J Mol Evol (2001) 52:361–371 DOI: 10.1007/s002390010166
© Springer-Verlag New York Inc. 2001
Mutation and Recombination in Cattle Satellite DNA: A Feedback Model for the Evolution of Satellite DNA Repeats Isaa¨c J. Nijman, Johannes A. Lenstra Department of Infectious Diseases and Immunology, Faculty of Veterinary Medicine, Utrecht University, Yalelaan 1, 3584 CL Utrecht, The Netherlands Received: 21 July 2000 / Accepted: 30 October 2000
Abstract. The cattle genome contains several distinct centromeric satellites with interrelated evolutionary histories. We compared these satellites in Bovini species that diverged 0.2 to about 5 Myr ago. Quantification of hybridization signals by phosphor imaging revealed a large variation in the relative amounts of the major satellites. In the genome of water buffalo this has led to the complete deletion of satellite III. Comparative sequencing and PCR-RFLP analysis of satellites IV, 1.711a, and 1.711b from the related Bos and Bison species revealed heterogeneities in 0.5 to 2% of the positions, again with variations in the relative amounts of sequence variants. Restriction patterns generated by double digestions suggested a recombination of sequence variants. Our results are compatible with a model of the life history of satellites during which homogeneity of interacting repeat units is both cause and consequence of the rapid turnover of satellite DNA. Initially, a positive feedback loop leads to a rapid saltatory amplification of homogeneous repeat units. In the second phase, mutations inhibit the interaction of repeat units and coexisting sequence variants amplify independently. Homogenization by the spreading of one of the variants is prevented by recombination and the satellite is eventually outcompeted by another, more homogeneous tandem repeat sequence. Key words: Satellite DNA — Concerted evolution — Cattle — Bovini
Correspondence to: Dr. J.A. Lenstra; e-mail:
[email protected]
Introduction The centromeric satellite DNA (stDNA) is organized as a complex of tandem repeats and is one of the most abundant components of most eukaryotic genomes (Charlesworth et al. 1994; Elder and Turner 1995). Satellites are generally considered as selfish DNA, although several hypotheses have been developed about their function (Csink and Henikoff 1998). For instance, a role of the human ␣ satellite in the functioning of the centromere has been proposed (Willard 1998; Koch 2000). However, any universal function does not depend on a conservation of the sequence, protein binding motives (Goldberg et al. 1996), or other structural features (Koch 2000) of the satellite DNA. Only closely related species share homologous satellites sequences (Jobse et al. 1995; Waye and Willard 1989), but by concerted evolution monomers are more similar to monomers of the same species than to monomers of other species. Previously, the evolution of the centromeric satellites of ox (Bos taurus) was analyzed by studying their occurrence in other ruminants (Jobse et al. 1995; Modi et al. 1996). The monomer of satellite I consists of degenerated 31-mer tandem subrepeats, which also has been found in the satellites I of sheep, goat (Novak 1984; Reisner and Bucholtz 1983), deer (Lee and Lin 1996), and pronghorn (Denome et al. 1994). Homologues of the minor satellite II have been found in sheep, goat (Buckland 1985), and deer species (Qureshi and Blake 1995). The repeat unit of satellite III consists of two related and homogeneous 23-mer tandem subrepeats (Pech et al. 1979), the Pvu and the Sau motives, respectively, which have been derived from the 31-mer subrepeat of satellite
362 Table 1.
Sequences of primers for the PCR amplification of cattle satellite sequencesa
Template
Reference(s)
Primer
Sequence
Positions
Satellite I
Plucienniczak et al. (1982)
Satellite II
Buckland (1985)
BovS15-L BovS15-R BovS23-L BovS23-R
GACTTCTCCTGAGGCGCTGT AACCCAGGGTTTCCTGCCTCA GTTGCACATCCAAGGGCTCC CCGGCAGAGCAGCCTCGC
1295–1314 601–581 169–150 340–360
Satellite III Pvu unit Sau unit Satellite IV
Pech et al. (1979), Jobse et al. (1995) BovS06-1 BovS06-2 BovS09-L
AATCAWGCAGCTCAGCAGGCART GATCACGTGACTGATCATGCACT AAGCTTGTGACAGATAGAACGAT
1–23
BovS09-R BovS09-L2 BovS09-R2 BovS09-R3 BovS11-L BovS11-R
CAAGCTGTCTAGAATTCAGGGA TTTACCTTAGAACAAACCGAGGCA CAAACGAGGGCTACGGAAAGGA CAATCCAGACAGACAAGACAAGAC ATGAGGAAGGAGGCTCGGCA TGATCCAGGGTATTCGAAGGA
BovS11a-L BovS11a-R BovS11b-L BovS11b-R BovS11b-L2 BovS11b-R2 Bov-L Bov-R BovB-L BovB-R
CTGTCAAAGAGYTAACTTACAGC GCTCCAGATGGAGACTCAGC CTGGGTGTGACAGTGTTTAAC CCAGAAGGTAAGAGAAAGAACG CAGAAGATGATGCAAATCACC CTTCACCAATACAATTTCTAATC CTCAGTCGTGTCCGACTCTT AATGGCAACCCACTCCAGTA GTCATGTATGGATGTGAGAGT TCAGGGTCTTTTCCAATGAGT
Satellites 1.711a/1.711b
Skowronski et al. (1984), Jobse et al. (1995)
Streeck (1981), Jobse et al. (1995)
Satellite 1.711a Satellite 1.711b
SINE Bov-tA/Bov-A2
Lenstra et al. (1993), Jobse et al. (1995)
SINE Bov B
Lenstra et al. (1993)
a
604–583 33–56 581–600 311–334 1–20/1–20 543–523/ 1023–1003 170–192 255–235 202–222 876–856 677–697 388–365 83–102/10–29 183–164/110–91 134–154 371–351
The positions refer to the numbering in Fig. 2 or the numbering of Genbank entries (see Jobse et al. 1995)
I (Jobse et al. 1975). Like satellite II, satellites IV has no resemblance to other satellites. Satellites 1.711a and 1.711b both arose by recombination. The monomer of satellite 1.711a consists of a segment from the satellite III monomer combined with a segment that is homologous to a segment from satellite 1.711b. However, in satellite 1.711b this segment is interrupted by a sequence unique for this satellite and combined with the monomer unit of satellite I (Streeck, 1981). Satellites III, IV, 1.711a, and 1.711b are not present in goat and sheep, while satellites IV, 1.711a, and 1.711b, but not satellite III, have homologues in the genome of water buffalo (Jobse et al. 1995). RFLP analysis of satellites III and 1.711b discriminated among ox, zebu (Bos indicus), and the taurindicine hybrids (Nijman et al. 1999), indicating that closely related species may possess different sequence variants of these satellites. Here we analyze the changes in amount and sequence of the satellites in the genomes of other species of the Bovini. Within this tribe, hybridization of Bos and Bison species yield viable offspring with, in most cases, sterile males, but these species do not hybridize with the African buffalo (Syncerus caffer) or water buffalo (Bubalus bubalis). Divergence times range from about 0.2 Myr (ox–zebu) to about 5 Myr (ox–water buffalo), which provides an opportunity to follow changes in satellite DNA after different time periods. We observed that the relative amounts of satellites and their sequence variants fluctuate considerably. We
propose a model of the life history of satellites that describes an initial unstable phase of rapid amplification or deletion of homogeneous repeat units, a second phase of a progressive degeneration by mutations and recombinations, and a final phase of gradual deletion. Materials and Methods DNA Isolations. DNA was isolated from various tissues (liver, skin, muscle, old blood) using proteinase K/SDS/phenol extractions (Sambrook et al. 1989) or from fresh blood using guanidine isothiocyanate (Ciulla et al. 1988). PCR, PCR-RFLP, and Direct Sequencing. Satellite DNA from approximately 50 ng template DNA was amplified with the primers listed in Table 1 in reaction buffer with 1.5 mM MgCl2, 0.2 mM dNTPs, and 1.25 U Taq polymerase (Promega). The following program was used: predenaturation for 2 min at 92°C, then 30 cycles of 15 s at 92°C, 45 s at 60°C, and 45 s at 72°C. PCR products from satellites 1.711a and 1.711b, which were both generated by primers BovS11-L and BovS11R, were separated by agarose gel electrophoresis. For restriction analysis, one-fifth of the PCR product was digested twice with 5–10 U of the appropriate enzyme at 37°C (TaqI at 65°C) for 3 h before separation on a 2% agarose gel in 1× TBE. Completeness of the digestions was checked by testing if a second digestion had any effect. Sequencing of the PCR products was performed using the cycle sequencing kit with ␥-33P-labeled terminators from Amersham with 10 ng fragment and 5 ng PCR primer. Fragments were separated on 6% denaturing polyacrylamide gels and carefully read by two independent researchers. The use of labeled dideoxy terminators appeared to be essential to suppress bands caused by nonspecific termination products. Sequences were aligned by the Multalin PC program (Corpet 1988). Ambiguities in the sequences are not unclearities but indicate the presence of different
363 bases at a certain position. Ambiguities were scored only if (i) two or more bands were clearly visible and (ii) the bands were both less intense than a single base. Variable restriction sites were localized using in-house developed PC software. Sequence data were deposited in the GenBank database under accession numbers AF162507 to AF162514 (satellite IV), AF162491 to AF162498 (satellite 1.711a), and AF162499-162506 (satellite 1.711b), respectively.
We hybridized Southern blots of genomic HindIII digests with probes specific for satellites I, II, III, IV, and
1.711b under conditions that prevented crosshybridization (Jobse et al. 1995). The 1.711b probe consisted of the sequence that was not shared by other satellites. Probes for satellite 1.711a were not tested, since these probes would cross-hybridize to satellite I, satellite 1.711b, and/or a hitherto unidentified satellite that is predominant in the buffalos and nilgai (unpublished results). The HindIII patterns of the Bos and Bison species were as expected on the basis of the published sequences of ox (results not shown). For a semiquantitative analysis, hybridization signals were analysed by phosphor imaging. Signals were normalized on the basis of the hybridization signals of other probes specific for the Bov-A and Bov-B SINE sequences (Lenstra et al. 1993), which are shared by all ruminants (Jobse et al. 1995; Modi et al. 1996). The signal of the ox satellites was arbitrarily set at 100%. For satellite 1.711b, oligonucleotide hybridization yielded essentially the same relative intensities as a longer, PCR-generated probe (Jobse et al. 1995). Another control was the analysis of cattle of mixed-species origin (Nijman 1999), the beefalo (ox–bison) and the Madura (zebu–banteng) breeds, respectively, which yielded signals that were intermediate between the signals of the parent species. As shown in Fig. 1, the signals from satellites I and II,
Fig. 1. Relative intensities of hybridization signals on a Southern blot of HindIII digests of DNA from Bovini species. The 32P signals have been quantified per gel lane by phosphor imaging and averaged over the two values that were obtained after correction for the amount of
DNA via the hybridization signals of Bov-A and Bov-B SINE probes, respectively. The signal of ox is arbitrarily set at 100%. The deviations (vertical bars above columns) indicate half the difference of the signals after correction on the basis of BovA and Bov-B, respectively.
Southern Blotting and Hybridization. Southern blots were made following standard procedures (Sambrook et al. 1989) and contained approximately 3–5 g of digested chromosomal DNA separated on agarose gels. After 2–3 h of prehybridization, filters were hybridized overnight at 55°C to ␣-32P-labeled PCR satellite DNA products or ␥-32P-labeled oligonucleotides derived from Bos taurus. Hybridizations to PCR-generated probes were washed twice during 10 min in 2× SSPE and 0.1% SDS at 55°C. Oligonucleotide hybridizations were washed once during 10 min with 5× SSPE, 0.1% SDS and once with 2× SSPE, 0.1% SDS at 55°C (high stringency) or twice times for 10 min in 5× SSPE, 0.1% SDS at 50°C (low stringency; only for satellite III). Signals were detected by autoradiography or a Molecular Dynamics 400 phosphorimager set at 176 m and 680 V. Quantitative hybridization signals were analyzed with the Imagequant software (Molecular Dynamics, version 3.22).
Results Hybridization to Cattle Satellite Probes
364
Fig. 2. Alignments of sequences of amplification products of satellite DNA. A Satellite IV. B Satellite 1.711a. C Satellite 1.711 b. Dots indicated identity to the top sequences from GenBank (see Table 1). The positions of PCR primers are underlined. Ambiguity codes indicate sequence heterogeneities. Boxes indicate restriction sites that discriminate sequence variants or, in satellite 1.711b, other TaqI sites.
365
366
which are shared by other ruminants, were rather constant, but there was considerable variation in the signals from the other satellites. The most variation was observed for satellite III, considered to be the youngest addition to the cattle satellite repertoire (Jobse 1995). The repeat unit of this satellite consists of a tandem subrepeat of two related 23-mer sequences, the Pvu and Sau motifs, respectively (Pech et al. 1979), both of which were absent in the water buffalo (Jobse et al. 1995). The genomes of other bovine species appear to contain more of the Pvu motif than the ox genome does. Surprisingly, the Pvu motif but not the Sau motif was detected in the African buffalo. This was confirmed by Southern blots of other restriction digests (not shown). Sequence Variation of Satellite DNA To test if the suggested fluctuations in the copy number were accompanied by changes in the consensus sequence, we compared satellites IV, 1.711a, and 1.711b from the Bos and Bison species by direct sequencing of PCR products (Fig. 2). From satellites 1.711a and 1.711b, those parts of the monomer units were analyzed that did not contain the tandem subrepeats. In addition to a few unambiguous mutations (Fig. 2), most differences among the sequences of satellites IV, 1.711a, and 1.711b appeared to be caused by variation in relative amounts of sequence variants, as apparent from heterogeneous nucleotide positions. Satellite sequences from ox and zebu differed by one detectable heterogeneity in 1900 positions and from other species by heterogeneities in 0.5–2% of the positions. Several heterogeneities are shared by more than one species. However, sequencing is not adequate to compare quantitatively the ratios of sequence variants, and, depending on the variable background level, minor variants may not be detected. Therefore, we selected candidate mutations that changed recognition sequences of restriction enzymes for a more detailed comparison. An RFLP analysis of genomic DNA (Fig. 3A) showed the presence of a TaqI site (TCGA) in part of the 1.711b units from ox but not in the units from bison (TCTA). This is in agreement with sequence gels and excludes the possibility that the difference in gel reading represented only a part of the satellite as a consequence of selective amplification of repeat units. Quantification of these hybridization signals relative to the BovA signals yielded ox/bison ratios of 2.6 and 0.11 for the total amount of satellite 1.711b and the TCTA variant, respectively. Figure 3B shows by PCR-RFLP that the frequencies of this TaqI site at positions 752–755 (Fig. 2C) in banteng, gaur, and gayal are also different but are intermediate between those of ox/zebu and those of bison/ wisent/yak. The latter three species also shared a clear AAGCKT heterogeneity at positions 698–704 in satellite 1.711b that was reflected in the extent of HindIII digestion.
Fig. 3. RFLP and PCR-RFLP patterns of satellite DNA. A Southern blot of TaqI digests of genomic DNA from cattle and bison hybridized to a satellite 1.711b probe, revealing a variation at position 756. B Restriction digestions of satellite 1.711b: HindIII digestion of PCR products generated by primers BovS11b-L and BovS11b-R, revealing variation on positions 703; TaqI digestion of PCR products generated by primers Bov-S11b-L and BovS11-R revealing variation at position 754. C Restriction digestions of satellite IV PCR segments generated by primers BovS09-L and BovS09-R: BanII digestion revealing variation at position 438; MseI digestion revealing variation at positions 76 and 133.
A GAATTM heterogeneity at positions 879–884 in satellite 1.711b of yak was confirmed by EcoRI digestion (not shown). Previously, we used MboI or Sau3AI digestion to correlate the GATT/GATY difference between ox and zebu at positions 281–284 in the same satellite with taurine–indicine hybridization (Nijman et al. 1999). In this study we did not find any variation of digestion patterns in different individuals of pure taurine (ox) and indicine (zebu) cattle.
367
Fig. 4. PCR-RFLP pattern of satellite IV after double MseI and BanII digestions of PCR amplification products, Southern blotting, and hybridization to oligonucleotide probes specific for the left-terminal, central, and right-terminal fragments, respectively. (1) Ox; (2) zebu; (3) banteng; (4) bison; (5) yak; (6) gaur. The right panel shows a residual signal from the previous hybridization to the probe specific for the left-terminal fragment. Asterisks indicate clear but weak bands. Ethidium bromide patterns of the agarose gel before blotting were fully consistent with the hybridization pattern. Southern blots of single digestions (not shown) were included as controls and were compatible with Fig. 3C. The positions of the oligonucleotide probes and the fragments expected for the respective sequence variants are indicated.
In satellite IV an MseI digestion (Fig. 3C) confirmed a TTMA variation (131–134) with a variable ratio of the TTCA and TTAA variants. Sequencing and/or PCRRFLP revealed an extra MseI site at positions 74–77 in bison, wisent, and yak. A BanII digestion confirmed the GAGCTM variation at positions 433–438 (Fig. 2A) and indicated that also satellite IV from yak and gaur contains the GAGCTC sequence as minor variant. In general, all PCR-RFLP patterns were consistent with the results of the sequencing gels but allowed the detection of lower levels of minor variants. Recombination of Monomers The digestion patterns in Fig. 3C indicate that monomers of satellite IV without the MseI site at positions 131–134 occur with and without the BanII site at positions 433– 438. The relative intensities of the fragments in gaur indicate that at least some of the units with the MseI site have no BanII site. To detect repeat units with both restriction sites, double digestions with MseI and BanII were carried out (Fig. 4). Since not all fragments were separated in these digests, terminal and central fragments were identified by blotting and hybridization to specific probes. The detection of an internal 298-bp MseI–BanII fragment indicated the existence of units that contained both restriction sites. Likewise, the MseI site at positions 74–77 in yak occurs both with and without the BanII site
in the same unit. Since the mutations that either created or abolished the restriction sites are not likely to have occurred more than once, this may suggest that recombination also played a role in creating the restriction variants of the repeat units.
Discussion Evolution of Cattle Satellite DNA In this study we used primers and probes derived from ox satellites to study the occurrence and sequence variation in satellites from related Bovini species. By this approach this study is limited to the hybridization and amplification of ox-like variants. Satellite I entries from water buffalo and ox in the nucleotide database are identical for only 80%, and we observed a similar divergence in sequence data from satellite IV (not shown). This would at least partially explain the low hybridization signals of African buffalo, water buffalo and nilgai with the oxderived probes (Haaf and Willard 1998; Waye and Willard 1989). However, sequence divergence cannot account for the variation in the hybridization signal of the satellite III probe, which is clearly weaker with ox DNA than with DNA from the other Bos and Bison species. The dynamic behavior of satellite III is also apparent from the pres-
368
ence and absence of the Pvu motif in the African buffalo and water buffalo, respectively. Phylogenetic reconstructions on the basis of mitochondrial DNA (Wall et al. 1992; Gatesy 1997), nuclear genes (Pitra et al. 1997), and AFLP patterns (Buntjer 1997) indicate that the ancestor of the buffalo’s species is predated by the common ancestor of all Bovini. This implies that satellite III was present in the genomes of both ancestral species and has apparently been removed from the genome of water buffalo. Likewise, the weak hybridization signals of satellites IV and 1.711b relative to the signals in ox probably reflect variation in copy number, since comparative sequencing did not indicate a sequence divergence that can explain a decrease in the hybridization signal. Variation in the sequence of the monomers of satellites IV, 1.711a, and 1.711b has been studied by comparative sequencing and PCR-RFLP analysis of variable sequence positions. It was verified that the same sequence variants were obtained with different PCR primers. Furthermore, a variation in a TaqI site in the PCR products of satellite IV was confirmed on a Southern blot of genomic DNA. Analysis of different ox, zebu, or bison individuals did not indicate any variation within species (Nijman et al. 1999; results not shown). However, we found that the divergence of ox and zebu during ca. 0.2 Myr introduced a heterogeneity at one nucleotide position, while divergence times of about 1 Myr, separating ox from bison, yak, gaur, or banteng, led to more heterogeneities and a few transitions between homogeneous sequences. This indicates that spreading of new bovine satellite variants over the whole satellite population may have occurred within 0.5 to 1 Myr. Comparative sequencing of noncoding DNA from ox and bison from five loci revealed six point mutations/1024 bp (unpublished data; Ward et al. 1997), indicating a neutral mutation rate in the range of 0.5–1% replacement/Myr. This implies that new variant satellites also degenerate before they have spread completely over the genome. We conclude that the total copy number as well as the relative amounts of individual sequence variants of different satellites is subject to large fluctuations. Similar results with the murine light satellite (Dod et al. 1989) and human ␣ satellite (Lo et al. 1999) have been reported. Below we incorporate these results in a more general model of the evolution of satellites. At the taxonomic level of the Bovini, the satellite sequence variation does not appear to be informative for their phylogeny, which has been only partially resolved (Wall et al. 1992; Gatesy 1997; Pitra et al. 1997; Lenstra and Bradley 1999). The 1.711b sequence of yak resembles the bison and wisent sequence, which is confirmed by the MseI patterns of satellite IV. However, in satellite IV yak shares several other heterogeneous nucleotide positions with gaur and banteng. These discrepancies may be explained by a mechanism analogous
to allele sorting, by which an arbitrary variant becomes predominant after speciation. However, satellites appear to be informative for detection of interspecies hybridization (Smirnov et al. 1996). Previously, we have shown that an RFLP pattern of satellite III and the MboI PCR-RFLP of satellite 1.711b correlate with the zebu–ox hybridization in African cattle breeds (Nijman et al. 1999). In addition, the MseI and BanII PCR-RFLP of satellite IV both allowed analysis of the mixed zebu–banteng origin of Indonesian cattle breeds (Nijman 1999). A Model of the Satellite Life History The dynamic nature of satellites has been studied for more than 20 years. Any model that explains their dynamic behavior should accommodate the following observations. (a) Within a species, several tandem repeats with different taxonomic distributions may coexist. This has been documented most extensively for the bovine genome (Jobse et al. 1995) and has been explained by the “library hypothesis” (Mesˇtrovı´c et al. 1998). (b) Species that are as closely related as the crosshybridizing bovine species may share the same sequence variants, as indicated by the conservation of sequence heterogeneities. (c) Sequence variants within a species may be chromosome-specific, as documented for the human ␣ satellite (Warburton and Willard 1995; Nilsson et al. 1997). (d) In species that are less related but still share homologous satellites, digestion patterns and consensus sequences indicate that similarities within species is higher than across species (Haaf and Willard 1998; Waye and Willard 1989; Jobse et al. 1995). (e) In the course of evolution major satellites are always replaced by other, unrelated sequences. Ruminants such as goat, sheep, and deer have homologues of satellites I and II (Buckland 1985; Qureshi and Blake 1995; Jobse et al. 1995) but no satellites are shared with other artiodactyl suborders. The process that results in the intraspecies homogeneity is commonly referred to as concerted evolution (Elder and Turner 1995). Although this term may suggest nonindependent changes in a fixed number of loci, for instance, by sequence conversion, it generally refers to mechanisms that change the number of loci. Several mechanisms have been described that, via interactions of tandem repeat units, change their copy number (Charlesworth et al. 1994). RecA-dependent recombination and RecA-independent slipped misalignment of direct repeats in E. coli leads to expansions with a frequency of >10−5 per generation (Morag et al. 1999). In
369
Fig. 5. Model for the satellite life history. The feedback loops on homogeneity and frequency of interaction are postulated to operate as shown during phase I on a new satellite, but also during phase II on individual sequence variants. (⊕) Positive feedback loop; (䊞) negative feedback loop.
mammalian cells intrachromosomal recombination by unequal sister chromatide exchange has been demonstrated (Baker et al. 1999). Interallelic sequence conversion has been described for minisatellites (Jeffreys et al. 1998), and replication slippage for microsatellites (Schlo¨tterer and Tautz 1992). For centromeric satellites, unequal crossing-over has been postulated (Smith 1976), but more recent literature emphasizes the role of amplification, for instance, by looping-out after intralocus recombination (Walsh 1987; Dod et al. 1989; Rossi et al. 1990; Marc¸ais et al. 1991). In any of these mechanisms, the frequency of these interaction events is likely to increase with the copy number of the repeat units. This would then establish a positive feedback and result in exponential growth. However, this expansion may be counteracted by deletion events (Marc¸ais et al. 1991) that also depend on interactions of homogeneous repeat units. So we propose that during an initial phase of a satellite life history (Fig. 5), interactions of homogeneous repeat units cause rapid expansions as well as contractions, leading to saltatory fluctuations in the copy number. This explains the fluctuations in the amount of young satellite III in species that diverged 0.2 to 1 Myr ago and the virtual deletion of this satellite from the genome of the water buffalo after its divergence from the African buffalo. Since satellite III is present on most cattle chromosomes (Modi et al. 1993), the amplification is apparently not restricted to one chromosome. Since the emergence of a new homogeneous tandem repeat does not require the immediate removal of previous satellites, several satellites with different evolutionary origins can coexist in the centromeres (Jobse et al. 1995; Mesˇtrovı´c et al. 1998). In eukaryotes, homologous recombinations within plasmids (Rubnitz and Subramani 1984), within chromosomes (Waldman and Liskay 1988), or between chromosomes (Metzenberg et al. 1991) have been shown to be inhibited by only one mutation per 200 bp. Similarly, mutations may also suppress the interactions of repeat units and attenuate the dynamic behavior of the satellite. This implies that homogeneity is both consequence and
cause of the amplification process. We propose that the second phase in the life history (Fig. 5) is initiated by mutations, during which interactions are mainly between monomers of identical sequence, and sequence variants amplify and contract independently. This explains the fluctuations in the relative amounts of the sequence variants of satellites IV, 1.711a, and 1.711b in crosshybridizing bovine species (cf. Marc¸ais et al. 1991). Concerted evolution occurs if one variant becomes predominant in a species (Dod et al. 1989). Higher-order repeats arise if the saltatory interactions of repeat units extend over two or more units. For the human ␣ satellite, it has been shown that intrachromosomal variation is less than the difference between chromosome-specific variants [10–20% (Waye and Willard 1989; Warburton and Willard 1995; Marc¸ais et al. 1991; Nilsson et al. 1997; Haaf and Willard 1998)]. This indicates that intrachromosomal amplification is faster than migration of sequence variants to other chromosomes. However, this also leads to a progressive partitioning of the satellite population into different variants and a concomitant reduction in their interactions. Overall concerted evolution, as has been observed for the diverged monomers of the ␣ satellites (Haaf and Willard 1998; Waye and Willard 1989; Warburton and Willard 1995), then presumably takes place by recombination of diverged sequence variants (Warburton and Willard 1993). This recombination would be mediated by short segments of perfect match and is likely to be slower than the saltatory interaction of homogeneous repeat units (Rubnitz and Subramani 1984). Only a fast recombination would lead to fixation or extinction of new mutations, but Fig. 4 suggests that recombination gave rise to new sequence variants. Bachmann et al. (1996) explained the relatively high copy number of variable satellites in cave crickets by a lower frequency of removal by crossing-over. This is partially consistent with the explanation that these satellites have a reduced frequency of mutual interactions in the second phase of their life history. Since any new sequence variant degenerates by mutations before it has spread over all centromeres, the gradual loss of homogeneity is likely to be irreversible. Consequently, each satellite eventually enters a terminal phase III (Fig. 5), during which interactions between repeat units, within as well as across chromosomes, have stopped. One factor that will favor a new satellite instead of a new sequence variant of an older satellite is the presence of many copies of the older satellite, which by recombination suppresses the amplification of new variants. Carnahan et al. (1993) reported an array of heterogeneous alphoid repeat units conserved in all primates and with a high degree of similarity to the consensus sequence. This may illustrate the existence of an old and inactive repeat in phase III. However, any selective pressure on maintenance of the size of the genome is ex-
370
pected to lead eventually to the removal of inactive DNA of the older repeat families. The evolutionary time scale of satellite evolution precludes a direct test of the model of the satellite life history and the factors that determine the interactions between repeat units. Possibly, artificial acceleration of amplification (Parra et al. 1997) and introduction of new satellites by transfection (Harrington et al. 1997) offer perspectives to an experimental simulation of the evolution of satellites. Acknowledgments. Samples were kindly provided by Dr. B. Morris, Stormont Laboratories, Davis, California; Dr. A. Schreiber, Heidelberg; Dr. A. Randi, Potenza, Italy; Dr. J. Womack, College Station, Texas; Dr. D.G. Bradley, Dublin; Antwerp Zoo, Antwerp; Dr. P. Klaver, Artis Zoo, Amsterdam; Dr. Schaftenaar, Blijdorp Zoo, Rotterdam; Dr. J. Bos, Ouwehands Zoo, Rhenen; and the Department of Pathology, Faculty of Veterinary Medicine, Utrecht University. We thank Drs. J.B. Buntjer, R.J. de Groot, P. Devilee, and J.P.M. van Putten for stimulating discussions and reading of the manuscript.
References Bachmann L, Venanzetti F, Sbordoni V (1996) Tandemly repeated satellite DNA of Dolichopoda schiavazzii: A test for models on the evolution of highly repetitive DNA. J Mol Evol 43:135–144 Baker MD, Read LH, Ng P, Beatty BG (1999) Intrachromosomal recombination between well-separated homologous sequences in mammalian cells. Genetics 152:685–697 Buckland RA (1985) Sequence and evolution of related bovine and caprine satellite DNAs. Identification of a short DNA sequence potentially involved in satellite DNA amplification. J Mol Biol 186:25–30 Buntjer JB (1997) DNA repeats in vertebrate genomes as probes in phylogeny and species identification, Thesis. Utrecht University, Utrecht, The Netherlands Carnahan L, Palamidis-Bourtsos E, Musich PR, Doering JL (1993) Characterization of an evolutionary old human alphoid DNA. Gene 123:219–225 Charlesworth B, Sniegowski P, Stephan W (1994) The evolutionary dynamics of repetitive DNA in eukaryotes. Nature 371:215–220 Ciulla TA, Sklac RM, Hauser SL (1988) A simple method for DNA purification from periferal blood. Anal Biochem 174:485–488 Corpet F (1988) Multalin. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res 16:10881–10890 Csink AK, Henikoff S (1998) Something from nothing: The evolution and utility of satellite repeats. Trends Genet 14:200–204 Denome R, O’Callaghan B, Luitjens C, Harper E, Bianco R (1994) Characterization of a satellite DNA from Antilocapra americana. Gene 145:257–259 Dod B, Mottez E, Desmarais E, Bonhomme F, Roizes G (1989) Concerted evolution of light satellite DNA in genus Mus implies amplification and homogenization of large blocks of repeats. Mol Biol Evol 6:478–491 Elder JF Jr, Turner J (1995) Concerted evolution of repetitive DNA sequences in eukaryotes. Q Rev Biol 70:297–320 Gatesy J (1997) More DNA support for a Cetacea/Hippopotamidae clade: The blood-clotting protein gene gamma-fibrinogen. Mol Biol Evol 14:537–543 Goldberg IG, Sawhney H, Pluta AF, Warburton PE, Earnshaw WC (1996) Surprising deficiency of CENP-B binding sites in African green monkey ␣-satellite DNA: Implication for CENP-B function at centromeres. Mol. Cell. Biol. 16:5156–5168 Haaf T, Willard HF (1998) Orangutan alpha-satellite monomers are
closely related to the human consensus sequence. Mammal Genome 9:440–447 Harrington JJ, Van Bokkelen G, Mays RW, Gustashaw K, Willard HF (1997) Formation of de novo centromeres and construction of firstgeneration human artificial microchromosomes. Nature Genet 15: 345–355 Jeffreys AJ, Neill DL, Neumann R (1998) Repeat instability at human minisatellites arising from meiotic recombination. EMBO J 17: 4147–4157 Jobse C, Buntjer JB, Haagsma N, Breukelman HJ, Beintema JJ, Lenstra JA (1995) Evolution and recombination of bovine DNA repeats. J Mol Evol 41:277–283 Koch J (2000) Neocentromers and alpha satellite: A proposed structural code for functional human centromere DNA. Hum. Molec. Genet. 9:149–154 Lee C, Lin CC (1996) Conservation of a 31-bp bovine subrepeat in centromeric satellite DNA monomers of Cervus elaphus and other cervid species. Chromosome Res 4:427–435 Lenstra JA, Bradley DG (1999) Systematics and phylogeny of cattle. In: Fries R, Ruvinsky A (eds) The genetics of cattle. CAB International, Wallingford, pp 1–14 Lenstra JA, van Boxtel JAF, Zwaagstra KA, Schwerin M (1993) Short interspersed nuclear element (SINE) sequences of the Bovidae. Anim Genet 24:33–39 Lo AWI, Lioa C-C, Rocchi M, Choo KHA (1999) Extreme reduction of chromosome-specific ␣-satellite is unusually common on human chromosome 21. Genome Res 9:895–908 Marc¸ais B, Charlieu JP, Allain B, Brun E, Bellis M, Roizes G (1991) On the mode of evolution of alpha satellite DNA in human populations. J Mol Evol 33:42–48 Mesˇtrovı´c N, Plohl M, Mravinac B, Ugarkovic D (1998) Evolution of satellite DNAs from the genus Palorus—Experimental evidence for the “library” hypothesis. Mol Biol Evol 15:1062–1068 Metzenberg B, Wurzer G, Huisman TH, Smithies O (1991) Homology requirements for unequal crossing over in humans. Genetics 128: 143–161 Modi WS, Gallagher S, Womack JE (1993) Molecular organization and chromosomal localization of six highly repeated DNA families in the Bovine genome. Anim Biotechn 4:143–161 Modi WS, Gallagher DS, Womack E (1996) Evolutionary histories of highly repeated DNA families among the artiodactyla (mammalia). J Mol Evol 42:337–349 Morag AS, Saveson CJ, Lovett, ST (1999) Expansion of DNA repeats in Escherichia coli: Effects of recombination and replication functions. J Mol Biol 289:1–27 Nijman IJ (1999) Repetitive DNA as genetic and phylogenetic markers in the genome of cattle and other ruminants, Thesis. Utrecht University, Utrecht, The Netherlands Nijman IJ, Bradley DG, Hanotte O, Otsen M, Lenstra JA (1999) Satellite DNA length polymorphism and AFLP correlate with Bos indicus-taurus hybridization. Anim Genet 30:245–250 Nilsson M, Krejci K, Koch J, Kwaikowski M, Gustavsson P, Landegren U (1997) Padlock probes reveal single-nucleotide differences, parent of origine and in situ distribution of centromeric sequences in human chromosomes 13 and 21. Nature Genet 16: 252–255. Novak U (1984) Structure and properties of a highly repetitive DNA sequence in sheep. Nucleic Acids Res 12:2343–2350 Parra I, Flores C, Adrian D, Windle B (1997) AZT induces high frequency, rapid amplification of centromeric DNA. Cytogenet Cell Genet 76:128–133 Pech M, Streeck ER, Zachau HG (1979) Patchwork structure of a bovine satellite DNA. Cell 18:883–93 Pitra C, Furbass R, Seyfert H-M (1997) Molecular phylogeny of the tribe Bovini (Mammalia: Artiodactyla): alternative placement of the Anoa. J Evol Biol 10:589–600 Plucienniczak A, Skowronski J, Jaworski J (1982) Nucleotide sequence
371 of bovine 1.715 satellite DNA and its relation to other bovine satellite sequences. J Mol Biol 158:293–304 Qureshi SA, Blake RD (1995) Sequence characteristics of a cervid DNA repeat family. J Mol Evol 40:400–404 Reisner AH, Bucholtz CA (1983) Apparent relatedness of the main component of ovine 1.714 satellite DNA to bovine 1.715 satellite DNA. EMBO J 2:1145–1149 Rossi MS, Reig OA, Zorzopulos J (1990) Evidence for rolling-circle replication in a major satellite DNA from the South American rodents of the genus Ctenomys. Mol Biol Evol 7:340–350 Rubnitz J, Subramani S (1984) The minimum amount of homology required for homologous recombination in mammalian cells. Mol Cell Biol 4:2253–2258 Sambrook J, Fritsch F, Maniatis T (1989) Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY Schlo¨tterer C, Tautz D (1992) Slippage synthesis of simple sequence DNA. Nucleic Acids Res 20:211–215 Skowronski J, Plucienniczak A, Bednarek A, Jaworski J (1984) Bovine 1.709 satellite. Recombination hotspots and dispersed repeated sequences. J Mol Biol 177:399–416 Smirnov F, Pavlova VA, Sleptsov MK, Steklenev EP (1996) [Variability of satellite DNA II and IV in cattle, various representatives of the subfamily Bovinae and their hybrids]. Genetika 32:1263–1269 Smith GP (1976) Evolution of repeated DNA sequences by unequal crossover. Science 191:528–535 Streeck ER (1981) Inserted sequences in bovine satellite DNA’s. Science 213:443–445
Waldman AS, Liskay RM (1988) Dependence of intrachromosomal recombination in mammalian cells on uninterrupted homology. Mol Cell Biol 8:5350–5357 Wall DA, Davis SK, Read BM (1992) Phylogenetic relationships in the subfamily Bovinae (Mammalia; Artiodactyla) based on ribosomal DNA. J Mammal 73:262–725 Walsh JB (1987) Persistence of tandem arrays: implications for satellite and simple-sequence DNAs. Genetics 115:553–567 Warburton PE, Willard F (1995) Interhomologue sequence variation of alpha satellite DNA from human chromosome 17: evidence for concerted evolution along haplotype lineages. J Mol Evol 41:1006– 1015 Warburton PE, Waye JS, Willard HF (1993) Nonrandom localization of recombination events in human alpha satellite repeat unit variants: implications for higher-order structural characteristics within centromeric heterochromatin. Mol Cell Biol 13:6520–6529 Ward T, Honeycutt RL, Deri JN (1997) Nucleotide sequence evolution at the -casein locus: Evidence for positive selection within the family Bovidae. Genetics 147:1863–1872 Waye JS, Willard HF (1989) Concerted evolution of alpha satellite DNA: Evidence for species specificity and a general lack of sequence conservation among alphoid sequences of higher primates. Chromosoma 98:273–279 Willard HF (1991) Evolution of alpha satellite. Curr Opin Genet Dev 1:509–514 Willard HF (1998) Centromeres: The missing link in the development of human artificial chromosomes. Curr Opin Genet Dev 8:219–225
