Mutant Ribosomes Can GenerateDominant Kirromycin Resistance

JOURNAL OF BACTERIOLOGY, June 1991,

Vol. 173, No. 12

p. 3635-3643

0021-9193/91/123635-09$02.00/0 Copyright © 1991, American Society for Microbiology

Mutant Ribosomes Can Generate Dominant Kirromycin Resistance IOANNIS TUBULEKAS,1 RICHARD H. BUCKINGHAM,2 AND DIARMAID HUGHES'* Department of Molecular Biology, Box 590, The Biomedical Center, S-751 24 Uppsala, Sweden,' and Unite Recherche Associee 1139 du Centre National de la Recherche Scientifique, Institut de Biologie Physico-Chimique, 75005 Paris, France2 Received 26 October 1990/Accepted 25 March 1991

Mutations in the two genes for EF-Tu in Salmonella typhimurium and Escherichia coli, tufA and tufB, can confer resistance to the antibiotic kirromycin. Kirromycin resistance is a recessive phenotype expressed when both tuf genes are mutant. We describe a new kirromycin-resistant phenotype dominant to the effect of wild-type EF-Tu. Strains carrying a single kirromycin-resistant tuf mutation and an error-restrictive, streptomycin-resistant rpsL mutation are resistant to high levels of kirromycin, even when the other tuf gene is wild type. This phenotype is dependent on error-restrictive mutations and is not expressed with nonrestrictive streptomycin-resistant mutations. Kirromycin resistance is also expressed at a low level in the absence of any mutant EF-Tu. These novel phenotypes exist as a result of differences in the interactions of mutant and wild-type EF-Tu with the mutant ribosomes. The restrictive ribosomes have a relatively poor interaction with wild-type EF-Tu and are thus more easily saturated with mutant kirromycin-resistant EF-Tu. In addition, the mutant ribosomes are inherently kirromycin resistant and support a significantly faster EF-Tu cycle time in the presence of the antibiotic than do wild-type ribosomes. A second phenotype associated with combinations of rpsL and error-prone tuf mutations is a reduction in the level of resistance to streptomycin.

The antibiotic kirromycin (mocimycin) blocks translation in bacteria by inhibiting the release of EF-Tu from the ribosome after GTP hydrolysis (29). In many bacteria, including Escherichia coli and Salmonella typhimurium, there are two separate genes encoding EF-Tu, tufA and tufB. Mutations conferring resistance to kirromycin map in the tuf genes (12, 26). Kirromycin resistance is a recessive phenotype and is expressed when both tuf genes are mutant. Thus, cells with mixed populations of mutant and wild-type EF-Tu are sensitive to the antibiotic, presumably because the ribosomes are blocked by the wild-type EF-Tu. Resistance to the antibiotic streptomycin can be conferred by mutations in ribosomal protein or rRNA. High-level resistance is conferred by mutations in the ribosomal protein gene rpsL (4, 19). The structural basis for resistance or sensitivity to streptomycin is unknown. Some rpsL mutations result in streptomycin-resistant ribosomes which restrict the level of translational errors (6, 10). Error restriction is associated with an increased proofreading of the EFTu tRNA ternary complexes by the mutant ribosomes (5). We selected an error-restrictive kirromycin-resistant mutant strain in the expectation that it would harbor a novel tuf mutation. Surprisingly, we found that the phenotype is conferred by the combined effects of separate mutations in the ribosome and one of the tuf genes. Here we describe the origins of this complex phenotype. MATERIALS AND METHODS

Bacterial and phage strains. The bacterial strains used are listed in Table 1. S. typhimurium strains were derivatives of LT2. All transductions in S. typhimurium were made with P22 HT105/1 int-201 (21). The strain TH139 (trpE91 tufA8 hisA&644 zee-1::TnlO) was transduced with phage grown on hisG3720, selecting for growth on histidinol and screening for tetracycline sensitivity, to make TH488. The tufA8 *

Corresponding author.

mutation suppresses both trpE9l and hisG3720 (15) such that 1-mm colonies appear on M9 medium plus histidine or tryptophan as appropriate, after 4 or 3 days, respectively, at 37°C. TH488 was used in selections for kirromycin-resistant strains. These strains were expected to be the result of new mutations arising in the tufB gene. The strain TH500 was chosen for analysis because it is kirromycin resistant but no longer suppresses the his or trp mutations. The S. typhimurium mutations rpsL105, -106, -107, -115, -116, -117, and -118 were isolated in this laboratory, by a project student, Anda Hansen, as spontaneous, high-level streptomycin-resistant mutations mapping in the rpsL region. These have been characterized with respect to nonsense suppression and growth rate and are shown by plasmid complementation and DNA sequencing to be rpsL mutations (this work). The mutations rpsL105 and 118 are nonrestrictive, while all of the others are restrictive (23a). The tetracycline-resistant markers used for mapping, argHl823: :TnlO, zii-614: :TnlO, zhb-736::TnlO, are from the collection of John Roth, University of Utah. The JT strains used in this study were all derived from TH329 or TH332 by appropriate cotransductions of rpsL and tuf alleles with the TnlO markers above. The marker argHl823::TnlO was routinely removed from strains by subsequently selecting transductants for arginine prototrophy. The E. coli strains used were derived from the prototrophic wild-type K-12 strain MG1655 (3). Transductions in E. coli were with P1 virA phage (17). Characterized streptomycin-resistant rpsL mutations (rpsL222, -224, and -226) originally isolated by Gorini et al. (5, 6, 10) were transduced into a derivative of MG1655, US428 (aroE zhd-126::TnlO), by selecting for prototrophy and screening for tetracycline sensitivity and streptomycin resistance. Media. Liquid and solid media were rich LB and minimal M9 media as described previously (13, 17). Kirromycinresistant mutants were selected and checked on LC plates (27) containing 2 mM EDTA (pH 8.0). Media contained, as appropriate, tetracycline (15 ,ug/ml), kanamycin (50 pug/ml), streptomycin (100 ,ug/ml), or mocimycin (kirromycin) (100 3635

3636

TUBULEKAS ET AL.

Strain

TABLE 1. Bacterial strains used Genotype

Salmonella typhimurium TH193 ................. TH194 ................. TH195 ................. TH196 ................. TH329 ................. TH332 ................. TH381 ................. TH488 ................. TH500 ................. TH626 .................

trpE91 trpE9J tufA8 tufB103 trpE9J tufA8 trpE9J tufB103 trpE91proBAl trpE91tufA8 proBA4 trpE91tufA300::MudJ trpE91hisG3720 tufA8 trpE91hisG3720 tufA8 rpsL500 trpE91tuJB103 zhb-736::TnlOfusA2 TH706 .trpE9 tufB103 zhb-736::TnlO rpsL105 TH718 ................. trpE91zhb-736::TnlO rpsL500 tufA300: :MudJ JT806 .trpE91proBA4 zhb-736::TnlO rpsL500

tufA8 JT855 .trpE9 proBAl zhb-736::TnlO rpsL500 JT884 ................. trpE91proBA4 tufA8 tufB103 JT940 .trpE9 proBAl zhb-736: :TnlO rpsL500 tufB103 JT947 ................. trpE91proBAl zhb-736::TnlO rpsL105 JT948 ................. trpE9l proBAl zhb-736::TnlO rpsL106 JT949 ................. trpE9J proBAl zhb-736: :TnlO rpsL116 JT953 ................. trpE91proBAl zhb-736: :TnlO rpsL106

tu.fB103

JT954 .................

trpE9l proBA/zhb-736::TnlO rpsL116

JT987 .................

trpE91proBA4 zhb-736::TnlO rpsL106

JT988 .................

trpE91proBA4 zhb-736::TnlO rpsL116

JT998 .................

trpE9l proBAl zhb-736: :TnlO rpsLI05

tufB103 tufA8

tufA8

tufB103 Escherichia coli US428 ......aroE zhd-126::TnlO

,ug/ml). Mocimycin (kirromycin) was a gift from Gist-brocades nv. Delft, The Netherlands. Antibiotic resistance assays. Three different measures of antibiotic resistance were used. (i) The MIC of kirromycin or streptomycin required to prevent growth of the strains studied was estimated as follows. From an overnight liquid culture of the strain (grown in LB medium for streptomycin measurements or in LC for kirromycin measurements), 5 was inoculated into 1-ml aliquots of fresh media containing various amounts of the antibiotic. These tubes were shaken overnight at 37°C (streptomycin) or 30°C in the dark (kirromycin), and the optical densities were measured next day. (ii) Growth on solid media containing antibiotic was assessed by counting the number of days required for strains to grow to 1-mm-diameter colonies in the presence of either kirromycin or streptomycin. (iii) The level of antibiotic (streptomycin) causing a 50% reduction in exponential growth rate was measured by inoculating overnight cultures into flasks of fresh LB medium containing various amounts of the antibiotic and measuring growth rate by following the increase in optical density. PCR amplification and DNA sequencing. Total chromosomal DNA from S. typhimurium strains carrying wild-type or mutant rpsL genes (rpsL105, -106, -107, -115, -116, -117, -118, and -500) was prepared by the method of Gay (11). Single-stranded DNA for sequencing was prepared by asymmetric polymerase chain reaction (PCR) amplification by using oligonucleotides homologous to sequences flanking rpsL (15a). The oligonucleotides used were upstream 187

J. BACTERIOL.

(CGTTGTATATTTCTTGACACC) and downstream 785 (TACGCTGACCAATGACGCGA). Symmetric PCR reaction mixtures (50 ,ul containing 400 ng of each primer) were subjected to 30 cycles of 1 min at 93°C, 1 min at 62°C, and 1 min at 72°C on a Perkin Elmer Cetus thermal cycler. Asymmetric reaction mixtures (50 ,u) were seeded with 4 RIl of the symmetric reaction product, to which were added 10 ng of the limiting primer and 400 ng of the other primer, and run as described above except that the extension time at 72°C was 2 min. Asymmetric PCR products were purified by four rounds of centrifugation through Centricon 30 filters and sequenced by using T7 DNA polymerase (Pharmacia) and the appropriate opposite oligonucleotide. In vitro translation assays. EF-Tu was purified by the method of Leberman et al. (16) with some modifications (14). Ribosomes, other factors, components, and chemicals were purified or prepared as described by Ehrenberg et al. (9). Translation assays were carried out according to the principles and methods described by Ehrenberg et al. (9) except as noted below. Amounts of components used in translation assays are given as picomoles per 100-pul volume of reaction mixture. The R-factor (kcatlKm) of the interaction between EF-Tu and ribosome species was determined by measuring the rate of translation of poly(U) as a function of the concentration of EF-Tu (titrated from 20 to 600 pmol). The translation cocktail contained 10 pmol of active ribosomes and an excess of all other components to achieve maximal elongation rate. Reaction times were from 4 to 20 s (wild-type ribosomes) or 4 to 35 s (mutant rpsLSOO ribosomes) to give precipitable poly(Phe) chains of 15 to 24 amino acids. The EF-Tu cycle time on the ribosome was determined by measuring the rate of protein synthesis in an EF-Tu-limited system. This was achieved by holding the amount of EF-Tu at 10 pmol while titrating the concentration of active ribosomes from 35 to 600 pmol. The amount of poly(U) chains (approximately 2,400 pmol) exceeded that of total ribosomes. The amounts of EF-Ts (1,000 pmol), tRNAPhe (1,000 pmol), Phe synthetase (150 U), and EF-G (150 pmol) were large enough to make the elongation rate independent of the translocation and ternary complex formation time. Reaction times were from 15 to 70 s for wild-type ribosomes and from 25 to 100 s for the mutant rpsLSOO ribosomes. The EF-Tu cycle time in the presence of kirromycin was measured as described above with the following differences: kirromycin (added to the factor mix) was present at a final antibiotic concentration of 2 puM, ribosomes were titrated over the range of 30 to 320 pmol, EF-Tu was present at 30 pmol, and EF-G was present at 20 pmol. Incubation times were from 8 to 20 min for the wild-type ribosomes and 4 to 10 min for the mutant rpsL500 ribosomes. The rate of translation supported by wild-type and mutant rpsLS00 ribosomes was measured as a function of kirromycin concentration. Reaction conditions were the same as for a standard translation "burst" (9) except that the antibiotic kirromycin was added to the factor mix to give a final concentration of 0 to 8 puM. To get precipitable poly(Phe) chains, incubation times were from 4 s to 40 min for wild-type ribosomes and from 4 s to 10 min for the mutant rpsL500 ribosomes. RESULTS Mutations in each of the tuf genes in S. typhimurium can generate error-prone and kirromycin-resistant species of EF-Tu (12-15). We are interested in studying EF-Tu species

VOL. 173,

1991

with other phenotypes to learn more about the function of EF-Tu in translation. For one approach, we selected kirromycin-resistant mutants and screened them to identify those that also restrict translation errors. The starting strain for this selection is TH488 trpE9J (-1 frameshift) hisG3720 (UGA) tufA8. Translational errors generated by tufA8 allow this strain to grow slowly in the absence of either tryptophan or histidine (15). Selection of an error-restrictive, kirromycin-resistant strain. TH488 was grown overnight in LB medium and plated on LC kirromycin plates at 30°C to select spontaneous kirromycin-resistant mutants. Two hundred mutants were purified and subsequently tested for the continued ability to suppress the trp and his mutations. Among these isolates were two which showed no growth in the absence of either amino acid but essentially unimpaired growth in their presence. One of these isolates, designated TH500, is analyzed here. Mapping results and the similarity of the restrictive phenotypes suggest that the other isolate, TH501, probably carries an identical mutation. TH500 was expected to carry both the tufA8 mutation and a new tufB mutation. To confirm this, transductions were made by using argH1823::TnJO and zii-614::TnlO, both of which are linked to tufB (14). Surprisingly, neither the kirromycin resistance phenotype nor the error-restrictive phenotype was affected in any of the transductants, indicating that the mutation did not map in tufB. We considered the possibility that the new phenotype might be caused by a second mutation within the tufA gene and, therefore, we carried out transductions in this region. TH500 was transduced with phage grown on zhb-736: :TnJO (closely linked to tufA) (12), selecting for tetracycline resistance and screening for kirromycin resistance and suppression. We distinguished three classes of transductants among 200 tested. As expected, kirromycin resistance was lost in a portion of the transductants (because the tufA+ gene is linked to the TnJO). In addition, the restrictive phenotype was lost in a portion of the transductants. This shows that the new mutation causing restriction in TH500 maps in this region (i.e., close to tufA8). Surprisingly, however, the two phenotypes, kirromycin resistance and error restriction, are easily separated, suggesting the possibility that they map in different, although linked, genes. The transduction analysis suggested that the new mutation (termed * at this point) maps between zhb-736: :TnJO and tufA8. In E. coli, this region contains the str operon (rpsL-rpsG-fusA-tufA). Although the data are incomplete, the genes and their order are identical in S.

typhimurium (14, 15a).

To determine more precisely the positions of tufA and * relative to each other, we mapped them relative to the recently isolated fusidic acid-resistant mutation, fusA2 (14). Phage grown on TH626 (carrying zhb-736::TnJO linked to fusA2) was used to transduce TH500, selecting for tetracycline resistance and screening for fusidic acid resistance, kirromycin resistance, and restriction or suppression. One hundred transductants were tested, and the results were interpreted to show the linkage order zhb-736::TnJO-*fusA2-tufA8. The importance of this result is that it shows that the restriction is not due to a second mutation within the tufA gene but rather to a mutation in a separate but closely linked gene. Furthermore, these results show that the restrictive * mutation maps between zhb-736::TnJO and fusA, i.e., within the region where rpsL maps. rpsL and the restrictive mutation are very closely linked. The * mutation was mapped relative to rpsL by transducing TH500 with phage grown on TH706 (carrying zhb-736: :TnJO

KIRROMYCIN-RESISTANT RIBOSOME MUTANTS

Tn1O rpsLIOS

s

a

0

*1's

3637

Donor

Recipient tuWAS

rpsL500 Class/Phenotype 1. TettR

Kir R

StrS

2. T e tR R 3. Tet

KirS

StrR Suppression R Str No suppression (leaky)

4.

Kir S

Teo? KirS

Str

Restrictive

(non-leaky)

Restrictive (non-leaky)

42 29 27 2

FIG. 1. Transduction mapping of * (rpsLS00) relative to rpsL105. Suppression by tufA8 of trpE9J or hisG3720 supports growth of 1-mm-diameter colonies after 4 or 3 days, respectively, on media lacking tryptophan or histidine as appropriate. The frameshift mutation trpE91 is intrinsically leaky at a low level, and in suppressorfree strains some growth is visible in the absence of tryptophan after 1 week. Strains with the restrictive phenotype of rpsLS00 display no growth at all after 1 week in the absence of tryptophan or histidine.

and the linked rpsL105). rpsL105 is a nonrestrictive streptomycin-resistant mutation isolated in this laboratory (see Materials and Methods). Fifty tetracycline-resistant transductants were purified and screened for streptomycin resistance, kirromycin resistance, and restriction or suppression. The transduction data and a derived linkage map are shown in Fig. 1. In 42% of the transductants, recombination occurred between the TnWO and rpsL (class 1, those which retain kirromycin resistance and error restriction but do not acquire streptomycin resistance). In 29% of the transductants, recombination occurred between rpsL and tufA (class 2, those which acquire streptomycin resistance, lose dominant kirromycin resistance, and regain tufA8-mediated suppression). In the third major class (27%), recombination occurred beyond the tufA gene; these recombinants acquired streptomycin resistance, lost dominant kirromycin resistance, and also lost tufA8-mediated suppression. In this third class, a low level of leakiness typical of the trpE9J mutation remained. This intrinsic leakiness of trpE9J allowed us to distinguish a fourth class of transductants (2%) which we interpret to be the result of a double crossover event. In this class, the restrictive phenotype was retained (trpE91 leakiness was abolished), but the dominant kirromycin resistance was lost (tufA8 is replaced by tufA+). Surprisingly, this class was streptomycin resistant. These results suggest that * and rpsL are closely linked, possibly within the same gene. In addition, they suggest that * has the potential to express a streptomycin resistance phenotype. The restrictive mutation is streptomycin resistant. To test the possibility that * is potentially streptomycin resistant, we constructed a strain carrying '*' but lacking tufA8. Phage grown on TH685 (carrying zhb-736::TnlO-*-tufA8) was used to transduce TH381 (tufA300::MudJ) selecting for tetracycline resistance. Transductants were screened for kanamycin resistance, which signals the presence of tufA300::MudJ. These transductants lose kirromycin resistance and are expected to simultaneously gain the * mutation at a high frequency because it maps between the TnWO and the tufA gene. Most transductants were slow growing on LB and M9

3638

TUBULEKAS ET AL.

J. BACTERIOL.

TABLE 2. Sequence alterations of S. typhimurium rpsL mutationsa Allele

Site 42

Site 53

Wild type rpsL500 rpsL105 rpsL106 rpsL107 rpsL115 rpsL116 rpsL 117 rpsL118

AAA(Lys)

CGT(Arg) CTT(Leu)

AGA(Arg) ACA(Thr) ACA(Thr) AAC(Asn) AAC(Asn) AAC(Asn) AGA(Arg)

a The mutant base is boldfaced in each case. The E. coli mutants we tested are the following: rpsL222, restrictive, Lys-42 to Thr; rpsL224, semirestric-

tive, Lys-87 to Arg; rpsL226, nonrestrictive, Lys42 to Arg (5, 6, 10).

medium plates, indicating the presence of the restrictive * mutation. All of these transductants were streptomycin resistant. We concluded that * is a restrictive streptomycinresistant mutation mapping close to rpsL and is thus probably an allele of rpsL. The restrictive mutation is an allele of rpsL. Plasmid complementation experiments were made by using pNO1523 (7) which carries an active wild-type rpsL gene from E. coli. When transformed into an E. coli strain with a chromosomal rpsL mutation conferring streptomycin resistance, this plasmid causes the strain to be sensitive to streptomycin. We transformed this plasmid into S. typhimurium and subsequently transduced it into the streptomycin-resistant transductants isolated in the previous section, selecting for ampicillin resistance. In each case, this results in the loss of the streptomycin-resistant phenotype which could be restored by subsequent loss of the plasmid. This phenotypic complementation shows that the restrictive mutation we are studying is an allele of rpsL, now designated rpsLSOO. Similarly, we transduced the rpsL plasmid into strains carrying other streptomycin-resistant mutations isolated in this laboratory (see Materials and Methods) and showed that each of these is also an allele of rpsL. DNA sequence alterations of the rpsL mutations. Chromosomal DNA prepared by the method of Gay (11) from strains carrying wild-type and each of the mutant rpsL genes was PCR amplified by using the oligonucleotides 187 and 785 (see Materials and Methods). The asymmetric PCR products were sequenced, and a single mutation was identified in each case. The wild-type DNA sequence of rpsL from S. typhimurium is 98% similar to the equivalent E. coli sequence, and at the amino acid level the predicted sequence is identical (15a). The seven mutants isolated by selecting for streptomycin resistance have one of three base substitutions affecting amino acid 42 (Table 2), converting Lys to Arg, Thr, or Asn. Each of these mutations has previously been identified in E. coli rpsL (6, 10). The rpsLSOO mutation isolated in the selection for kirromycin resistance is a novel mutation converting amino acid 53 from Arg to Leu. Conditional streptomycin and kirromycin resistance. The data presented above suggest that the mutation rpsLS00, which in combination with tufA8 confers dominant kirromycin resistance, is also a streptomycin resistance mutation. However, a streptomycin-resistant phenotype was not observed in the original experiments with the TH500 strain. We examined the phenotypes of a set of eight strains made during this study which contained various combinations of the relevant mutant and wild-type alleles. The tentative

conclusion we drew is that rpsLS00 is streptomycin resistant only in the absence of tufA8. We made a series of strain constructions to systematically investigate this phenomenon. The strains TH193 (tufA+ tufB+), TH194 (tufA8 tufB103), TH195 (tufA8 tufB+), and TH196 (tufA+ tuJB103) were each transduced with phage grown on TH718 (zhb-736::TnJOrpsLSOO-tufA300::MudJ), and tetracycline-resistant transductants were selected. In each case, three major classes of transductants were expected (class 1, those that receive only TnJO; class 2, those that receive TnJO and rpsLSOO; class 3, those that receive all three donor mutations). In the tufA+ tufB+ strain, TH193, all of the rpsL500 transductants are streptomycin resistant and no transductants are kirromycin resistant (some were weakly resistant; see below). In the tufA8 tufB103 background (TH194), only the kanamycinresistant transductants are streptomycin resistant. Thus, streptomycin resistance is not expressed in the presence of tufA8. All transductants in this background are kirromycin resistant. In the tufA8 tufB+ background (TH195), we again noted that dominant kirromycin resistance is expressed in the presence of both rpsLS00 and tufA8, but that streptomycin resistance depends on the absence of tufA8. Finally, in the tufA+ tufB103 background (TH196), we noted that the combination of rpsLS00 and tufB103 also confers dominant kirromycin resistance and furthermore that tufB103 does not abolish streptomycin resistance. There are several conclusions we can draw from these results. Firstly, combinations of rpsLS00 and either tufA8 or tuJBJ03 have a dominant kirromycin resistance phenotype. Secondly, rpsLS00 alone is not strongly kirromycin resistant. Thirdly, rpsLS00 is a streptomycin-resistant mutation, but this phenotype is abolished or weakened in the presence of tufA8. Finally, the tuB 103 mutation does not abolish the streptomycin-resistant phenotype of rpsLS00, at least on these solid media. Dominant kirromycin resistance with other rpsL mutations. The results presented above describe a mutation, rpsLS00, initially selected as conferring kirromycin resistance and subsequently shown to be streptomycin resistant. To test the generality of this result, we asked whether mutations selected as streptomycin resistant, i.e., normal rpsL mutations, could also confer dominant kirromycin resistance in the presence of tufA8 and tufBl03. A set of streptomycinresistant rpsL mutations isolated in this laboratory (see Materials and Methods), including both nonrestrictive and restrictive mutants, were transduced into TH195 and TH196 selecting for a linked zhb-736::TnlO. The tetracycline-resistant transductants were tested for streptomycin resistance and for kirromycin resistance. The striking result of this experiment is that each of the five restrictive rpsL mutations confers dominant kirromycin resistance in the presence of either tufA8 or tuJB103. However, the two nonrestrictive rpsL mutations tested do not confer a kirromycin resistance phenotype. This result confirms and extends the conclusions drawn from the experiments with rpsLS00 (a restrictive mutation) by showing that this phenotype is associated with a particular type of rpsL mutation. The reduced streptomycin resistance on plates (100 ,ug/ml) noted for the combination rpsLS00 with tufA8 is not repeated with any of these rpsL mutations. High-level kirromycin resistance of rpsL tuf combinations. Our experiments have revealed novel drug resistance phenotypes associated with specific combinations of rpsL and tuf mutations. We have expressed these results in terms of growth or lack of growth on agar plates containing standard concentrations of the appropriate antibiotic (100 ,ug of kir-

VOL. 173, 1991


TABLE 3. Kirromycin resistance of strains with various rpsL and tuf alleles Strain

Relevant markers

Colony growth

TH329 TH332 JT855 JT806 JT891 JT884c

Wild type tufA8 rpsLS00 rpsLS00, tufA8 rpsLS00, tufB103 tufA8, tufB103

-

LC Kir Agar'

+ ++ ++ +++

on

L Liquid

MICb

125 175 425 1,200 1,200 >3,000

a LC Kir agar plates contained 100 ,ug of kirromycin per ml. Symbols: +++, ++, +, colony growth to 1-mm diameter after 1, 2, or 3 to 5 days of incubation, respectively; -, no growth even after 7 days. b Details of the MIC assay are given in Materials and Methods. c JT884 grows in the presence of 3 mg of kirromycin per ml but was not tested at higher levels.

romycin or streptomycin per ml). It is of interest to determine whether the level of kirromycin resistance associated with mutations in both tuf genes is significantly different from that conferred by a combination of rpsL and tuf mutations while one tuf gene remains wild type. Thus, we determined the ability of our strains to grow in liquid media containing various levels of antibiotic (see Materials and Methods for details of the MIC assay). The results (Table 3) show the level of kirromycin resistance both on solid media and as measured in an MIC assay. Thus, the tuf wild-type strain (and strains with only one wild-type tuf gene and the other resistant), has a kirromycin MIC of less than 125 p,g/ml (slightly higher when one tuf gene is mutant). Strains carrying one resistant tuf mutation in combination with a restrictive rpsL mutation have a kirromycin MIC of greater than 1 mg/ml. The strain with both tuf genes mutant is resistant to at least 3 mg/ml (we have not determined the upper limit). We conclude that the kirromycin resistance conferred by a combination of a restrictive rpsL mutation and a single tuf mutation is a high-level resistance. In addition, we note that a restrictive rpsL mutation alone (in the presence of two wild-type tuf genes) has a kirromycin MIC of approximately 425 ,ug/ml and supports slow growth on solid kirromycin media. We also tested the set of rpsL mutations isolated as streptomycin resistant (rpsL105, -106, -107, -115, -116, -117, and -118) alone and in combination with tuf mutations, with similar results. A new result we obtained from these experiments was confirmation of our expectation that the nonrestrictive rpsL mutations are sensitive to kirromycin. Genotype influences rpsL500 streptomycin resistance level. We measured the influence of strain genotype on streptomycin resistance. We have noted earlier that, on agar plates, the combination rpsLS00 tufA8 is unique in being phenotypically streptomycin sensitive. In Table 4, we give the results of other assays of streptomycin resistance (i.e., MIC and 50% inhibition of growth rate in liquid media) for a set of strains with relevant combinations of rpsL and tuf alleles. There are two striking results of these experiments. Firstly, the mutation rpsLS00 causes resistance to streptomycin as measured in each assay, but the additional presence of either tufA8 or tufjBl03 significantly reduces this level of resistance (which still remains above the wild-type level). It is notable that, in each of the assays, the reduction in resistance caused by tufA8 is slightly greater than that caused by tufB103. Thus, in our initial experiments, we used solid media which, by good fortune, allowed us to distinguish between the relative effect of each of the tuf mutations on the rpsLS00 streptomycin resistance phenotype. We also tested whether these error-

3639

TABLE 4. Streptomycin resistance of strains with combinations of various rpsL and tuf allelesa Relevant genotype

Strain Strain TH329 TH332 JT884

JT855 JT806 JT940 JT947 JT948 JT949 JT998 JT953 JT954 JT987 JT988

MIC (pLg/ml)

Wild type

tufA8

tufA8 tufB103 rpsLS00 rpsL500 tufA8 rpsL500 tufBI03 rpsL105 rpsL106 rpsLJ16 rpsLl05 tufBI03 rpsL106 tuJB103 rpsL116 tufB103 rpsL106 tufA8 rpsLI16 tufA8

a Details of the MIC values and

50% Inhibition concn

(pLg/ml)

250 150

10 NDb

100 900 275 350

ND 60 20 25

16,000 16,000 16,000 12,000 13,000 13,000 13,000 13,000

50%

inhibition concentration values of

growth assays are given in Materials and Methods. b ND, not done.

prone tuf mutations influenced the level of streptomycin resistance or sensitivity of other strains with mutant or wild-type ribosomes. The data in Table 4 show clearly that, in every case, the presence of the tuf mutations reduces the level of resistance to streptomycin. These experiments were also made with strains TH193 through TH196 with similar results, although in the background of these strains the absolute level of resistance to streptomycin as measured by MIC was lower. We conclude from these experiments that the level of ribosomally determined streptomycin resistance can be influenced by the tuf genotype. Kirromycin resistance phenotype of rpsL mutants in E. coli. We wished to examine whether the dominant kirromycin resistance phenotype is also expressed in strains of E. coli carrying mutations in tuf and rpsL. Previous studies in E. coli have not revealed this phenotype, either when strains by chance happened to carry such mutant combinations (28) or when the purpose of the study was to examine the phenotypes of such combinations (23). We transduced well-characterized streptomycin-resistant rpsL mutations (rpsL222, -224, and -226) into a clean genetic background (see Materials and Methods). Resistance was checked by testing for the ability to grow on solid media containing 100 p.g of kirromycin per ml. Strains carrying rpsL222 (restrictive) and rpsL224 (semirestrictive) are resistant to kirromycin in proportion to the degree of restriction (rpsL222 supports faster growth on kirromycin than rpsL224). The mutation rpsL226 is nonrestrictive and does not support growth in the presence of kirromycin. We attempted to make strains carrying combinations of these rpsL mutations and the characterized errorprone tufA mutation tufAr (28) to determine if such combinations displayed a further enhancement of kirromycin resistance, as seen in S. typhimurium. To our surprise, strain EV8 [A(lac pro) tufAr tufB+] displays a significant inherent level of resistance to kirromycin despite the tuJB gene being wild type. We tested tufAr taken from other strains (PM455, LBE2014, and LBE2021) with the same result, even when transduced into a clean genetic background (MG1655). The basis of this phenotype is currently unknown. Strains carrying combinations of each of the restrictive rpsL mutations and tufAr displayed a slightly increased resistance to kirromycin consistent with an additive contribution from each mutant allele (the nonrestrictive rpsL allele had no effect).

TUBULEKAS ET AL.

3640

10

J. BACTERIOL.

-

5 -

80 LA) -J

0 .T

6-

co

0

a)

4

3

a) 0.

> 4

2

-

.50 cc

2-

1

0

0,0

0,2

0,4

0,6

0,8

0 1,0

V/[TuJ x 10-7 (M-1 sec-1) FIG. 2. Translation kinetics of wild-type EF-Tu with wild-type (E) and mutant rpsLSOO (*) ribosomes. The assay of the interaction between EF-Tu and the ribosome was carried out as described in Materials and Methods and Results. V(sec-1) shows the extrapolated kcat for translation, while V/[Tu] shows the R-factor of the interaction between the EF-Tu complex and the ribosome.

The important conclusion we can draw from these results is that the phenotype of resistance to kirromycin caused by error-restrictive rpsL mutations is not unique to S. typhimurium but is also found in E. coli. Impaired interaction between EF-Tu and the ribosome. The data presented demonstrate that error-restrictive rpsL mutations, alone or in combination with a mixture of mutant and wild-type EF-Tu, cause a kirromycin-resistant phenotype. This result is unexpected because wild-type EF-Tu should prevent translation by blocking the ribosome in the presence of kirromycin (29). A possible explanation for this resistance is that the interaction between wild-type EF-Tu and the mutant ribosome is altered such that the kirromycininduced blocking of the ribosome is much weaker. Previous studies with E. coli demonstrate that error-restrictive rpsL mutations have a poor interaction with the EF-Tu tRNA complex (2, 5). We have determined the R-factor of the interaction in vitro between ribosomes and EF-Tu species isolated from relevant strains. Typical results are presented in Fig. 2. Wild-type ribosomes support translation with similar, "normal" kinetics with both wild-type and mutant (A8 B103) EF-Tu. In contrast, the mutant rpsLSOO ribosomes display very different translation kinetics depending on the nature of the EF-Tu species. The kinetics of rpsLSOO translation with the mutant (A8 B103) EF-Tu are "normal." However, when rpsLSOO ribosomes use wild-type EF-Tu for translation, the R-factor is greatly reduced (by more than 50%), showing that these particular ribosome and EF-Tu species have a relatively poor interaction. This suggests that the mutant ribosomes may effectively discriminate between mutant and wild-type EF-Tu species, preferentially translating with the kirromycin-resistant species. Translation rate in the presence of kirromycin. The results of the R-factor experiments described above suggest that, in the presence of a mixed mutant and wild-type EF-Tu population, rpsLSOO ribosomes will interact more efficiently with, and thus preferentially translate with, the kirromycin-resistant EF-Tu. This helps to explain why such strains should be more resistant to kirromycin. However, our in vivo data also show that strains carrying error-restrictive ribosomes are

2

4 6 Kirromycin (gM)

8

10

FIG. 3. Translation rate in the presence of kirromycin. The ratio of the rates of translation supported by wild-type ribosomes and mutant rpsLSOO ribosomes (with wild-type EF-Tu) is plotted as a function of increasing concentrations of kirromycin.

kirromycin resistant even in the complete absence of mutant EF-Tu. We investigated this in vitro by measuring the rate of translation supported by wild-type and rpsLSOO ribosomes, using wild-type EF-Tu, in the presence of different concentrations of kirromycin. The results (Fig. 3) are expressed as the ratio of translation rates (rpsLSOOIwild type) at increasing kirromycin concentrations. If both ribosomes react in the same way to kirromycin, the slope should be zero (this is what is expected if the only determinant of kirromycin resistance is EF-Tu). In fact, the data show that, in the presence of kirromycin, the mutant rpsLSOO ribosomes translate at a significantly faster rate than do the wild-type ribosomes. Thus, these results show that mutant rpsLSOO ribosomes are intrinsically more resistant to the inhibitory effects of kirromycin on translational elongation than are wild-type ribosomes. EF-Tu cycle time on the ribosome. We have shown that, on the basis of translation rates in the presence of kirromycin, rpsLSOO ribosomes are intrinsically resistant to the antibiotic. We reasoned that a likely cause of this resistance is a reduced blocking of EF-Tu on the ribosome by kirromycin during translation. To investigate this, we measured the time taken for EF-Tu to complete its cycle through the ribosome, in both the presence and absence of kirromycin. In the absence of kirromycin, the maximum number of EF-Tu cycles per second (kcat) was the same with both wild-type and rpsLSOO ribosomes (Fig. 4a). As noted previously, there is a difference in the Km values of these interactions. In strong contrast, in the presence of the antibiotic kirromycin (Fig. 4b), the rpsLSOO ribosomes support a significantly faster EF-Tu cycle time than do the wild-type ribosomes. As a control on the specificity of these effects, we tested EF-G from S. typhimurium in translation with wild-type and rpsLSOO ribosomes. Both the kcat for elongation and the R-factor of the EF-G ribosome interaction were identical with mutant and wild-type ribosomes. This suggests that the rpsL mutant does not perturb the EF-G cycle. We conclude that resistance to kirromycin inherent in the rpsLSOO ribosomes is associated with an altered EF-Tu cycle on the ribosome.


VOL. 173, 1991

14 12

a -

3641

by van de Klundert (25). He noted that a cotransduction of tufAr with rpsL from a streptomycin-resistant strain con-

ferred kirromycin resistance on the recipient strain. Although van de Klundert provided no details, it seems likely 10 that his observation is an example of the same phenomenon we have explored here. The pattern which emerges from our a.) results is that all of the restrictive rpsL mutations tested cause resistance to kirromycin, whereas the nonrestrictive t64 rpsL alleles do not. Restrictive rpsL mutations were originally defined as restricting the translational error level, and this effect has been associated with an enhanced proofread4ing activity of these ribosomes (5). Strains carrying such 2mutations have slower growth and translational elongation \_______________________________ rates associated with a poor interaction between the EF0Tu tRNA complex and the ribosome (2). 2 0,4 0,6 0,8 1,0 1,2 1,4 1,6 0,0 S. typhimurium and E. coli carry two genes for EF-Tu, 012 and the previously described kirromycin-resistant mutations [Tu] [Ribosomes] x 10-7 (M-1 sec-1) required that both of these genes be mutated (either to 300 resistance or inactivity). If one of the two tuf genes of a strain is wild type, then the strain is still sensitive to kirromycin, presumably because there is sufficient wild-type EF-Tu in the cell to block the ribosome and inhibit translation and growth. The ribosomal mutations described here 200 overcome this sensitivity to kirromycin caused by a mixed E wild-type and resistant population of EF-Tu. These strains contain approximately 50% wild-type EF-Tu (14), yet a 0E single alteration to the ribosome is sufficient to prevent 100 kirromycin-induced blockage of the ribosome. Indeed, the initial selection that isolated rpsLSOO was for growth on El a * kirromycin plates with one wild-type tuf gene and one resistant tuf gene. We have also tested rpsLSOO and other ,____.___,____.___,___.____,___.__ rpsL mutations in strains where both tuf genes are wild type, and even in these cases growth is supported (although it is 660 10 0 202 3030 404 5050 slow). Active ribosomes (pmoles) The basis of the ribosomal kirromycin resistance phenotype was investigated by studying translational parameters FIG. 4. EF-Tu cycle time on the ribosome. (a) The number of in vitro with ribosomes isolated from an rpsLSOO strain. EF-Tu cycles per ssecond in the absence of kirromycin supported by Previous results (2, 5) have identified a poor interaction wild-type (E) or rniutant rpsLSOO (*) ribosomes. (b) The number of EF-Tu cycles per minute in the presence of 2 FLM kirromycin between restrictive rpsL ribosomes and EF-Tu. We find, likewise, that the R-factor for the interaction between musupported by wild -type (E) or mutant rpsLSOO (*) ribosomes. tant rpsLSOO ribosomes and wild-type EF-Tu is strongly reduced, in this case by more than 50%. In contrast, the DISCUSSION R-factor for mutant rpsLSOO ribosomes and kirromycinresistant EF-Tu is normal. This suggests that, when preThis report de-scribes ribosomal mutations whose phenosented with a mixed population of EF-Tu, the rpsLSOO ribosomes will preferentially use the kirromycin-resistant type permits the cell to overcome sensitivity to the antibiotic EF-Tu for translation, thus overcoming to some degree the kirromycin. Sewsitivity is caused by EF-Tu GDP remaining inhibitory effect of the antibiotic. on the ribosomie in complex with kirromycin after GTP The in vivo growth data show that rpsLSOO and other hydrolysis and tthus blocking further translation (29). Until restrictive rpsL mutations allowed strains with 100% wildnow, the only s trains described as resistant to kirromycin have carried mu tations in the genes coding for EF-Tu (12, type EF-Tu to grow on kirromycin plates. We found a similar pattern in vitro. When translation rates in the pres27). Our results support the view that it is the interactions between EF-Tu and the ribosome which are important in ence of kirromycin (and wild-type EF-Tu) are compared, the mutant rpsLSOO ribosomes are significantly faster than the determining kirriomycin sensitivity. Altering either the ribosome or EF-Tu by mutation can influence this level of wild-type ribosomes. This is evidence that the mutant ribosomes are inherently resistant to the effects of the antibiotic. sensitivity or resistance. The ribosomal mutations we have identified as causing We investigated the basis of this faster translation rate by looking in more detail at some of the steps which make up resistance to kirrromycin belong to a very well-studied group, the streptomycini-resistant rpsL mutations. We have isolated the total elongation cycle. In terms of time consumed, the one of these multations, rpsLSOO, in a selection for kirromyprincipal steps in translation are the EF-Tu and EF-G cycles. In contrast to our results with rpsLSOO ribosomes and EF-Tu cin resistance anid it was subsequently shown to be streptodescribed above, we found no alteration in the EF-G ribomycin resistant. The other rpsL mutations were originally isolated as strep tomycin resistant in either S. typhimurium some R-factor. Thus, we concentrated our attention on the or E. coli, and s Wome of these have been shown to influence EF-Tu cycle. The results showed that, in the presence of kirromycin, the mutant rpsLSOO ribosome supports an kirromycin sensoitivity. Since making our experiments, we have become aw'are of a previously unexplained observation EF-Tu cycle several times faster than that supported by the '

0

0.

-

3642

TUBULEKAS ET AL.

J. BACTERIOL.

wild-type ribosomes. We conclude that the basis of the inherent ribosomal resistance to kirromycin is in the reduced inhibition of the EF-Tu cycle time. In conclusion, we can say that we have identified two related mechanisms which together account for the ribosomally generated kirromycin resistance. One is the discrimination these ribosomes make between kirromycin-resistant and kirromycin-sensitive EF-Tu. The other is the reduced inhibition of the kirromycin-sensitive EF-Tu cycle. In addition to the main findings, we have noted other intriguing phenotypes associated with rpsLS00. The streptomycin resistance level of rpsLS00 is lower than that of the other rpsL mutations tested here (an MIC of 900 compared to 16,000 ,ug/ml). rpsLS00 represents a new allele, changing amino acid 53 from Arg to Leu. When we measured the ability to grow in the presence of streptomycin, we found that the presence of tuf mutations reduces the resistance level typical of rpsLS00. Indeed, we found that resistance to streptomycin is reduced in all strains tested (wild-type, nonrestrictive, or restrictive streptomycin-resistant ribosomes) by the presence of the error-prone tuf mutations. This is the first instance where tuf mutations have been shown to influence the streptomycin resistance phenotype. It has been shown in E. coli that the presence of ram mutations in the ribosomal proteins S4 and S5 also reduces resistance to streptomycin in all strains tested (1, 20). In an in vitro translation system, Spirin et al. (22) found that EF-Tu acted as an antagonist of the effects of tetracycline and streptomycin on the ribosome. Whether this is relevant to our results is unclear since we see that mutant EF-Tu increases sensitivity to streptomycin. These combinations of mutant tuf and rpsL alleles are potentially of great interest in helping us understand the structural basis of sensitivity or resistance to streptomycin and indeed the nature of the EF-Tu tRNA interaction with the ribosome. Each of the error-prone tuf mutations tested, tufA8 and tufB103 from S. typhimurium and tufAr from E. coli, causes the same alteration in EF-Tu, Ala-375 to Thr (8, 24). The rpsL mutations tested map at three sites, positions 42 and 53 in S. typhimurium and positions 42 and 87 in E. coli (5, 10; this work). The only nonrestrictive mutation identified is Lys to Arg at position 42 in both species (10, this work). The known restrictive mutations are Lys to Thr or Asn at position 42 in both species, Arg to Leu at position 53 in S. typhimurium, and Lys to Arg at position 87 in E. coli (this is semirestrictive rpsL224; see reference 5). Thus, error-restrictive mutations map at multiple positions and overlap with the nonrestrictive mutation. Interestingly, the nonrestrictive and semirestrictive mutations have the most conservative amino acid alterations. Our results provoke the question of whether the EF-Tu tRNA complex interacts directly with the S12 protein on the ribosome. Translation factor ribosome interactions have recently been reviewed (18). EF-G can be cross-linked to S12 and competes with EF-Tu for interaction with the same or overlapping sites on the ribosome. Immunoelectron microscopy maps the EF-Tu binding site on the ribosome as being close to L7/L12 on the large subunit and S3, S4, and S12 on the small subunit, but there is as yet no evidence that the EF-Tu or tertiary complex directly interacts with S12. Our data provide support for a strong functional interplay between S12 and the EF-Tu tRNA complex, but it is premature to make judgments on how direct this interaction might be. -

ACKNOWLEDGMENTS This work was supported by grants from the Swedish Natural Science Research Council to D. Hughes and to C. G. Kurland and from the Swedish Cancer Society to C. G. Kurland. R. H. Buckingham is supported by grants from the Centre National pour la Recherche Scientifique (URA1139), I'Association pour la Recherche sur le Cancer, the Fondation pour la Recherche Medicale, and E. I. du Pont de Nemours and Co. D. H. gratefully acknowledges the support of an EMBO ShortTerm Fellowship to work at the I.B.P.C. in Paris. We thank Mans Ehrenberg for his helpful advice on the in vitro translation experiments. REFERENCES 1. Ahmad, M. H., A. Rechenmacher, and A. Bock. 1980. Interaction between aminoglycoside uptake and ribosomal resistance mutations. Antimicrob. Agents Chemother. 18:798-806. 2. Andersson, D. I., H. W. van Verseveld, A. H. Stouthamer, and C. G. Kurland. 1986. Suboptimal growth with hyperaccurate ribosomes. Arch. Microbiol. 144:96-101. 3. Bachmann, B. J. 1987. Derivations and genotypes of some mutant derivatives of Escherichia coli K-12, p. 1190-1219. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology, vol. 2. American Society for Microbiology, Washington, D.C. 4. Birge, E. A., and C. G. Kurland. 1969. Altered ribosomal protein in streptomycin dependent Escherichia coli. Science 166:1282-1284. 5. Bohman, K., T. Ruusala, P. C. Jelenc, and C. G. Kurland. 1984. Kinetic impairment of restrictive streptomycin-resistant ribosomes. Mol. Gen. Genet. 198:90-99. 6. Breckenridge, L., and L. Gorini. 1970. Genetic analysis of streptomycin resistance in Escherichia coli. Genetics 65:9-25. 7. Dean, D. 1981. A plasmid cloning vector for the direct selection of strains carrying recombinant plasmids. Gene 15:99-102. 8. Duisterwinkel, F. J., J. M. De Graaf, B. Kraal, and L. Bosch. 1981. A kirromycin resistant elongation factor EF-Tu from Escherichia coli contains a threonine instead of an alanine residue in position 375. FEBS Lett. 131:89-93. 9. Ehrenberg, M., N. Bilgin, and C. G. Kurland. 1990. Design and use of a fast and accurate in vitro translation system, p. 101-129. In G. Spedding (ed.), Ribosomes and protein synthesis: a practical approach. Oxford University Press, New York. 10. Funatsu, G., and H. G. Wittmann. 1972. Localisation of amino acid replacements in protein S12 isolated from Escherichia coli mutants resistant to streptomycin. J. Mol. Biol. 68:547-550. 11. Gay, N. J. 1984. Construction and characterization of an Escherichia coli strain with a uncI mutation. J. Bacteriol. 158:820825. 12. Hughes, D. 1986. The isolation and mapping of EF-Tu mutations in Salmonella typhimurium. Mol. Gen. Genet. 202:108-111. 13. Hughes, D. 1987. Mutant forms of tufA and tuJB independently suppress nonsense mutations. J. Mol. Biol. 197:611-615. 14. Hughes, D. 1990. Both genes for EF-Tu in Salmonella typhimurium are individually dispensable for growth. J. Mol. Biol. 215:41-51. 15. Hughes, D., J. F. Atkins, and S. Thompson. 1987. Mutants of elongation factor Tu promote ribosomal frameshifting and nonsense readthrough. EMBO J. 6:4235-4239. 15a.Hughes, D., and R. H. Buckingham. Unpublished data. 16. Leberman, R., B. Antonsson, R. Giovanelli, R. Schumann, and A. Wittinghofer. 1980. A simplified procedure for the isolation of bacterial polypeptide elongation factor EF-Tu. Anal. Biochem. 104:29-36. 17. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 18. Moore, P. B., and M. S. Capel. 1988. Structure-function correlations in the small ribosomal subunit from Escherichia coli. Annu. Rev. Biophys. Biophys. Chem. 17:349-367. 19. Ozaki, M., S. Mizushima, and M. Nomura. 1969. Identification and functional characterization of the protein controlled by the streptomycin resistant locus in E. coli. Nature (London) 222:

VOL. 173, 1991 333-339. 20. Piepersberg, W., V. Noseda, and A. Bock. 1979. Bacterial ribosomes with two ambiguity mutations: effects on translational fidelity, on the response to aminoglycosides and on the rate of protein synthesis. Mol. Gen. Genet. 171:23-34. 21. Sanderson, K. E., and J. R. Roth. 1983. Linkage map of Salmonella typhimurium, edition VI. Microbiol. Rev. 47:421453. 22. Spirin, A. S., 0. E. Kostiashkiva, and J. Jonak. 1976. Contribution of the elongation factors to resistance of ribosomes against inhibitors: comparison of the inhibitor effects of the factordependent and factor-free translation systems. J. Mol. Biol. 101:553-562. 23. Tapio, S., and L. Isaksson. 1988. Antagonistic effects of mutant elongation factor Tu and ribosomal protein S12 on control of translational accuracy, suppression and cellular growth. Biochimie 70:273-281. 23a.Tubulekas, I., and D. Hughes. Unpublished data. 24. Tuohy, T. M. F., S. Thompson, R. F. Gesteland, D. Hughes, and


25.

26.

27.

28. 29.

3643

J. F. Atkins. 1990. The role of EF-Tu and other translation components in determining translocation step size. Biochim. Biophys. Acta 1050:274-278. van de Klundert, J. A. M. 1978. Ph.D. thesis, p. 66. University of Leiden, The Netherlands. van de Klundert, J. A. M., E. den Turk, A. H. Borman, P. H. van der Meide, and L. Bosch. 1977. Isolation and characterization of a mocimycin resistant mutant of Escherichia coli with an altered elongation factor EF-Tu. FEBS Lett. 81:303-307. van de Klundert, J. A. M., P. H. van der Meide, P. van de Putte, and L. Bosch. 1978. Mutants of Escherichia coli altered in both genes coding for the elongation factor Tu. Proc. Natl. Acad. Sci. USA 75:4470-4473. Vijgenboom, E., T. Vink, B. Kraal, and L. Bosch. 1985. Mutants of the elongation factor Tu, a new class of nonsense suppressors. EMBO J. 4:1049-1052. Wolf, H., G. Chinali, and A. Parmeggiani. 1977. Mechanism of the inhibition of protein synthesis by kirromycin. Eur. J. Biochem. 75:67-75.