J. Korean Soc. Appl. Biol. Chem. 52(1), 00-00 (2009)
Multiplex PCR Detection of Four Events of GM Maize (Event 3272, LY038, MIR162, and MON88017)
Jae-Hwan Kim, Si-Hong Park, and Hae-Yeong Kim* Institute of Life Sciences & Resources and Graduate School of Biotechnology, Kyung Hee University, Yongin 446-701 Korea Received
Key words:
Event 3272, GM maize, LY038, MIR604, MON88017, multiplex PCR
To date, a number of genetically modified (GM) crops have been planted in 23 countries. GM maize was grown on 35.2 million hectares (13% of the global biotech area) in 2007 [James, 2007]. Since the first approval of a commercial genetically modified organism (GMO) in 1996, many countries have approved commercial releases of various events of GM maize for food and feed. According to the GMO database of Agbios (http://www. agbios.com, Agriculture and Biotechnology Strategies Inc., Merrickville, Ontario, Canada), 47 events of GM maize including 18 stacked traits were developed and approved in several countries [James, 2007]. The KFDA (Korea Food and Drug Administration) has approved 28 events of GM maize. KFDA is additionally conducting safety assessments of several GM maize events (MIR162, MON89034, Event 3272, LY038, etc.). Korea first imported GM maize for food use (corn starch and syrup) in 2008. GM crops will continue to be developed in various countries and Korea may import more GMOs for food use in the near future. Therefore, detection methods should be continuously developed to monitor a labeling system for GM foods. In this study, an event-specific multiplex PCR detection method for four events of GM maize (Event 3272, *Corresponding author Phone: 82-31-201-2660; Fax: 82-31-204-8116 E-mail:
[email protected]
Abbreviations: GMO, genetically modified organism; LOD, limit of detection; PCR, polymerase chain reaction doi:10.3839/jksabc.
Short Communication LY038, MIR162, and MON88017) was devised. GM maize Event 3272 contains the thermostable alpha amylase (amy797E) gene from Thermococcus bacteria and the mannose-6-phosphate isomerase (pmi) gene from E. coli. GM maize LY038 contains the dihydrodipicolinate synthase (cordapA) gene from Corynebacterium glutamicum. GM maize MIR162 containing the vegetative insecticidal protein (vip3A) gene from Bacillus thuringiensis was developed to provide resistance to Lepidopteran species. GM maize MON88017 contains the Cry3Bb1 delta-endotoxin (cry3Bb1) gene for insect resistance from Bacillus thuringiensis subsp. kumamotoensis strain EG4691 and the 5-enolpyruvylshikimate-3-phosphate synthase (cp4 epsps) gene for glyphosate tolerance from Agrobacterium tumefaciens CP4. An event-specific PCR system designed based on the junction between the transgenic insert and the host DNA is regarded as the most specific approach [Heo et al., 2004]. Multiplex PCR detection methods have been developed for GM maize [Matsuoka et al., 2001; Heo et al., 2004; Hernández et al., 2005; Onishi et al., 2005; Kim et al., 2006; Ahn et al., 2008], GM canola [Demeke et al., 2002; Kim et al., 2007], GM cotton [Kim et al., 2008], and mixed GM crops [James et al., 2003; Germini et al., 2004; Forte et al., 2005]. In this study, the multiplex PCR method was developed to efficiently monitor four events of GM maize (Event 3272, LY038, MIR162, and MON88017) in a single reaction using event-specific primers. Event 3272 and MIR162 were developed from Syngenta Seeds Inc. (Golden Valley, MN, USA), and LY038 and MON88017 were developed from Monsanto Company (St. Louis, MO). Eleven different plants [soybean (Glycine max), corn (Zea mays), canola (Brassica napus), cotton (Gossypium hirsutum), rice (Oryza sativa), barley (Hordeum vulgare), buck wheat (Fagopyrum esculentum), wheat (Triticum aestivum), red-bean (Phaseolus angularis), radish (Raphanus sativus), and Chinese cabbage (Brassica rapa subsp. pekinensis)] were collected from Rural Development Association in Korea and the Department of Food Biotechnology at Kyung Hee University. Samples were finely ground in liquid nitrogen using a mortar and pestle. The DNeasy Plant Maxi Kit (Qiagen GmbH, Hilden, Germany) was used for DNA extraction according to the manufacturer’s instructions. PCR was carried out on a Mastercycler (Eppendorf, Hamburg, Germany). The 25-µL reaction volume contained 2.5 µL of 10× buffer (Applied Biosystems, Foster City, CA, USA), 200 µM of each dNTP (Applied Biosystems), 1.5
2
Jae-Hwan Kim
et al.
Table 1. Primer pairs for multiplex PCR. Primer name
Sequences (5'-3')
SSIIb-JHF SSIIb-JHR M88017-JHF M88017-JHR M162-JHF M162-JHR L038-JHF L038-JHR E3272-JHF E3272-JHR
ATGCCAGTGCGGTGAAGCCA CGGAGCTGCATCAGCCTTAG CAGCAGAATCGTGTGACAAC TTTCCCGGACATGAAGCCAT TATAGCGCGCAAACTAGGAT CTACCACAAGGCCCAGTATG GCTCGGATCCACTAGTAACG GCCGTCGCAATGCACACTCA AGTGCGTGATGAGGGCTCTT CGTTTCCCGCCTTCAGTTTA
mM of MgCl2, 0.8 unit of Ampli Gold DNA polymerase (Applied Biosystems), the appropriate concentration of template DNA. The optimized primer pairs are shown in Table 1. The PCR conditions were preincubation at 94oC for 5 min, 40 cycles of denaturation at 94oC for 30 s, annealing at 61oC for 30 s, extension at 72oC for 30 s, and terminal elongation at 72oC for 8 min. The primer pair SSIIb-JHF/JHR was used to amplify an endogenous maize gene ( ) as an internal control. The primer pair SSIIb-JHF/JHR gave rise to a 101-bp amplicon via PCR (Fig. 1). We performed a qualitative PCR using 50 ng of genomic DNA from 11 different plant species to test the specificity of the intrinsic primer pair. No amplicon was observed in any of the species tested except for maize (data not shown). Single PCR was used to individually assess the specificity of each designed primer pair. The genomic DNA extracted from the seeds of four events of GM maize was used as template. The expected amplicons were specifically amplified from each target GM maize event: Event 3272, LY038, MIR162, and MON88017 (data not shown). The M88017-JHF/JHR primer pair amplified a 120-bp fragment of the 5'-flanking region of MON88017, the M162 JHF/JHR primer pair amplified a 140-bp fragment of the 3'-flanking region of MIR162, the L038 JHF/JHR primer pair amplified a 161-bp fragment of the 3'flanking region of LY038, and the E3272 JHF/JHR primer pair amplified a 200-bp fragment of the 5'flanking region of Event 3272 (Fig. 1). Figure 1 shows the result of a multiplex PCR performed under optimized conditions. The multiplex PCR amplified two fragments corresponding to the chosen target sequence for each GM event and to the sequence as an internal control in the non-GM maize. As shown in lane 5 of Fig. 1A, the intensities of the bands derived from the four amplicons were equivalent. The sequences of these amplicons were determined using an ABIPRISM 3700 DNA analyzer Taq
zSSIIb
zSSIIb
Amplicon size Concentration (bp) (µM)
Targets zSSIIb MON88017 5'-flanking region MIR162 3'-flanking region LY038 3'-flanking region Event 3272 5'-flanking region
101
4
120
12
140
14
161
4
200
50
(Perkin Elmer, Boston, MA, USA). This PCR result showed that this method is sufficient to distinguish the four events of GM maize (Event 3272, LY038, MIR162, and MON88017). We also evaluated the sensitivity of the multiplex PCR method. Reference materials containing 10, 5, 3, 1, 0.5, 0.1, and 0.01% of the GM maize mixture were prepared by mixing GM DNA from each GM maize event (Event 3272, LY038, MIR162, and MON88017) with non-GM DNA from control maize. In the multiplex PCR assay, the LOD value was determined to be 1% of the GM maize mixture in 100 ng of genomic DNA (Fig. 1B). This LOD value is significant for monitoring the presence of GMOs in food using PCR. Multiplex PCR is regarded as a useful tool for GMO detection due to the dramatic increase in the use of GMOs; numerous multiplex PCR systems for simultaneous detection of multiple transgenes in commercialized GM crops have been developed by many researchers [Matsuoka ., 2001; James ., 2003; Germini ., 2004; Heo ., 2004; Forte ., 2005; Kim ., 2006; Kim ., 2007; Onishi ., 2007; Ahn ., 2008]. The advantage of multiplex PCR-based methods is that several target DNA sequences can be identified in a single reaction [Markoulatos ., 2002]. However, in the case of processed foods, multiplex PCR may be a limitation due to the nature of the target DNAs. It is difficult to distinguish between PCR products of similar lengths due to the limitations of agarose gel electrophoresis. Additionally, the amplicon size should be considered when detecting DNA in processed foods due to DNA degradation during food processing. Most GMOs contain the same or a similar promoter, terminator, foreign gene, or a combination of two of these elements [Kim ., 2007]. Therefore, event-specific PCR system is regarded as the most specific approach for GMO detection because of its high specificity. In this study, event-specific primer pairs were used for the effective and reliable identification et al
et al
et al
et al
al
et al
et al
et al
et
et al
et al
et al
Multiplex PCR Detection of Four Events of GM Maize (Event 3272, LY038, MIR162, and MON88017)
3
References
Fig. 1. Specificity (A) and Sensitivity (B) analysis of the multiplex PCR. Lane M: Marker (100 bp DNA ladder);
B: Blank; In Fig. 1A, lane 1: MON88017 and endogenous gene; lane 2: MIR162 and endogenous gene; lane 3: LY038 and endogenous gene; lane 4: Event 3272 and endogenous gene; lane 5: MON88017, MIR162, LY038, Event 3272, and endogenous gene; In Fig. 1B, lanes 1-8: 100, 10, 5, 3, 1, 0.5, 0.1, and 0.01% of a mixture of GM maize (MON88017, MIR162, LY038, and Event 3272); lane 9: non-GM maize; The reference materials containing 10, 5, 3, 1, 0.5, 0.1 and 0.01% of the GM maize mixture were prepared by mixing GM DNA from each variety of GM maize (Event 3272, LY038, MIR162, and MON88017) with non-GM DNA from the control maize to determine the LOD value of the multiplex PCR.
of four events of GM maize (Event 3272, LY038, MIR162, and MON88017) using multiplex PCR. In conclusion, we developed a multiplex PCR method for four events of GM maize (Event 3272, LY038, MIR162, and MON88017). This method represents a useful tool to detect four events of GM maize (Event 3272, LY038, MIR162, and MON88017) in the markets and to monitor a labeling system for GMOs (3% threshold) in Korea.
Acknowledgment. This research was supported by the
Kyung Hee University Post-Doctoral Research Associate Fund in 2008 (KHU-20080483).
Ahn JH, Kim JH, Kim SY, Lee WY, Park SH, and Kim HY (2008) Multiplex PCR detection for 3 events of genetically modified maize, DAS-59122-7, TC6275, and MIR604. Food Sci Biotechnol 17, 569-572. Demeke T, Giroux RW, Reitmeier S, and Simon SL (2002) Development of a polymerase chain reaction assay for detection of three canola transgenes. J AOCS 79, 10151019. Forte VT, Di Pinto A, Martino C, Tantillo GM, Grasso G, and Schena FP (2005) A general multiplex-PCR assay for the general detection of genetically modified soya and maize, Food Control 16, 535-539. Germini A, Zanetti A, Salati C, Rossi S, Forre C, Schmid S, Fogher C, and Marchelli R (2004) Development of a seven-target multiplex PCR for the simultaneous detection of transgenic soybean and maize in feeds and foods. J Agric Food Chem 52, 4350-4350. Hernández M, Rodriguez-Lázaro D, Zhang D, Esteve T, Pla M, and Prat S (2005) Interlaboratory transfer of a PCR multiplex method for simultaneous detection of four genetically modified maize events: Bt11, MON810, T25, and GA21. J Agric Food Chem 53, 3333-3337. Heo MS, Kim JH, Park SH, Woo GJ, and Kim HY (2004) Detection of genetically modified maize by multiplex PCR method. J Microbiol Biotechnol 14, 1227-1231. James C. (2007) Global Status of Commercialized Biotech/ GM Crops. ISAAA Briefs No. 37. James D, Schmidt AM, Wall E, Green M, and Masri S (2003) Reliable detection and identification of genetically modified maize, soybean, and canola by multiplex PCR analysis. J Agric Food Chem 51, 5829-5834. Kim JH, Kim SA, Seo YJ, Lee WY, Park SH, and Kim HY (2008) Multiplex PCR detection of the MON1445, MON15985, MON88913, and LLcotton25 varieties of GM cotton. Food Sci Biotechnol 17, 829-832. Kim JH, Kim TW, Lee WY, Park SH, and Kim HY (2007) Multiplex PCR detection of the GT73, MS8xRF3, and T45 varieties of GM canola. Food Sci Biotechnol 16, 104-109. Kim JH, Song HS, Heo MS, Lee WY, Lee SH, Park SH, Park HK, Kim MC, and Kim HY (2006) Detection of eight different events of genetically modified maize by multiplex PCR method. Food Sci Biotechnol 15, 148151. Markoulatos P, Siafakas N, and Moncany M (2002) Multiplex polymerase chain reaction: a practical approach. J Clin Lab Anal 16, 47-51. Matsuoka T, Kuribara H, Akiyama H, Miura H, Goda Y, Kusakabe Y, Kenji I, Toyoda M, and Hino A (2001) A multiplex PCR method of detecting recombinant DNAs from five lines of genetically modified maize. J Food Hyg Soc Japan 42, 24-32. Onishi M, Matsuoka T, Kodama T, Kashiwaba K, Futo S, Akiyama H, Maitani T, Furui S, Oguchi T, and Hino A (2005) Development of a multiplex polymerase chain reaction method for simultaneous detection of eight events of genetically modified maize. J Agric Food Chem 53, 9713-9721.
