused by non-C. neoformans/C. gattii species has been reported (Da Cunha & Lusins, 1973; Melo et al., 1980; Lindsberg et al., 1997; Johnson et al., 1998; Kordossis et al., 1998; Farina et al., 1999; McCurdy & Morrow, 2001; Averbuch et al., 2002; Kano et al., 2004, 2008; Rimek et al., 2004; Khawcharoenporn et al., 2006; Manfredi et al., 2006; Campos et al., 2009; Poth et al., 2010), suggesting that they might represent potential pathogens, especially in immunocompromised hosts. The pathogenic species C. neoformans has been divided into four major molecular types (VNI, VNII, VNIII, VNIV) on the basis of different molecular typing techniques (Viviani et al., 1997; Cogliati et al., 2000; Boekhout et al., 2001; Velegraki et al., 2001; Meyer et al., 2003), with VNI and VNII corresponding to C. neoformans var. grubii (serotype A), VNIV corresponding to C. neoformans var. neoformans (serotype D) and VNIII to the intervarietal AD hybrids. Previous studies have shown that Cryptococcus species/genotypes are characterized by different levels of pathogenicity and that their geographical distribution may affect prevalence, infection and clinical manifestations in human patients (Bovers et al., 2008). Cryptococcus neoformans var. grubii (VNI) is found worldwide and is responsible for more than 80% of cryptococcal diseases (Litvintseva et al., 2006). In contrast to C. neoformans var. neoformans (serotype D) isolates are more common in Europe and South America (Barreto de Oliveira et al., 2004; Igreja et al., 2004; Guinea et al., 2010). A higher prevalence of C. neoformans var. neoformans (VNIV) and serotype AD hybrids (VNIII) has been reported from the Mediterranean area (Italy, Spain, Portugal and Greece) than from north-western Europe (Viviani et al., 2006; Guinea et al., 2010). Previous studies, which highlighted the occurrence of C. neoformans and C. gattii in human infections in Italy (Guinea et al., 2010; Iatta et al., 2012) reported that C. neoformans. var. grubii (VNI) seemed more prevalent in the south of Italy than C. neoformans var. neoformans (VNIV), which was more common in the north (FIMUA Cryptococcosis network, 2002; Guinea et al., 2010). Differently, C. gattii is exclusively present in the south. On the basis of environmental and animal investigations, C. neoformans, C. gattii and other Cryptococcus species (i.e. C. albidus, C. laurentii, C. terreus) have been isolated (Saponetto et al., 1991; Mancianti et al., 1992; Faggi et al., 1993; Mandrioli et al., 2002; Campisi et al., 2003; Cafarchia et al., 2006b; Romeo et al., 2012). However, only C. neoformans and C. gattii were described in depth, ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
P. Danesi et al.
including the determination of serotype, genotype and mating type (Romeo et al., 2012; Cogliati 2013). Based on the lack of detailed studies of non-C. neoformans/C. gattii isolates, the aim of this study was to investigate the genetic characteristics of Cryptococcus isolates from veterinary source to understand their epidemiology and genetic variability. The ISHAM consensus MLST scheme for the C. neoformans/C. gattii species complex (Meyer et al., 2009) was applied to genotype 17 C. neoformans isolates. Due to the lack of a specific MLST scheme for the other Cryptococcus species M13 PCR fingerprinting analysis was performed to obtain molecular profiles of those species, including: C. adeliensis, C. albidus, C. aureus, C. carnescens, C. laurentii, C. magnus, and C. uniguttulatus.
Materials and methods Isolates
Cryptococcus isolates included in this study were collected from the nasal cavity of asymptomatic cats as previously described (Danesi et al., 2014), from cloaca or oropharynx of birds during West Nile virus surveillance (2010– 2012 – north of Italy). Three C. neoformans isolated from lymph node cryptococcosis in cats (2) and a dog (1) were obtained during diagnostic activity at the Laboratory of Parasitolgy, Istituto Zooprofilattico Sperimentale delle Venezie (IZSVE), Legnaro, Padua, Italy. Cryptococcus neoformans (n = 17), C. adeliensis (n = 2), C. albidus (n = 12), C. aureus (n = 2), C. carnescens (n = 12), C. laurentii (n = 4), C. magnus (n = 20) and C. uniguttulatus (n = 14) were identified to the species level by sequence analysis of the internal transcribe spacer (ITS) region of the rDNA gene cluster, as previously reported (Danesi et al., 2014). All isolates are maintained in glycerol at 80 °C in the culture collections of the Laboratory of Parasitolgy, IZSVE, Legnaro, Padua, Italy and the Molecular Mycology Research Laboratory at the University of Sydney at Westmead Hospital, Sydney, Australia. Strain information and GenBank accession numbers are reported in Table 1. MLST analyses and M13 PCR fingerprinting were performed at the Molecular Mycology Research Laboratory, University of Sydney at Westmead Hospital, Westmead, Australia. Reference strains
The following set of laboratory standard reference strains representing each of the eight major molecular types of the C. neoformans/C. gattii species complex were used: WM 148 (serotype A, VNI/AFLP1), WM 626 (serotype A, VNII/AFLP1A), WM 628 (serotype AD, VNIII/AFLP2), FEMS Yeast Res 14 (2014) 897–909
899
Genetic heterogeneity of Cryptococcus isolates in animals
Table 1. Strains used in this study: including IZSVe collection and Westmead Hospital collection numbers, animal host and source of isolation, ITS GenBank accession numbers IZSVe No.
WM No.
Cryptococcus neoformans PD 2234 WM 12.172 PD 249 WM 12.173 PD 1579 WM 12.174 PD 32 WM 12.185 PD 67 WM 12.184 PD 2696 WM 12.176 PD 635 WM 12.186 PD 2694 WM 12.179 PD 79 WM 13.132 PD 181 WM 12.181 PD 1556 WM 12.182 PD 1596 WM 12.194 PD 2270 WM 12.183 PD 135 WM 12.177 PD 1516 WM 12.175 PD 161 WM 12.178 PD 2851 WM 12.180 Non-neoformans Cryptococcus species Cryptococcus adeliensis PD 90 WM 13.141 PD 1600 WM 13.142 Cryptococcus aureus PD 399 WM 13.137 PD 1559 WM 13.140 Cryptococcus albidus PD 2698 WM 13.122 PD 2679 WM 13.123 PD 514 WM 13.124 PD 574 WM 13.125 PD 208 WM 13.126 PD 1629 WM 13.127 PD 1630 WM 13.128 PD 1548 WM 13.129 PD 1542 WM 13.130 PD 781 WM 13.133 PD 1766 WM 13.134 PD 1538 WM 13.135 Cryptococcus carnescens 2_75 (PD 1597) – PD 599 WM 13.105 PD 500 WM 13.106 PD 420 WM 13.108 PD 1840 WM 13.109 PD 571 WM 13.110 PD 2700 WM 13.111 PD 84 WM 13.112 PD 1591 WM 13.113 PD 572 WM 13.114 PD 507 WM 13.115 PD 1151 WM 13.117 Cryptococcus laurentii PD 425 WM 13.143 PD 75 WM 13.144
FEMS Yeast Res 14 (2014) 897–909
Host
Scientific name
Source
Accession No.
Cat Cat Cat Cat Cat Cat Cat Cat Cat Cat Cat Cat Cat Falcon Dog Dog Cat
Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Falco peregrinus Canis lupus familiaris Canis lupus familiaris Felis silvestris catus
Nasal swab Nasal swab Nasal swab Nasal swab Nasal swab Nasal swab Nasal swab Nasal swab Nasal swab Nasal swab Nasal swab Nasal swab Nasal swab Cloaca Lymph nodes Lymph nodes Lymph nodes
KF958213 KF958214 KF958215 KF958227 KF958226 KF958218 KF958228 KF958220 KJ459921 KF958222 KF958223 KF958224 KF958225 KF958217 KF958216 KF958219 KF958221
Cormorant Cat
Phalacrocorax carbo Felis silvestris catus
Cloaca Nasal cavity
KF958204 KF958205
Gadwall Wild Duck
Anas strepera Anas platyrhynchos
Oropharynx Oropharynx
KJ439602 KF958208
Cat Cat Shoveler Wigeon Pigeon Cat Cat Cat Cat Cat Cat Cat
Felis silvestris catus Felis silvestris catus Anas clypeata Anas penelope Columba livia Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus
Nasal cavity Nasal cavity Cloaca Cloaca Cloaca Nasal cavity Nasal swab Nasal cavity Nasal cavity Nasal cavity Nasal cavity Nasal cavity
KF958193 KF958194 KF958195 KJ439601 KJ439600 KF958197 KF958198 KF958199 KF958200 KF958202 KF958196 KF958203
Cat Wild Duck Wigeon Wigeon Cat Teal Cat Cat Cat Teal Wigeon Cat
Felis silvestris catus Anas platyrhynchos Anas penelope Anas penelope Felis silvestris catus Anas crecca Felis silvestris catus Felis silvestris catus Felis silvestris catus Anas crecca Anas penelope Felis silvestris catus
Nasal cavity Oropharynx Cloaca Cloaca Nasal cavity Cloaca Nasal cavity Nasal cavity Nasal cavity Cloaca Cloaca Nasal cavity
KF958229 KF958230 KJ439603 KJ439604 KF958232 KJ439605 KF958233 KF958234 KF958235 KJ439606 KJ439607 KF958237
Wild Duck Shoveler
Anas platyrhynchos Anas clypeata
Cloaca Oropharynx
KJ439608 KJ439609
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
900
P. Danesi et al.
Table 1. Continued IZSVe No. PD 358 PD 269 Cryptococcus magnus PD 1550 PD 1768 PD 1625 PD 1537 PD 1163 PD 2235 PD 1419 PD 2273 PD 1544 PD 2678 PD 2467 PD 1592 PD 1616 PD 726 PD 2570 PD 46 PD 2647 2_78 (PD 86) 2_108 (PD 45) PD 1545 PD 2061 Cryptococcus uniguttulatus PD 909 PD 981 PD 979 PD 1261 PD 209 PD 2676 PD 1237 PD 411 PD 982 PD 1244 PD 1210 PD 1176 PD 1144 PD 364
WM No.
Host
Scientific name
Source
Accession No.
WM 13.145 WM 13.146
Teal Wild Duck
Anas crecca Anas platyrhynchos
Oropharynx Oropharynx
KJ439611 KJ439610
WM WM WM WM WM WM WM WM WM WM WM WM WM WM WM WM WM – – WM WM
13.86 13.87 13.88 13.89 13.91 13.92 13.93 13.94 13.95 13.96 13.97 13.98 13.99 13.100 13.101 13.102 13.103
13.104 13.149
Cat Cat Cat Cat Pigeon Cat Pigeon Cat Cat Cat Cat Cat Cat Cat Cat Cat Cat Cormorant Cat Cat Cat
Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Columba livia Felis silvestris catus Columba livia Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Felis silvestris catus Phalacrocorax carbo Felis silvestris catus Felis silvestris catus Felis silvestris catus
Nasal cavity Nasal cavity Nasal cavity Nasal cavity Oropharynx Nasal cavity Oropharynx Nasal cavity Nasal cavity Nasal cavity Nasal cavity Nasal cavity Nasal cavity Nasal cavity Nasal cavity Nasal cavity Nasal cavity Oropharynx Nasal cavity Nasal cavity Nasal cavity
KF941325 KF941326 KF941327 KF941328 KF941337 KF941329 KF941330 KF941331 KF941332 KF941333 KF941334 KF941335 KF941336 KF941340 KF941339 KF941343 KF941341 KF941338 KF941344 KF941342 KF958209
WM WM WM WM WM WM WM WM WM WM WM WM WM WM
13.152 13.153 13.154 13.155 13.156 13.158 13.159 13.160 13.161 13.162 13.163 13.164 13.165 13.166
Parrot Eagle-Owl Eagle-Owl Magpie Pigeon Cat Magpie Dog Eagle-Owl Magpie Falcon Pigeon Pigeon Pigeon
Nonidentified Bubo bubo Bubo bubo Pica pica Columba livia Felis silvestris catus Pica pica Canis lupus familiaris Bubo bubo Pica pica Falco peregrinus Columba livia Columba livia Columba livia
Cloaca Cloaca Cloaca Oropharynx Cloaca Nasal cavity Oropharynx Auricular canal Oropharynx Oropharynx Oropharynx Oropharynx Oropharynx Cloaca
KF958239 KF958240 KF958241 KF958248 KJ439612 KF958242 KF958243 KJ439613 KF958244 KF958249 KF958245 KF958246 KF958247 KJ439614
WM629 (serotype D, VNIV/AFLP3), WM 179 (serotype B, VGI/AFLP4), WM 178 (serotype B, VGII/AFLP6), WM 175 (serotype B, VGIII/AFLP5) WM 779 (serotype C, VGIV/AFLP7) (Meyer et al., 2009). DNA extraction
Isolates were cultured on Sabouraux dextrose agar and maintained at 37 °C for 48–72 h. Genomic DNA was isolated as described previously (Meyer et al., 2003). A loop full of yeasts was transferred in a tube and frozen at 20 °C for 1 h. A volume of 500 lL of lysis buffer (0.5 g sodium dodecyl sulphate, 1.4 g NaCl, 0.73 g EDTA, 20 mL ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
1 M Tris-HCl per 100 mL lysis) and 5 lL of 2-mercaptoethanol were added to each tube, vortexed and then incubated at 65 °C for 1 h. The lysate was extracted with 500 lL phenol–chloroform–isoamyl alcohol (25 : 24 : 1, v:v:v) and mixed for 2 min. The tubes were centrifuged for 15 min at 21 000 g. The aqueous phase was transferred to a new tube, and DNA was precipitated by adding 500 lL of isopropanol overnight at 20 °C. The solution was centrifuged for 15 min at 21 000 g at 4 °C to pellet the DNA. The DNA pellet was washed with 70% ethanol, centrifuged for 15 min at 21 000 g and air-dried. The DNA was resuspended in 200 lL sterile deionized water at 4 °C overnight and stored at 20 °C. FEMS Yeast Res 14 (2014) 897–909
901
Genetic heterogeneity of Cryptococcus isolates in animals
Ura5-rflp
The major molecular types of C. neoformans were determined by URA5-RFLP analysis as previously described (Meyer et al., 2003) using the following primers URA5 (50 ATGTCCTCCCAAGCCCTCGACTCCG30 ) and SJ01 (50 TTAAGACC TCTGAACACCGTACTC30 ). The amplification products obtained were than digested with the restriction enzymes HhaI and Sau96I at 37 °C for 3 h or over night. The digested PCR products were visualized and compared with the reference strains on 3% agarose gels, stained with ethidium bromide. Isolates with mixed patterns were considered to be potential hybrids. Mating type
Amongst C. neoformans isolates, the mating types (MATa or MATa) were determined as previously described (Halliday et al., 1999). In addition, the mating-type allele pattern was determined in nine C. neoformans isolates (Table 2) by a multiplex PCR using four pairs of primers: NCP1 (aD allele), NAD4 (aA allele), STE20D (aD allele), STE20A (aA allele) and amplified as previously described (Esposto et al., 2004). MLST
MLST analysis was performed on 14 C. neoformans isolates. Hybrids were excluded from further MLST analysis, as amplified fragments of hybrid isolates will result in a
mixture of sequences consisting of different alleles. Using the ISHAM consensus MLST scheme for the C. neoformans/C. gattii species complex, the following seven unlinked genetic loci: CAP59, GPD1, LAC1, PLB1, SOD1, URA5 and the IGS1 region were amplified using the primers and amplification parameters described by the ISHAM Working Group for genotyping of C. neoformans and C. gattii (Meyer et al., 2009) and analysed as reported previously (Carriconde et al., 2011). Allele types (ATs) were assigned to each of the seven loci, resulting in a seven-digit allelic profile for each isolate. The allelic profiles were then defined as sequence types (STs) according to the ISHAM MLST database for C. neoformans (http://mlst.mycologylab.org). All novel ATs and STs have been added to the database. To put the newly identified STs into context with the typing results of previous Italian studies (Cogliati 2013), STs of additional strains of the C. neoformans species complex were downloaded from the mlst.mycologylab.org webpage and a map with the sequence type distribution was created (Fig. 2). Phylogenetic analyses were performed using Neighbour Joining analysis with 1000 bootstrap replicates implemented in MEGA version 5.10 (Tamura et al., 2011). PCR fingerprinting of non-C. neoformans isolates
PCR fingerprinting was carried out as described previously (Meyer et al., 1999) using the microsatellite-specific
Table 2. Molecular type, mating type, allele type and sequence type of C. neoformans isolates Strain No
WM No
City
Host
PD PD PD PD PD PD PD PD PD PD PD PD PD PD PD PD PD
WM WM WM WM WM WM WM WM WM WM WM WM WM WM WM WM WM
Verona Bari Verona Verona Vicenza Verona Verona Verona Verona Torino Verona Verona Verona Verona Verona Verona Pordenone
Cat Falcon Cat Cat Dog‡ Cat Cat Cat Cat Dog‡ Cat Cat Cat Cat Cat Cat Cat‡
67 135 249 635 1516 1556 2234 32 79 161 1596 2270 2694 2696 181 1579 2851
12.184 12.177 12.173 12.186 12.175 12.182 12.172 12.185 13.132 12.178 12.194 12.183 12.179 12.176 12.181 12.174 12.180
Sample
Molecular type
Mating type
Nasal swab Cloaca Nasal swab Nasal swab Lymph node Nasal swab Nasal swab Nasal swab Nasal swab Lymph node Nasal swab Nasal swab Nasal swab Nasal swab Nasal swab Nasal swab Lymph node
VNI VNI VNI VNI VNI VNI VNI VNIV VNIV VNIV VNIV VNIV VNIV VNIV VNIII VNII/VNIV VNIII
aA* a aA* aA* a a aA* aD* a a aD* aD* a a aADa* aADa* a
MLST CAP59
GPD1
IGS1
LAC1
PLB1
SOD1
URA5
ST
1 1 7 1 7 1 1 16 16 16 22 27 26 16 Hybrid Hybrid Hybrid
1 1 1 1 1 1 3 21 21 22 22 22 22 21
1 1 1 1 1 1 1 24 24 31 30 43 43 30
18 18 2 18 18 1 5 20 20 24 19 24 24 19
1 3 1 1 1 1 2 13 13 14 14 13 13 13
1 1 38† 1 1 1 1 22 22 17 23 17 17 17
2 1 2 2 1 2 1 32 32 16 41† 20 20 19
58 264† 250† 58 63 37 5 294† 294† 112 252† 135 251† 160
*Determined by multiplex PCR (Esposto et al., 2004). New allele or ST. ‡ Symptomatic animals. †
FEMS Yeast Res 14 (2014) 897–909
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
902
primer M13 (50 GAGGGTGGCGGTTCT 30 ) on all non-C. neoformans Cryptococcus species: C. adeliensis (n = 2), C. albidus (n = 12), C. aureus (n = 2), C. carnescens (n = 12), C. laurentii (n = 4), C. magnus (n = 21) and C. uniguttulatus (n = 14). The PCR fingerprinting amplicons were visualized on 1.4% agarose gels under UV light after running at 70 V to 14 cm. After a complete run, a picture was taken and the bands were analysed using the 1D gel analysis module (BioGalaxy) implemented in the BIOLOMICS software ver. 7.5.88 (BioAware, Hannut, Belgium) using the UPGMA algorithm. Strains with 100% similarity were grouped in the same M13 PCR fingerprinting type.
Results Crytococcus neoformans major molecular types and mating types
The 17 C. neoformans isolates were obtained from asymptomatic (n = 13) and symptomatic (n = 1) cats, a falcon (n = 1) and dogs (n = 2). Amongst them canine (n = 2) and feline (n = 1) clinical cases were described (Table 1). All 17 C. neoformans isolates were typed, and the molecular type determined as VNI (n = 7, 41%) and VNIV (n = 7, 41%), as well as two different types of hybrids, VNIII hybrids (n = 2, 14%) and VNII/VNIV (n = 1, 7%), where identified (Table 1). The molecular type VNI was identified from cats (n = 5), falcon (n = 1) and dog (n = 1), while VNIV from cats (n = 6) and dog (n = 1). Hybrids VNIII (n = 1) and VNII/VNIV (n = 1) were found in asymptomatic cats, the other VNIII was from the cutaneous lesion of a feline clinical case. Mating- and serotype-specific PCR revealed that the majority of the isolates were MATa (n = 15; 88%) and serotype A or D (i.e. were aA or aD). The remaining two hybrids VNIII possessed aADa (n = 1) and aADa (n = 1) mating and serotypes (Table 1).
P. Danesi et al.
of the STs obtained from Italian veterinary isolates is shown in Figs 1 and 2. ST5 had previously been reported from Korea, Japan, Uganda, China, Thailand, Africa, ST58 from North America, and ST63 form Africa and Australia. Sequence types ST58 and ST294 were both identified in two samples (n = 2, 14.3%), while the other sequence types were represented from one isolate each (7.1%). M13 PCR fingerprinting of non-C. neoformans isolates
The obtained M13 PCR fingerprinting patterns were assigned with a M13 PCR fingerprinting type, identified as Cadel (C. adeliensis), Cal (C. albidus), Caur (C. aureus), Ccarn (C. carnescens), Claur (C. laurentii), Cmagn (C. magnus) and Cunig (C. uniguttulatus) according to the Cryptococcus species (Table 3). Fifty-nine M13 PCR fingerprinting types were identified amongst all 66 studied isolates. Dendrograms revealed different intraspecies M13 PCR fingerprinting patterns for C. adeliensis (n = 2), C. albidus (n = 10), C. aureus (n = 2), C. carnescens (n = 11), C. laurentii (n = 2), C. magnus (n = 20) and C. uniguttulatus (n = 12) (Figs 3–7). The heterogeneity was defined as the numbers of M13 PCR fingerprinting types in relation to the total number of isolates in the same group of species (%) and is summarized in Table 3.
MLST results of C. neoformans isolates
MLST analysis identified six CAP59 ATs, four GPD1 ATs, four IGS1 ATs, seven LAC1 ATs, seven PLB1 ATs, five SOD1 ATs and seven URA5 ATs. Two new allele types, one for SOD1 (AT 38) and one for URA5 (AT 48), were described (Table 2). A total of 12 STs from 14 isolates were identified (Table 2), five of which were novel ST250, ST251 amongst C. neoformans var. grubii (VNI) and ST252, ST264 and ST294 amongst C. neoformans var. neoformans (VNIV). None of the identified STs were previously reported from Italy. The phylogeny and the distribution ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
Fig. 1. Phylogram of the veterinary Cryptococcus neoformans isolates. Maximum likelihood tree showing the genetic relationship between the human and veterinary C. neoformans isolates based on neighbour joining analysis of the concatenated seven ISHAM consensus MLST loci, using the program MEGA version 5.10. Bootstrap values are shown at the branches.
FEMS Yeast Res 14 (2014) 897–909
Genetic heterogeneity of Cryptococcus isolates in animals
903
Fig. 2. Distribution of Cryptococcus neoformans sequence types (ST) in Italy. Underlined ST numbers and hybrid represent the ones identified in the present study.
The results suggest that non-C. neoformans Cryptococcus strains are highly genetically diversified.
Discussion The results of this study represent an interesting data set of C. neoformans and non-C. neoformans Cryptococcus isolates from veterinary sources and contribute to an improved understanding of the molecular epidemiology and genetic characterization of these animal and human opportunistic pathogens. They show the presence of the molecular types VNI, VNIV and VNIII in veterinary isolates from northern Italy and highlight a similar prevalence amongst the molecular types VNI and VNIV in the investigated area, in contrast to previous findings on human cryptococcosis by other Italian investigations, which reported an unbalanced molecular type distribution, with a higher prevalence of VNI in the south and FEMS Yeast Res 14 (2014) 897–909
VNIV in the north of the Italian peninsula (Guinea et al., 2010; Cogliati et al., 2012; Romeo et al., 2012). All isolates were mating-type a but interestingly, the analysis revealed the presence of MATa associated to serotype A and serotype D alleles in two hybrids. The involvement of AD hybrid strains (associated to MATa/ MATa) in human cryptococcosis infections in Italy is well documented (Guinea et al., 2010). However, these new findings provided evidence that C. neoformans hybrids can be carried and spread by asymptomatic animals in the environment. Monitoring hybridization in C. neoformans is important, as it has been suggested that hybridization may represent an evolutionary driving force for increased fitness of this yeast (Cogliati et al., 2012). Sequence type results showed that the Italian C. neoformans population conserves a high variability as 12 STs were identified amongst 14 isolates studied. Concerning C. neoformans var. grubii, our results are in agreement ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
904
P. Danesi et al.
Table 3. M13 PCR fingerprinting Cryptococcus isolates Cryptococcus species (No)
types
of
non-C. neoformans
Cryptococcus species (No) WM number
C. adeliensis (2)
C. albidus (12) C. albidus var. C. albidus var. C. albidus var. C. albidus var. C. albidus var.
C. albidus C. albidus var. C. albidus var. C. albidus var. C. albidus var. C. aureus (2)
ovalis ovalis ovalis ovalis kuetzingii
albidus albidus ovalis ovalis
PD 90 PD 1600
WM 13.141 WM 13.142
PD PD PD PD PD PD PD PD PD PD PD PD
WM WM WM WM WM WM WM WM WM WM WM WM
1630 1548 1538 1542 2698 574 781 208 2679 1766 1629 514
Table 3. Continued
13.128 13.129 13.135 13.130 13.122 13.125 13.133 13.126 13.123 13.134 13.127 13.124
PD 399 PD 1559
WM 13.137 WM 13.140
PD PD PD PD PD PD PD PD PD PD PD PD
1597 2700 500 571 572 599 1840 420 1591 84 1151 599
2.75 WM 13.111 WM 13.106 WM 13.110 WM 13.114 WM 13.105 WM 13.109 WM 13.108 WM 13.113 WM 13.112 WM 13.117 WM 13.105
PD PD PD PD
358 269 425 75
WM WM WM WM
PD PD PD PD PD PD PD PD PD PD PD PD PD PD PD PD
86 726 1616 1544 2647 2570 45 1537 2467 2273 1419 1625 2061 1545 1768 2235
2.78 WM 13.100 WM 13.99 WM 13.95 WM 13.103 WM 13.101 2.108 WM 13.89 WM 13.97 WM 13.94 WM 13.93 WM 13.88 WM 13.149 WM 13.104 WM 13.87 WM 13.92
C. carnescens (12)
C. laurentii (4) 13.145 13.146 13.143 13.144
C. magnus (20)
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
M13 type (No) (2) Cadel 1 Cadel 2 (10) Cal 1 Cal 2 Cal 3 Cal 4 Cal 5
Cal 6 Cal 7 Cal 8 Cal 9 Cal 10 (2) Caur 1 Caur 2 (11) Ccarn 1 Ccarn 2 Ccarn 3 Ccarn 4 Ccarn 5 Ccarn 6 Ccarn 7 Ccarn 8 Ccarn 9 Ccarn 10 Ccarn 11 (2) Claur 1 Claur 2 (20) Cmagn 1 Cmagn 2 Cmagn 3 Cmagn 4 Cmagn 5 Cmagn 6 Cmagn 7 Cmagn 8 Cmagn 9 Cmagn 10 Cmagn 11 Cmagn 12 Cmagn13 Cmagn 14 Cmagn 15 Cmagn 16
WM number
M13 type (No)
PD PD PD PD
1550 1592 2678 46
WM WM WM WM
13.86 13.98 13.96 13.102
PD PD PD PD PD PD PD PD PD PD PD PD PD PD
909 981 979 209 2676 1237 1261 982 1210 1176 1144 364 411 1244
WM WM WM WM WM WM WM WM WM WM WM WM WM WM
13.152 13.153 13.154 13.156 13.158 13.159 13.155 13.161 13.163 13.164 13.165 13.166 13.160 13.162
Cmagn 17 Cmagn 18 Cmagn 19 Cmagn 20 (12) Cunig 1 Cunig 2 Cunig 3 Cunig 4 Cunig 5 Cunig 6 Cunig 7 Cunig 8 Cunig 9
C. uniguttulatus (14)
Total (66)
Cunig 10 Cunig 11 Cunig 12 (59)
with recent studies reporting a high variability of STs and microsatellite profiles in Italian and Dutch isolates (Esposto et al., 2004; Hagen et al., 2012). No definitive conclusions can be formulated for the C. neoformans var. neoformans isolates studied herein, due to the limited number of isolates characterized by MLST analyses. However, none of the STs herein identified were previously reported from Italy, and five new STs were assigned as part of this study (ST250, ST251 ST252, ST264, ST294) within the global MLST database. The M13 PCR fingerprinting patterns observed, showed a high intraspecies variability amongst C. adeliensis, C. albidus, C. aureus, C. carnescens, C. laurentii, C. magnus and C. uniguttulatus Italian veterinary isolates. To our knowledge, studies focusing on the genetic characterization and virulence potential of non-C. neoformans Cryptococcus isolates are limited, likely due to the fact that those species are usually considered saprophytes and only in recent decades emerged as cause of cryptococcosis in immunocompromised hosts (Khawcharoenporn et al., 2006). The results of this study are in agreement with the high intraspecies heterogeneity demonstrated in some nonC. neoformans species (C. albidus and C. laurentii) by analyzing sequences of 28S and the ITS region of rDNA gene cluster (Fonseca et al., 2000; Sugita et al., 2000). However, the intraspecies diversity was confirmed in C. laurentii but not in C. albidus when analysed by M13 and (GACA)4 PCR fingerprinting (Pedroso et al., 2009b).
FEMS Yeast Res 14 (2014) 897–909
Genetic heterogeneity of Cryptococcus isolates in animals
905
Fig. 3. Dendrogram of Cryptococcus albidus isolates obtained from the M13 PCR fingerprinting patterns using the 1D gel analysis module (BioGalaxy) implemented in the BIOLOMICS software ver. 7.5.88 (BioAware).
Fig. 4. Dendrogram of Cryptococcus carnescens isolates obtained from the M13 PCR fingerprinting patterns using the 1D gel analysis module (BioGalaxy) implemented in the BIOLOMICS software ver. 7.5.88 (BioAware).
Fig. 5. Dendrogram of Cryptococcus laurentii, C. adeliensis and C. aureus isolates obtained from the M13 PCR fingerprinting patterns using the 1D gel analysis module (BioGalaxy) implemented in the BIOLOMICS software ver. 7.5.88 (BioAware).
It was suggested that genetic adaptation to environmental conditions leads to phenotypic changes that benefit survival of C. neoformans (Gupta & Fries, 2010) The occurrence of genome changes in response to host environmental stresses was also shown for C. gattii (Ulrich et al., 2009), but not for C. albidus (Pedroso et al., 2009b), suggesting that heterogeneity probably has different meanings in pathogenic and nonpathogenic species. Critical points in characterizing uncommon Cryptococcus species other than C. neoformans/C. gattii are the complicated laboratory diagnosis and the complexity of their taxonomy. Identification at species level could be difficult using only phenotypic methods (Rimek et al., FEMS Yeast Res 14 (2014) 897–909
2004). Indeed C. laurentii can be misidentified as C. neoformans or C. gattii in culture, as they may produce melanin-like pigments on LDOPA media and grow at 37 °C, and a singular isolate was later re-identified as C. flavescens using molecular methods (Fonseca et al., 2011). The other critical point is represented by the tricky classification based on rDNA sequence analysis of the C. laurentii sensu lato complex, which comprises C. aerius, C. carnescens, C. peneaus, C. laurentii and C. flavescens (Takashima et al., 2003) and of the C. albidus sensu lato complex, which contains many related species, including C. adeliensis and C. diffluens (Fonseca et al., 2000) In addition, some species, such as C. albidus, C. laurentii and C. uniguttulatus, may differ in their susceptibility to ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
906
P. Danesi et al.
Fig. 6. Dendrogram of Cryptococcus magnus isolates obtained from the M13 PCR fingerprinting patterns using the 1D gel analysis module (BioGalaxy) implemented in the BIOLOMICS software ver. 7.5.88 (BioAware).
Fig. 7. Dendrogram of Cryptococcus uniguttulatus isolates obtained from the M13 PCR fingerprinting patterns using the 1D gel analysis module (BioGalaxy) implemented in the BIOLOMICS software ver. 7.5.88 (BioAware).
antifungal drugs (Garcia-Martos et al., 2002; Serena et al., 2004; Bernal-Martinez et al., 2010; Pan et al., 2012).
should be taken into consideration when identifying clinical isolates.
Conclusions
Acknowledgements
The wide variety of MLST types of C. neoformans (12 STs) and the occurrence of aADa and aADa hybrids in our study support the possibility of genetic recombination in the studied area, consistently with a previous finding of rare MATa mating types in the environment (Romeo et al., 2012). This study also provided for the first time a genetic characterization of C. magnus and C. carnescens isolates by M13 PCR fingerprinting, which seems to be a good method to study the intraspecies heterogeneity of those species. Further studies are needed to confirm the presence and the significance of this high intraspecies diversity amongst non-C. neoformans Cryptococcus isolates, as the heterogeneity of emergent pathogens
We thank Krystyna Marszewska (Molecular Mycology Research Laboratory at Westmead Hospital, Westmead Australia) for her useful technical support. This study was supported by the Italian Ministry of Health [project RC IZS VE 05/09] to PD/GC and by an Australian NH&MRC grant # APP103195 to W.M. The authors report no conflicts of interest. The authors alone are responsible for the content and the writing of the paper.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
References Averbuch D, Boekhoutt T, Falk R, Engelhard D, Shapiro M, Block C & Polacheck I (2002) Fungemia in a cancer patient
FEMS Yeast Res 14 (2014) 897–909
Genetic heterogeneity of Cryptococcus isolates in animals
caused by fluconazole resistant Cryptococcus laurentii. Med Mycol 40: 479–484. Barreto de Oliveira MT, Boekhout T, Theelen B, Hagen F, Baroni FA, Lazera MS, Lengeler KB, Heitman J, Rivera IN & Paula CR (2004) Cryptococcus neoformans show a remarkable genotypic diversity in Brazil. J Clin Microbiol 42: 1356–1359. Bernal-Martinez L, Gomez-Lopez A, Castelli MV, Mesa-Arango AC, Zaragoza O, Rodriguez-Tudela JL & Cuenca-Estrella M (2010) Susceptibility profile of clinical isolates of non-Cryptococcus neoformans/non-Cryptococcus gattii Cryptococcus species and literature review. Med Mycol 48: 90–96. Boekhout T, Theelen B, Diaz M, Fell JW, Hop WC, Abeln EC, Dromer F & Meyer W (2001) Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans. Microbiology 147: 891–907. Bovers M, Hagen F & Boekhout T (2008) Diversity of the Cryptococcus neoformans-Cryptococcus gattii species complex. Rev Iberoam Micol 25: S4–S12. Cafarchia C, Camarda A, Romito D, Campolo M, Quaglia NC, Tullio D & Otranto D (2006a) Occurrence of yeasts in cloacae of migratory birds. Mycopathologia 161: 229–234. Cafarchia C, Romito D, Iatta R, Camarda A, Montagna MT & Otranto D (2006b) Role of birds of prey as carriers and spreaders of Cryptococcus neoformans and other zoonotic yeasts. Med Mycol 44: 485–492. Campisi E, Mancianti F, Pini G, Faggi E & Gargani G (2003) Investigation in central Italy of the possible association between Cryptococcus neoformans var. gattii and Eucalyptus camaldulensis. Eur J Epidemiol 18: 357–362. Campos FL, Pereira JR, Silva MV, Pereira dos Santos BC & De Assis Baroni F (2009) Isolamento de Cryptococcus neoformans, C. gattii e C. laurentii de sistema nervoso central de c~aes na cidade do Rio de Janeiro. Acta Sci Vet 37: 351–355. Carriconde F, Gilgado F, Arthur I, Ellis D, Malik R, van de Wiele N, Robert V, Currie BJ & Meyer W (2011) Clonality and a-a recombination in the Australian Cryptococcus gattii VGII population - an emerging outbreak in Australia. PLoS ONE 6: e16936. Casadevall A & Perfect JR (1998) Cryptococcus neoformans. ASM Press, Washington. Cogliati M (2013) Global molecular epidemiology of Cryptococcus neoformans and Cryptococcus gattii: an atlas of the molecular type. Scientifica Article ID 675213: 23. Cogliati M, Allaria M, Tortorano AM & Viviani MA (2000) Genotyping Cryptococcus neoformans var. neoformans with specific primers designed from PCR-fingerprinting bands sequenced using a modified PCR-based strategy. Med Mycol 38: 97–103. Cogliati M, Barchiesi F, Spreghini E & Tortorano AM (2012) Heterozygosis and pathogenicity of Cryptococcus neoformans AD-hybrid isolates. Mycopathologia 173: 347–357. Cogliati M, Zamfirova RR, Tortorano AM, Viviani MA & Network Fimua Cryptococcosis (2013) Molecular
FEMS Yeast Res 14 (2014) 897–909
907
epidemiology of Italian clinical Cryptococcus neoformans var. grubii isolates. Med Mycol 51: 499–506. Da Cunha T & Lusins J (1973) Cryptococcus albidus meningitis. South Med J 66: 1230–1231. Danesi P, Furnari C, Granato A, Schivo A, Otranto D, Capelli G & Cafarchia C (2014) Molecular identity and prevalence of Cryptococcus spp. nasal carriage in asymptomatic feral cats in Italy. Med Mycol in press, doi: 10.1093/mmy/ myu030. Duncan C, Stephen C, Lester S & Bartlett KH (2005) Subclinical infection and asymptomatic carriage of Cryptococcus gattii in dogs and cats during an outbreak of cryptococcosis. Med Mycol 43: 511–516. Esposto MC, Cogliati M, Tortorano AM & Viviani MA (2004) Determination of Cryptococcus neoformans var. neoformans mating type by multiplex PCR. Clin Microbiol Infect 10: 1092–1094. Faggi E, Gargani G, Pizzirani C, Pizzirani S & Saponetto N (1993) Cryptococcosis in domestic mammals. Mycoses 36: 165–170. Farina C, Vailati F, Manisco A & Goglio A (1999) Fungaemia survey: a 10-year experience in Bergamo, Italy. Mycoses 42: 543–548. FIMUA Cryptococcosis network (2002) European Confederation of Medical Mycology (ECMM) prospective survey of cryptococcosis: report from Italy. Med Mycol 40: 507–517. Fonseca A, Scorzetti G & Fell JW (2000) Diversity in the yeast Cryptococcus albidus and related species as revealed by ribosomal DNA sequence analysis. Can J Microbiol 46: 7–27. Boekhout T & Fell JW (2011) Cryptococcus Fonseca A, Vuillemin (1901). The Yeasts, a Taxonomic Study, 5th edn (Kurtzman CP, Fell JW & Boekhout T, eds), pp. 1661–1737. Elsevier, Amsterdam. Garcia-Martos P, Noval JF, Garcia-Tapia A, Marin P, Puerto JL & Sepulveda A (2002) Sensibilidad a antif ungicos de especies de Cryptococcus de interes clınico. Med Clin 119: 211–213. Grover N, Nawange SR, Naidu J, Singh SM & Sharma A (2007) Ecological niche of Cryptococcus neoformans var. grubii and Cryptococcus gattii in decaying wood of trunk hollows of living trees in Jabalpur City of Central India. Mycopathologia 164: 159–170. Guinea J, Hagen F, Pelaez T, Boekhout T, Tahoune H, Torres-Narbona M & Bouza E (2010) Antifungal susceptibility, serotyping, and genotyping of clinical Cryptococcus neoformans isolates collected during 18 years in a single institution in Madrid, Spain. Med Mycol 48: 942–948. Gupta G & Fries BC (2010) Variability of phenotypic traits in Cryptococcus varieties and species and the resulting implications for pathogenesis. Future Microbiol 5: 775–787. Hagen F, Illnait-Zaragozı MT, Meis JF et al. (2012) Extensive genetic diversity within the Dutch clinical Cryptococcus neoformans population. Clin Microbiol 50: 1918–1926. Halliday CL, Bui T, Krockenberger M, Malik R, Ellis DH & Carter DA (1999) Presence of alpha and a mating types in
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
908
environmental and clinical collections of Cryptococcus neoformans var. gattii strains from Australia. J Clin Microbiol 37: 2920–2926. Iatta R, Hagen F, Fico C, Lopatriello N, Boekhout T & Montagna MT (2012) Cryptococcus gattii infection in an immunocompetent patient from southern Italy. Mycopathologia 174: 87–92. Igreja RP, Lazera Mdos S, Wanke B, Galhardo MC, Kidd SE & Meyer W (2004) Molecular epidemiology of Cryptococcus neoformans isolates from AIDS patients of the Brazilian city, Rio de Janeiro. Med Mycol 42: 229–238. Johnson LB, Bradley SF & Kauffman CA (1998) Fungemia due to Cryptococcus laurentii and a review of non-neoformans cryptococcomia. Mycoses 41: 277–280. Kano R, Hosaka S & Hasegawa A (2004) First isolation of Cryptococcus magnus from a cat. Mycopathologia 157: 263– 264. Kano R, Kitagawat M, Oota S, Oosumi T, Murakami Y, Tokuriki M & Hasegawa A (2008) First case of feline systemic Cryptococcus albidus infection. Med Mycol 46: 75– 77. Khawcharoenporn T, Apisarnthanarak A, Kiratisin P, Mundy LM & Bailey TC (2006) Evaluation of Cryptococcus laurentii meningitis in a patient with HIV infection: a case report and review of the literature. Hawaii Med J 65: 260–263. Review Kordossis T, Avlami A, Velegraki A, Stefanou I, Georgakopoulos G, Papalambrou C & Legakis NJ (1998) First report of Cryptococcus laurentii meningitis and a fatal case of Cryptococcus albidus cryptococcemia in AIDS patients. Med Mycol 36: 335–339. Krockenberger MB, Canfield PJ & Malik R (2002) Cryptococcus neoformans in the koala (Phascolarctos cinereus): colonization by Cryptococcus neoformans var. gattii and investigation of environmental sources. Med Mycol 40: 263– 272. Kwon-Chung KJ, Boekhout T, Fell JW & Diaz M (2002) Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. basillisporus (Basidiomycota, Hymenomycetes, Tremellomycetidae). Taxon 51: 804–806. Lazera MS, Wanke B & Nishikawa MM (1993) Isolation of both varieties of Cryptococcus neoformans from saprophytic sources in the city of Rio de Janeiro, Brazil. J Med Vet Mycol 31: 449–454. Leite DP Jr, Amadio JV, Martins ER, Sim~ oes SA, Yamamoto AC, Leal-Santos FA, Takahara DT & Hahn RC (2012) Cryptococcus spp isolated from dust microhabitat in Brazilian libraries. J Occup Med Toxicol 7: 11. Lindsberg PJ, Pieninkeroinen I & Valtonen M (1997) Meningoencephalitis caused by Cryptococcus macerans. Scand J Infect Dis 29: 430–433. Litvintseva AP, Thakur R, Vilgalys R & Mitchell TG (2006) Multilocus sequence typing reveals three genetic subpopulations of Cryptococcus neoformans var. grubii (serotype A), including a unique population in Botswana. Genetics 172: 2223–2238.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
P. Danesi et al.
Malik R, Wigney DI, Muir DB & Love DN (1997) Asymptomatic carriage of Cryptococcus neoformans in the nasal cavity of dogs and cats. J Med Vet Mycol 35: 27–31. Mancianti F, Giannelli C, Bendinelli M & Poli A (1992) Mycological findings in feline immunodeficiency virus-infected cats. J Med Vet Mycol 30: 257–259. Mandrioli L, Bettini G, Marcato PS, Benazzi C, Della Salda L, Krockenberger MB & Jensen HE (2002) Central nervous system cryptococcoma in a cat. J Vet Med A 49: 526–530. Manfredi R, Fulgaro C, Sabbatani S, Legnani G & Fasulo G (2006) Emergence of amphotericin B-resistant Cryptococcus laurentii meningoencephalitis shortly after treatment for Cryptococcus neoformans meningitis in a patient with AIDS. AIDS Patient Care STDS 20: 227–232. McCurdy LH & Morrow JD (2001) Ventriculitis due to Cryptococcus uniguttulatus. South Med J 94: 65–66. Melo JC, Srinivasan S, Scott ML & Raff MJ (1980) Cryptococcus albidus meningitis. J Infect 2: 70–82. Meyer W, Marszewska K, Amirmostofian M et al. (1999) Molecular typing of global isolates of Cryptococcus neoformans var. neoformans by polymerase chain reaction fingerprinting and randomly amplified polymorphic DNA-a pilot study to standardize techniques on which to base a detailed epidemiological survey. Electrophoresis 20: 1790–1799. Meyer W, Casta~ neda A, Jackson S, Huynh M, Casta~ neda E & IberoAmerican Cryptococcal Study Group (2003) Molecular typing of IberoAmerican Cryptococcus neoformans isolates. Emerg Infect Dis 9: 189–195. Meyer W, Aanensen DM, Boekhout T et al. (2009) Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med Mycol 47: 561–570. Nielsen K, De Obaldia AL & Heitman J (2007) Cryptococcus neoformans mates on pigeon guano: implications for the realized ecological niche and globalization. Eukaryot Cell 6: 949–959. Pan W, Liao W, Hagen F, Theelen B, Shi W, Meis JF & Boekhout T (2012) Meningitis caused by Filobasidium uniguttulatum: case report and overview of the literature. Mycoses 55: 105–109. Pedroso SR, Ferreira JC & Candido RC (2009a) The isolation and characterization of virulence factors of Cryptococcus spp. from saprophytic sources in the city of Ribeira, Preto, Sao Paulo, Brazil. Microbiol Res 164: 221–227. Pedroso RS, Ferreira JC, Lavrador MA, Maffei CM & Candido RC (2009b) Evaluation of the experimental inoculation of Cryptococcus albidus and Cryptococcus laurentii in normal mice: virulence factors and molecular profile before and after animal passage. Mycopathologia 168: 59–72. Petter R, Kang BS, Boekhout T, Davis BJ & Kwon-Chung KJ (2001) A survey of heterobasidiomycetous yeasts for the presence of the genes homologous to virulence factors of Filobasidiella neoformans, CNLAC1 and CAP59. Microbiology 147: 2029–2036. Poth T, Seibold M, Werckenthin C & Hermanns W (2010) First report of a Cryptococcus magnus infection in a cat. Med Mycol 48: 1000–1004.
FEMS Yeast Res 14 (2014) 897–909
Genetic heterogeneity of Cryptococcus isolates in animals
Rimek D, Haase G, L€ uck A, Casper J & Podbielski A (2004) First report of a case of meningitis caused by Cryptococcus adeliensis in a patient with acute myeloid leukemia. J Clin Microbiol 42: 481–483. Romeo O, Scordino F, Chillemi V & Criseo G (2012) Cryptococcus neoformans/Cryptococcus gattii species complex in Southern Italy: an overview on the environmental diffusion of serotypes, genotypes and mating-types. Mycopathologia 174: 283–291. Saponetto N, Pizzirani S, Pizzirani C, Faggi E, Azzi A & Gargani G (1991) Disseminated cryptococcosis in a cat. J Mycol Med 1: 236–238. Serena C, Pastor FJ, Ortoneda M, Capilla J, Nolard N & Guarro J (2004) In vitro antifungal susceptibilities of uncommon basidiomycetous yeasts. Antimicrob Agents Chemother 48: 2724–2726. Stephen C, Lester S, Black W, Fyfe M & Raverty S (2002) Multispecies outbreak of cryptococcosis on southern Vancouver Island, British Columbia. Can Vet J 43: 792–794. Sugita T, Takashima M, Ikeda R, Nakase T & Shinoda T (2000) Intraspecies diversity of Cryptococcus laurentii as revealed by sequences of internal transcribed spacer regions and 28S rRNA gene and taxonomic position of C. laurentii clinical isolates. J Clin Microbiol 38: 1468–1471. Sykes JE & Malik R (2012) Cryptococcosis. Infectious Diseases of the Dog and Cat, 4th edn (Greene CE, ed), pp. 621–634. Saunders, Elsevier, St Louis. Takashima M, Sugita T, Shinoda T & Nakase T (2003) Three new combinations from the Cryptococcus laurentii complex: Cryptococcus aureus, Cryptococcus carnescens and
FEMS Yeast Res 14 (2014) 897–909
909
Cryptococcus peneaus. Int J Syst Evol Microbiol 53: 1187– 1194. Tamura K, Peterson D, Peterson N, Stecher G, Nei M & Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28: 2731–2739. Ulrich K, Ngamskulrungroj P & Meyer W (2009) M13 PCR fingerprinting detects genetic instability of Cryptococcus gattii after passage through a rat model of infection. Aust Mycol 28: 20–23. Velegraki A, Kiosses VG, Kansouzidou A, Smilakou S, Mitroussia-Ziouva A & Legakis NJ (2001) Prospective use of RFLP analysis on amplified Cryptococcus neoformans URA5 gene sequences for rapid identification of varieties and serotypes in clinical samples. Med Mycol 39: 409–417. Viviani MA, Wen H, Roverselli A, Caldarelli-Stefano R, Cogliati M, Ferrante P & Tortorano AM (1997) Identification by polymerase chain reaction fingerprinting of Cryptococcus neoformans serotype AD. J Med Vet Mycol 35: 355–360. Viviani MA, Cogliati M, Esposto MC, Lemmer K, Tintelnot K, Colom Valiente MF, Swinne D, Velegraki A, Velho R & European Confederation of Medical Mycology (ECMM) Cryptococcosis Working Group (2006) Molecular analysis of 311 Cryptococcus neoformans isolates from a 30-month ECMM survey of cryptococcosis in Europe. FEMS Yeast Res 6: 614–619. Wuczkowski M, Metzger E, Sterflinger K & Prillinger H (2005) Diversity of yeasts isolated from litter and soil of different natural forest sites in Austria. Die Bodenkultur 56: 201–208.
ª 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved
