Murine susceptibility to Chagas' disease maps to ... - Nature

Genes and Immunity (2003) 4, 321–325 & 2003 Nature Publishing Group All rights reserved 1466-4879/03 $25.00 www.nature.com/gene

Murine susceptibility to Chagas’ disease maps to chromosomes 5 and 17 SEB Graefe1, BS Meyer2, B Mu¨ller-Myhsok3, F Ru¨schendorf2, C Drosten1, T Laue4, C Steeg1, P Nu¨rnberg2 and B Fleischer1 Department of Immunology, Bernhard-Nocht-Institute for Tropical Medicine, Hamburg, Germany; 2Max-Delbru¨ck-Center, Gene Mapping Center, Berlin-Buch, Germany; 3Department of Bioinformatics, Bernhard-Nocht-Institute for Tropical Medicine, Hamburg, Germany; 4Artus GmbH, Nobistor 29, Hamburg, Germany 1

Chagas’ disease is caused by the protozoan parasite Trypanosoma cruzi and commonly modelled in inbred mice. Susceptibility of mouse strains to experimental infection varies considerably. We quantified parasite tissue burdens in resistant and susceptible strains by real time PCR and applied a backcross strategy to map the genomic loci linked to susceptibility in inbred mice. Resistant B6D2F1 mice were backcrossed with susceptible C57BL/6 mice, and 46 of a total 192 offspring died after infection. Their genomes were scanned with microsatellite markers. One region on chromosome 17 was significantly linked to susceptibility, while another on chromosome 5 was suggestive of linkage. Genes and Immunity (2003) 4, 321–325. doi:10.1038/sj.gene.6363972 Keywords: T. cruzi; tissue parasite burden; C57BL/6 mice; susceptibility; linkage

Introduction Up to 18 million people are infected with Trypanosoma cruzi on the American continent. The parasite is naturally transmitted by the inoculation into the skin or mucous membranes of infectious trypomastigote forms that are present in the excretions of the vector, reduviide bugs. Following transmission, the infection may cause an acute sickness of varying severity, or it may remain asymptomatic for years. In some cases, mortality during early infection may exceed 5%, especially in children.1 The infection with T. cruzi usually becomes clinically overt in the chronic stage with signs of disrupted autonomous neural activity, mainly affecting the heart and intestine and termed Chagas’ disease or American Trypanosomiasis.1 Chagas’ disease is a leading cause of morbidity and mortality in South and Central America.2 It is characterized histologically by a persistent inflammation in the affected tissue. The pathogenesis of this inflammation is not fully understood, but it has been associated with autoimmune reactivity. However, an increasing body of evidence has accumulated indicating that chronic symptoms are mediated by persistence of parasites,3,4 even when present in low or undetectable numbers. Little is known about the host genetics of T. cruzi infection. It is assumed that host genes are responsible for the variation of morbidity in endemic Correspondence: Dr SEB Graefe, Department of Immunology, BernhardNocht-Institute for Tropical Medicine, Bernhard-Nocht-St 74, D-20359 Hamburg, Germany. E-mail [email protected] Received 30 August 2002; revised 29 November 2002; accepted 20 December 2002

areas.5 In an epidemiological study, the prevalence of serum antibody to T. cruzi as a marker of infection was strongly influenced by genetic factors.6 The parasite naturally infects a number of rodents such as rats and mice as well as other mammals that serve as a reservoir of parasites. In mice, the disease takes a similar course as in man. Inbred mouse strains are therefore commonly used to study Chagas’ disease. Differences of disease severity depend both on the parasite strain and on the inbred mouse strain used. Genes determining susceptibility of mice to severe infection with T. cruzi have not yet been identified. However, the H2 locus was found to influence the early phase, with certain haplotypes being of greater benefit to the host than others in terms of parasitaemia levels and mortality.7,8 Other genomic regions outside the H2 locus were also inferred to contribute,7–9 but have not been localized. Several mouse strains are highly susceptible to T. cruzi, succumbing to infection with some 100 parasites, while hybrid mice are generally more resistant to experimental infection.8,10,11 This suggests that in inbred mice, recessive alleles may be responsible for susceptibility. We compared parasite tissue burdens during early experimental T. cruzi infection in susceptible C57BL/6 and DBA/2 inbred mice and in resistant B6D2F1 (C57BL/ 6 DBA/2) hybrid mice by quantitative PCR. In order to identify murine genomic regions linked to susceptibility to a severe course of T. cruzi infection, we backcrossed resistant B6D2F1 mice with their parental strains. The susceptible offspring from the C57BL/6 B6D2F1 backcross was genotyped with microsatellite markers.

Gene loci linked to severe murine Chagas’ disease SEB Graefe et al

322

Figure 1 Course of early T. cruzi infection in susceptible C57BL/6 and DBA/2 mice and in resistant B6D2F1 hybrid mice. Male mice were infected intraperitoneally at 6–8 weeks of age with 104 T. cruzi Tulahuen (WHO reference strain M/HOM/CH/00/Tulahuen C2) blood form trypomastigotes. Cumulative mortality (a) and parasitaemia (b) are from one of three experiments with four to six mice per group. Parasitaemia was determined by diluting blood five- to 10-fold in 0.89% (w/v) NH4Cl and counting viable parasites in a Neubauer chamber.12

Results and discussion Following experimental infection with T. cruzi trypomastigotes, C57BL/6 and DBA/2 mice died between days 15 and 30 with parasitaemia exceeding 106 per ml blood (Figure 1). Mice derived from a cross of these strains, B6D2F1 mice, did not succumb to the infection, and parasitaemia was reduced to less than 5 105 per ml blood (Figure 1). We established a real-time PCR protocol to compare levels of parasitic DNA in infected tissue. We found that on day 13 of the infection, that is, shortly before susceptible mice died, levels of parasitism were generally lower in resistant B6D2F1 mice, with the exception of heart muscle where they were comparable between the three strains (Figure 2). Remarkably, in C57BL/6 mice, parasite load was highest in the spleen, while it was lowest in this tissue in DBA/2 and B6D2F1 mice. In these strains, highest levels of tissue parasitism were found in heart and striated muscle. The results show that parasitic infiltration varies among susceptible strains and dissociates between different tissues. They also indicate that tissue tropism of a given T. cruzi strain depends considerably on the host. The hybrid mouse strain B6D2F1 is considerably more resistant to experimental T. cruzi infection than the parental inbred strains (C57BL/6 and DBA/2). This is indicative of recessive alleles being responsible for the genetic susceptibility in these inbred mice. The offspring of a backcross bear both homozygous and heterozygous genomic regions. In the case of the T. cruzi-resistant B6D2F1 mice, this translates into backcross mice bearing Genes and Immunity

Figure 2 Relative tissue parasite burden on day 13 of T. cruzi infection in susceptible C57BL/6 and DBA/2 mice and in resistant B6D2F1 hybrid mice. Parasite burdens in spleen, liver, heart muscle (heart m). and skeletal muscle (skeletal m.) were measured by realtime PCR of T. cruzi DNA. Specimens of about 30 mg were analysed. DNA extraction was performed with Gentra Puregenet tissue kit (Biozym, Hessisch Oldendorf, Germany) according to the manufacturer’s instructions. A 121 bp sequence of the 140/116 kDa antigen gene of T. cruzi (accession no. U15616) was amplified, with forward primer GGCTGCAGAGGTCAGGTGTT, reverse primer GCATATCGGCAAACCAGCA, and an internal probe FAMTAGGCTTCCATGATGCAAAAACAAAAGAAA-TAMRA-TA. Reaction mixtures of 0.05 ml contained 200 nM of each primer, 100 nM probe, 0.2 mM of each dNTP, 2 mM MgCl2, 1 U AmpliTaq Gold, 50 mM KCl, 0.01 mM EDTA, 10 mM Tris-HCl, pH 8.3 and 0.005 ml of template DNA. PCR reagents were obtained from Applied Biosystems (Weiterstadt, Germany). Thermal cycling comprised an initial denaturation step of 15 min 951C, followed by 45 cycles of 20 s 951C, 40 s 581C on an Abi Prism 7700 SDS Instrument (Applied Biosystems). A 347 bp stretch of the murine beta-actin gene was used for quantification of host DNA. Amplification was carried out essentially as described.13 Both T. cruzi and beta-actin sequences were quantified individually for each DNA sample according to Bustin et al.14 The quantity of parasite DNA in a specimen was expressed in relation to that of its content of beta-actin DNA. The protocol allowed for detection of less than 10 T. cruzi typomastigotes per reaction. The mean relative concentration of T. cruzi DNA from three mice of each strain is shown. Statistically significant differences (Po0.05) between resistant B6D2F1 mice and the susceptible parental strains are indicated with an asterisk. Data are from one of three experiments.

Figure 3 Differential survival of backcross mice to experimental T. cruzi infection. Hybrid B6D2F1 mice were either crossed with C57BL/6 mice or with DBA/2 mice. Male offspring of the C57BL/ 6 B6D2F1 backcross (n=28, black line) and of the DBA/2 B6D2F1 backcross (n=50, grey line) were infected and monitored for survival during the acute phase. Five offspring in either group died.

either homozygous genomic regions derived from a susceptible parental strain or heterozygous regions from the resistant hybrid strain. We therefore applied a


323

Figure 4 Susceptibility of C57BL/6 mice to lethal T. cruzi infection maps to chromosomes 5 and 17. The offspring of a C57BL6 B6D2F1 backcross were infected, and 46 of 192 mice died during the early phase of the infection. These susceptible offspring were genotyped with polymorphic microsatellite markers. Genomic DNA was prepared from tails by conventional method. Reverse primers for the polymerase chain reaction were labelled either with FAM, HEX or NED flurochromes. Microsatellite markers at 10–15 cM spacing that were informative for the strains involved were used for primary genotyping of all autosomes (a). Subsequent fine mapping of regions displaying elevated frequencies of homozygous haplotypes was performed at 0–3 cM intervals (b, c). Amplification products were analysed by automated genotyping on the MegaBACETM 1000 DNA Analysis System (Amersham Biosciences, Sunnyvale, USA) using an internal length standard in every capillary and the MegaBACE Genetic Profiler software version 1.1 (Amersham Biosciences, Sunnyvale, USA). In total, 46 susceptible mice were genotyped with 156 microsatellite markers. The construction of genetic maps was performed with MAPMAKER/EXP v3.0b.15 Statistics were computed by comparing the numbers of homozygote vs heterozygote mice. A one-sided test of goodness-of-it was applied to calculate the significance of increased rates of homozygous markers. Fine mapping of candidate regions confirmed significant and suggestive linkage of loci on chromosomes 17 (b) and 5 (c), respectively. Single-point (solid line) and multi-point (dashed line) calculations of w2 values are shown. The dotted lines at w2=16.56 and 8.74 are threshold values for significant and suggestive linkage of a locus, respectively.16

backcross strategy to identify linkage of homozygous genomic regions of inbred mice with susceptibility to a severe course of T. cruzi infection. In a first approach, resistant B6D2F1 were backcrossed either with C57BL/6 or with DBA/2 mice. In the case of the C57BL/ 6 B6D2F1 backcross, five out of 28 N2 mice died (Figure 3). In the case of the DBA/2 x B6D2F1 backcross, five out of 50 N2 mice succumbed to the infection with T. cruzi trypomastigotes (Figure 3). In order to identify linkage of C57BL/6 genomic regions with susceptibility to a lethal outcome of experimental T. cruzi infection, we generated and infected 192 male N2 backcross mice (C57BL/6 B6D2F1). Of these, 46 (24%, ie about one-quarter) died between days 14 and 40 of infection, indicating the presence of two (or more) recessive alleles determining susceptibility. We performed a genome-wide scan at 10– 15 cM intervals with polymorphic microsatellite markers on the genomes of the susceptible offspring. A number of chromosomal regions displayed elevated frequencies of homozygosity (Figure 4A), and these were analysed with further markers at smaller intervals. Notably, loci on chromosomes 5, 13 and 17 were suggestive of influencing susceptibility. On chromosome 17, fine mapping

revealed significant linkage of a region between 16 and 22.3 cM from the centromere (Figure 4b), with a maximum w2 of 17.04 (P ¼ 0.000018). Increased mapping resolution on chromosome 5 confirmed the presence of a suggestive candidate region between approximately 45 and 52 cM, with w2 of 10.52 (P ¼ 0.00059, Figure 2c). The data concerning these two candidate loci are shown in Table 1. On chromosome 13, an additional region (including marker D13Mit35 at approximately 71 cM, w2 ¼ 9.80, P ¼ 0.00087) may also be linked to the susceptible phenotype. Other regions with w245 could not be substantiated by increasing mapping resolution or by multipoint analysis. This study confirms linkage of chromosome 17 and suggests linkage of another gene locus on chromosome 5 with murine susceptibility to death follwing T. cruzi infection. The regions on chromosomes 17 and 5 identified in this study map to the positions of two quantitative trait loci (QTLs) referred to as Tir1 and Tir2 (‘trypanosome immune response’), respectively. These were found to confer resistance of C57BL/6 mice to T. congolense,17,18 a hemoflagellate pathogenic to mice and domestic livestock. The reciprocal effect of both loci on murine immunity to either trypanosome may reflect Genes and Immunity


324

Table 1 Murine genetic regions linked to severe T. cruzi infection Single-pointc Chromosome, microsatellite marker

Multi-pointc

Approx. pos. (cM)

w2

P-value

w2

P-value

Chromosome 5a d5mit20 d5mit155 d5mit157 d5mit10 d5mit41 d5mit403 d5mit239 d5mit240 d5mit25

44.8 44.8 44.8 49.3 49.3 49.3 51.5 51.5 51.5

8.02 7.36 7.71 10.76 9.80 10.52 8.70 9.09 8.40

2.31E-03 3.32E-03 2.75E-03 5.19E-04 8.73E-04 5.90E-04 1.59E-03 1.29E-03 1.88E-03

7.04 7.04 7.04 10.52 10.52 10.52 8.70 8.70 8.70

3.98 103 3.98 103 3.98 103 5.90 104 5.90 104 5.90 104 1.59 103 1.59 103 1.59 103

Chromosome 17b d17mit173 d17mit30 d17mit198 d17mit135 d17mit16 d17mit234 d17mit11 d17mit168 d17mit50

11.8 13.6 16.0 17.0 18.2 20.7 22.0 22.3 23.2

14.40 13.89 14.70 17.04 16.20 15.36 13.56 11.52 12.52

7.39E-05 9.69E-05 6.30E-05 1.83E-05 2.85E-05 4.44E-05 1.16E-04 3.44E-04 2.01E-04

14.57 14.64 14.70 17.04 17.04 17.04 16.49 14.70 12.52

6.79 105 6.55 105 6.32 105 1.83 105 1.83 105 1.83 105 2.46 105 6.32 105 2.01 104

Order and approximate position of microsatellite markers according to a MAPMAKER15 multipoint analysis, with a log-likelihood of 56.42; this marker order was significantly more likely than that in the mouse genome database (log-likelihood–70.40). b Order and approximate position of microsatellite markers according to the mouse genome database (www.informatics.jax.org) and confirmed by MAPMAKER analysis. c 2 w and P-values correspond to a one-sided test for homozygosity. a

differential requirements for preventing severe disease. The control of T. cruzi infection affords a proinflammatory T-cell response, involving both CD4+ and CD8+ lymphocytes,19 while the defense against T. congolense depends on the generation of antibody and on the phagocytic activity of macrophages.20 The locus on chromosome 17 includes the murine MHC (homologous to the human HLA locus on chromosome 6) that codes for a number of immunologically important genes in addition to those responsible for antigen presentation. In addition, chromosome 17 is involved in determining murine resistance to Leishmania major 21 and in controlling cyst formation in experimental Toxoplasma gondii infection.22,23 The candidate region on chromosome 13 is indeed suggestive of linkage to susceptibility, too. However, the regulation of immunity to protozoa in mice has not previously been ascribed to this locus. The investigation is currently being extended to ascertain its relevance. In conclusion, the identification of genomic regions determining susceptibility to T. cruzi infection in mice supports efforts to unravel the genetic mechanisms that are associated with severe Chagas’ disease in man.

Acknowledgements We are grateful to Y Richter for mouse care and breeding, and to I Gaworski, U Klauenberg, E Kist, D Pachale and R Martin for technical assistance. Genes and Immunity

References 1 Miles MA. New World trypanosomiasis. In: Collier L (ed). Topley & Wilson’s Microbiology and Microbial Infections, Vol 5 Arnold: London, 1998, pp 283–302. 2 Ben Beard C, Schofield CJ. Chagas disease or American trypanosomiasis. Bull World Health Organ 1998; 76 (Suppl. 2): 144. 3 Tarleton RL, Zhang L, Downs MO. Autoimmune rejection of neonatal heart transplants in experimental Chagas disease is a parasite-specific response to infected host tissue. Proc Natl Acad Sci USA 1997; 94: 3932–3937. 4 Kierszenbaum F. Chagas’ disease and the autoimmunity hypothesis. Clin Microbiol Rev 1999; 12: 210–223. 5 Nogueira N, Coura JR. American Trypanosomiasis (Chagas’ disease). In: Warren KS, Mahmoud AAF. (eds). Tropical and Geographical Medicine McGraw-Hill: New York, 1990, pp 281–296. 6 Williams-Blangero S, Vandeberg JL, Blangero J, Teixeira AR. Genetic epidemiology of seropositivity for Trypanosoma cruzi infection in rural Goias, Brazil. Am J Trop Med Hyg 1997; 57: 538–543. 7 Trischmann TM, Bloom BR. Genetics of murine resistance to Trypanosoma cruzi. Infect Immun 1982; 35: 546–551. 8 Wrightsman R, Krassner S, Watson J. Genetic control of responses to Trypanosoma cruzi in mice: multiple genes influencing parasitemia and survival. Infect Immun 1982; 36: 637–644. 9 Wrightsman RA, Krassner SM, Watson JD, Manning JE. Role of the H-2s haplotype in survival of mice after infection with Trypanosoma cruzi. Infect Immun 1984; 44: 351–354. 10 Silva JS, Twardzik DR, Reed SG. Regulation of Trypanosoma cruzi infections in vitro and in vivo by transforming growth factor beta (TGF-beta). J Exp Med 1991; 174: 539–545.


325 11 Silva JS et al. Interleukin 10 and interferon gamma regulation of experimental Trypanosoma cruzi infection. J Exp Med 1992; 175: 169–174. 12 Hoff R. A method for counting and concentrating living Trypanosoma cruzi in blood lysed with ammonium chloride. J Parasitol 1974; 60: 527–528. 13 Pahl A, Kuhlbrandt U, Brune K, Rollinghoff M, Gessner A. Quantitative detection of Borrelia burgdorferi by real-time PCR. J Clin Microbiol 1999; 37, 1958–1963. 14 Bustin SA. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 2000; 25, 169–193. 15 Lander ES et al. MAPMAKER: an interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1987; 1: 174–181. 16 Lander E, Kruglyak L. Genetic dissection of complex traits: guidelines for interpreting and reporting linkage results. Nat Genet 1995; 11: 241–247. 17 Kemp SJ, Iraqi F, Darvasi A, Soller M, Teale AJ. Localization of genes controlling resistance to trypanosomiasis in mice. Nat Genet 1997; 16: 194–196.

18 Iraqi F et al. Fine mapping of trypanosomiasis resistance loci in murine advanced intercross lines. Mamm Genome 2000; 11: 645–648. 19 Dos Reis GA. Cell-mediated immunity in experimental Trypanosom cruzi infection. Parasitology Today 1997; 13: 335–342. 20 Tabel H, Kaushik RS, Uzonna JE. Susceptibility and resistance to Trypanosoma congolense infections. Microbes Infect 2000; 2: 1619–1629. 21 Roberts LJ, Baldwin TM, Curtis JM, Handman E, Foote SJ. Resistance to Leishmania major is linked to the H2 region on chromosome 17 and to chromosome 9. J Exp Med 1997; 185: 1705–1710. 22 Brown CR et al. Definitive identification of a gene that confers resistance against Toxoplasma cyst burden and encephalitis. Immunology 1995; 85: 419–428. 23 McLeod R, Skamene E, Brown CR, Eisenhauer PB, Mack DG. Genetic regulation of early survival and cyst number after peroral Toxoplasma gondii infection of A B/B A recombinant inbred and B10 congenic mice. J Immunol 1989; 143: 3031–3034.

Genes and Immunity