Mutations in COL11A2 cause non-syndromic hearing loss ... - Nature

© 1999 Nature America Inc. • http://genetics.nature.com

article

Mutations in COL11A2 cause non-syndromic hearing loss (DFNA13) Wyman T. McGuirt1, Sai D. Prasad1, Andrew J. Griffith2, Henricus P.M. Kunst3, Glenn E. Green1, Karl B. Shpargel2, Christina Runge1, Christy Huybrechts4, Robert F. Mueller5, Eric Lynch6, Mary-Claire King6, Han G. Brunner3, Cor W.R.J. Cremers3, Masamine Takanosu7, Shi-Wu Li8, Machiko Arita8, Richard Mayne7, Darwin J. Prockop8, Guy Van Camp4 & Richard J.H. Smith1 We report that mutation of COL11A2 causes deafness previously mapped to the DFNA13 locus on chromosome 6p. We found two families (one American and one Dutch) with autosomal dominant, non-syndromic hearing loss to have mutations in COL11A2 that are predicted to affect the triple-helix domain of the collagen protein. In both families, deafness is non-progressive and predominantly affects middle frequencies. Mice with a targeted disrup© 1999 Nature America Inc. • http://genetics.nature.com

tion of Col11a2 also were shown to have hearing loss. Electron microscopy of the tectorial membrane of these mice revealed loss of organization of the collagen fibrils. Our findings revealed a unique ultrastructural malformation of inner-ear architecture associated with non-syndromic hearing loss, and suggest that tectorial membrane abnormalities may be one aetiology of sensorineural hearing loss primarily affecting the mid-frequencies.

Introduction Hearing loss is a common sensory impairment, with nearly one in two persons developing an auditory deficit (>25 dB) during their lifetime1. The aetiology is multifactorial and can include numerous environmental and genetic factors. For prelingual hearing loss, epidemiological data show that 1 neonate in 1,000 is born with severe-to-profound or profound hearing impairment, and in half that number the loss is inherited. Similar data are not available for postlingual hearing impairment, but even for agerelated hearing impairment, hereditary factors are prominent2. With both pre- and postlingual hearing impairment, the most common phenotype excludes non-auditory features, and for this reason these losses are described as non-syndromic. They are further classified by mode of inheritance (DFNA, dominant; DFNB, recessive; DFN, X-linked), with the loci being numbered in the order of discovery3. To date, 31 autosomal dominant, non-syndromic sensorineural hearing loss (ADNSHL) loci have been mapped and ten genes have been cloned (Hereditary Hearing Loss Homepage, http://dnalab-www.uia.ac.be/dnalab/hhh/). Although no collagen genes have been associated with nonsyndromic hearing loss, several collagen genes are expressed in the inner ear. Their importance to normal auditory function can be inferred from the observation of hearing loss associated with collagen-related diseases, including osteogenesis imperfecta (COL1A1, COL1A2), Alport syndrome (COL4A3, COL4A4, COL4A5), otospondylomegaepiphyseal dysplasia (OSMED) syndrome (COL11A2) and Stickler syndrome (in both its classic (COL2A1, COL11A1) and non-ocular (COL11A2) forms, although the latter is more appropriately called heterozygous OSMED syndrome). These diseases cause complex phenotypes

in which hearing loss is only one component, reflecting the ubiquitous expression of collagens in connective tissue and the extracellular matrix throughout the body4,5. The collagen family is comprised of at least 32 unique genes that encode a common signature motif: the sequential repetition of the amino acids -G-X-Y-, where G is glycine and X and Y are often proline and hydroxyproline, respectively, and specifically exclude cysteine and tryptophan4,5. This motif permits trimerization of individual collagen molecules that combine into at least 19 different proteins grouped into seven classes6. The collagens associated with syndromic hearing loss belong to the basement-membrane-associated (type IV) and fibrillar (type I, type II, type XI) classes. Type XI collagen accounts for less than 10% of total cartilage collagen and is essential for maintaining the interfibrillar spacing and fibril diameter of type II collagen7–9. It is composed of three α-chain polypeptide subunits, each transcribed from a different gene: α-1 (COL11A1, 1p21), α-2 (COL11A2, 6p21.3) and α-3 (COL2A1, 12q13.11–q13.2). The first two subunits are closely related to α-1(V), suggesting that various combinations of these polypeptides may assemble to produce the triple helical structure of type XI collagen or heterotypic V/XI molecules10–12. COL11A2 spans over 28 kb and includes 66 exons and an alternatively spliced exon in the amino terminus10,11. Mutations in COL11A2 cause dominant and recessive disease and result in a spectrum of osteochondrodysplasias13–15. The phenotype is characterized by midface hypoplasia, a short, up-turned nose with a depressed nasal bridge, prominent eyes and supraorbital ridges, cleft palate, occasional micrognathia with glossoptosis, early onset degenerative joint disease and often small stature.

1Molecular Otolaryngology Research Laboratories, Department of Otolaryngology-Head and Neck Surgery, University of Iowa, Iowa City, Iowa, USA. 2National Institute on Deafness and Other Communication Disorders, National Institutes of Health, Bethesda, Maryland, USA. 3Department of Otorhinolaryngology, University Hospital, Nijmegen, The Netherlands. 4Department of Genetics, University of Antwerp, Belgium. 5Department of Clinical Genetics, St James’s Hospital, Leeds, UK. 6Department of Medicine, University of Washington, Seattle, Washington, USA. 7Department of Cell Biology, University of Alabama at Birmingham, Birmingham, Alabama, USA. 8Center for Gene Therapy, MCP Hahnemann University School of Medicine,

Philadelphia, Pennsylvania, USA. Correspondence should be addressed to R.J.H.S. (e-mail: [email protected]).

nature genetics • volume 23 • december 1999

413

article



a

b

Fig. 1 American DFNA13 family. a, Pedigree of American DFNA13 family (open circle, non-affected female; filled square, affected male). b, Representative audiogram from the American DFNA13 family (individual V:2, age 11 years).

hearing level in dB

Results Phenotypic data The congenital sensorineural hearing loss in the American family (Fig. 1a) varied from mild to moderately severe in degree. Audiograms of affected individuals showed greater mid-frequency than low- or high-frequency involvement, resulting in an audiometric profile commonly referred to as a ‘cookie-bite’ pattern (Fig. 1b). Aside from hearing loss, affected individuals were phenotypically normal. Specifically, no midface hypoplasia, cleft palate, precocious arthritis, or stature or ocular abnormalities were noted. In the Dutch family (Fig. 2a), the hearing impairment displayed a similar audiometric profile, with a dip from 500–2,000 Hz indicating a mid-frequency loss (Fig. 2b). (A complete audiologic analysis of this family has been reported19.) Of 17 affected individuals from the Dutch DFNA13 family, 8 also had caloric testing abnormalities, including areflexia, although vestibular dysfunction was not symptomatic. Their non-audiovestibular phenotype was normal. Cephalometric analysis comparing a single affected male from the American DFNA13 family with one person with autosomal recessive OSMED syndrome20 and another with autosomal dominant OSMED syndrome15 (non-ocular Stickler syndrome) confirmed the absence of midface hypoplasia in the DFNA13 phenotype. The American DFNA13 individual (IV:12) had a naso-frontal angle of 127 degrees (normal=115–130 degrees) compared with 103 degrees and 104 degrees for the recessive and dominant OSMED individuals, respectively. The latter persons also have shortened mid-faces and a lower and more posterior nasal root compared with the DFNA13 individual. Fisher exact two-tailed analysis of the presence or absence of cleft palate among individuals in reported cases of dominant OSMED syndrome13–15 (10/26) compared with that of the two DFNA13 families (0/24 American; 0/21 Dutch) demonstrates that DFNA13 is not associated with cleft palate (P=0.000011).

Hearing impairment is an invariable feature and is generally severe and sensorineural16. Notably absent, however, are the ophthalmologic abnormalities seen with COL11A1 or COL2A1 mutations, reflecting the absence of COL11A2 expression in the ocular vitreous17. To avoid nosologic confusion with other collagen-related osteochondrodysplasias, the term ‘autosomal dominant or recessive OSMED syndrome’ has been proposed for COL11A2 mutations18, although autosomal dominant OSMED is widely referred to as non-ocular Stickler syndrome. The type XI collagenopathies in general are referred to as the ‘SticklerOSMED phenotype’, as mutations in COL11A1 and COL2A1 cause classic Stickler syndrome. Our report describes the identification of COL11A2 as the gene responsible for deafness at the DFNA13 locus in two large families with isolated hearing loss. To determine the location and possible function of COL11A2 in the inner ear, we evaluated its expression in the temporal bone of mice by in situ hybridization and performed auditory and temporal bone histologic DFNA13 critical region and contig construction analyses of a Col11a2 transgenic mouse strain segregating a null We previously reported linkage of the DFNA13 locus to a 4-cM allele of Col11a2. region on chromosome 6p with a maximum two-point lod score 414




Fig. 2 Dutch DFNA13 family. a, Pedigree of Dutch DFNA13 family. (open circle, non-affected female; filled square, affected male). b, Representative audiogram from the Dutch DFNA13 family (individual IV:4, age 33 years).

of 6.4 at D6S299 (ref. 21). Ascertainment of additional family members and reconstruction of haplotypes with additional closely linked markers allowed refinement of the DFNA13 candidate gene interval to 0.5 Mb flanked by D6S1666 and D6S1560 on the centromeric side of the major histocompatibility complex (MHC) class II region. Concurrently, dominant non-syndromic sensorineural hearing loss segregating in a Dutch family was localized to the same interval. A physical map was constructed using yeast artificial chromosomes (YACs) and P1-derived artificial chromosomes (PACs; Fig. 3). We isolated five novel STRPs (CA repeats) by amplifying and sequencing linker libraries made from PAC clones in the region. An isolated CA repeat (158F5-5) and a single-nucleotide polymorphism in RING1 served as novel telomeric and centromeric boundaries, respectively, narrowing the DFNA13 interval to approximately 0.1 Mb. Shortly after completing the physical map, sequence data for most of the critical region became available through the Sanger Centre (BAC 1033B10). PCR-based screening against a human fetal cochlear cDNA library22 verified the presence of 3´ transcripts of three genes within the candidate region: COL11A2, RXRB (retinoic acid

b

hearing level in dB

a

article

receptor-β) and RING1. COL11A2 has been reported to be expressed in the cochlea22, consistent with its association with syndromic forms of hearing impairment. COL11A2 mutations Mutation screening of COL11A2 was completed by single-strand conformational polymorphism (SSCP) analysis and bi-directional sequencing of all PCR products. In the American family, we identified a heterozygous C→T missense mutation in exon 42 that predicts an arginine-to-cysteine substitution (Arg549Cys) in affected individuals (Fig. 4a,b). Three wobble bases that did not result in amino acid changes also were found. Although the C→T transition was readily identifiable by SSCP, because it destroys an

Fig. 3 Physical map of RING1, RXRB and COL11A2 are expressed in a human fetal cochlear cDNA library; HKE4 (RING5) and HKE6 (RING2) are not.


415

article


b

a

previously published

5´

ATT GGT CGC CAG GGG CGC CCA GGC Ile Gly Arg Gln Gly Arg Pro Gly

3´

wild type

5´

ATT GGT CCG CCA GGG CGC CCA GGC Ile Gly Pro Pro Gly Arg Pro Gly

3´

mutant

5´

ATT GGT CCG CCA GGG TGC CCA GGC Ile Gly Pro Pro Gly Cys Pro Gly

3´


c

SfoI site, segregation within the family was confirmed by SfoI digestion of the exon 42 PCR product (Fig. 4c). All 24 affected individuals from the American DFNA13 family were found to lack this restriction site; all had hearing impairment with typical audiometric findings. To exclude the possibility that the C→T transition represents a benign polymorphism, we screened 108 random individuals by SSCP analysis and found no mutations. The wild-type sequence data we obtained for exon 42 of COL11A2 was discordant with two deposited GenBank sequences (HSU32169 and J04974; independently derived but 100% concordant) at two nucleotide positions that reflect the omission of a cytidine (nt 1,638) and the insertion of a guanosine (nt 1,644). The result is a misread of two consecutive amino acids compared with wild-type sequence; however, the canonical -GX-Y- is retained (Fig. 4b).

a

Fig. 5 COL11A2 mutation in the Dutch family. a, Sequence data from a hearing-impaired person (III:6) and a family member with normal hearing (III:7) in the Dutch DFNA13 family. A heterozygous missense mutation in exon 31 at nt 970 results in replacement of a guanosine residue with adenosine. b, Amino acid and nucleotide sequence of COL11A2 exon 31 comparing mutant and wild-type alleles of the Dutch DFNA13 family. The point mutation produces a glycine-to-glutamate (red) amino acid change (Gly323Glu). c, Restriction digest with BsmFI showed an undigested 172-bp product in individuals with hearing impairment. Persons with normal hearing have two digestion products, each ∼86 bp. A 100-bp ladder was used as a size reference.

416

Fig. 4 COL11A2 mutation in the American family. a, Sequence data from a hearingimpaired person (V:3) and a relative with normal hearing (V:5) in the American DFNA13 family. A heterozygous missense mutation in exon 42 (nt 1,647) results in thymidine replacing a cytidine residue. b, Amino acid and nucleotide sequence of COL11A2 exon 42 comparing mutant and wild-type alleles of the American DFNA13 family. The point mutation produces an arginine-to-cysteine (red) amino acid change (Arg549Cys). HSU32169 and J04974 omit a cytidine (nt 1,638) and insert a guanosine (nt 1,644, blue). c, Restriction digest with SfoI shows an undigested 323-bp PCR product in individuals with hearing impairment in the American DFNA13 family. Persons with normal hearing have two digestion products of 187 and 136 bp. A 100-bp ladder is used as a size reference.

Our data show 100% sequence identity with BAC 1033B10 and are consistent with bi-directional sequencing data from five individuals with normal hearing. Further data to support our sequence as correct were generated by running the BLAST (basic local alignment search tool) algorithm (NCBI) with the predicted amino acid sequence derived from our sequence against predicted amino acid sequences derived from HSU32169 and J04974 (Fig. 4b). The TBLASTN search performed without a filter resulted in 100% homology for our predicted amino acid result and that of three mouse Col11A2 clones: MMU16789, S54563 and AF100956. SSCP analysis and bi-directional sequencing of all PCR products of COL11A2 in the DFNA13 Dutch family revealed a heterozygous G→A transition in exon 31 that predicts a glycineto-glutamate substitution (Gly323Glu) in affected individuals

b wild type

5´

CGT CAG GGA CCC AAG Arg Gln Gly Pro Lys

3´

mutant

5´

CGT CAG GAA CCC AAG Arg Gln Glu Pro Lys

3´

c




Fig. 6 Wild-type mouse strain FVB/N. a, Light microscopy demonstrating a radial section of a cochlear turn in the wildtype mouse strain FVB/N. The tectorial membrane was compact and well organized (×400). b, Electron microscopy of the tectorial membrane (middle portion) in the radial plane of a wild-type mouse showed parallel, closely approximated, collagen fibers (×10,000; scale bar, 500 nm).

b

a

(Fig. 5a,b). This missense mutation was identifiable by SSCP and destroys a BsmF1 site in the wild-type allele (Fig. 5c). BsmF1 digestion analysis of the exon 31 PCR product indicated complete co-segregation with the hearing impairment in this family. The mutation was not found in an SSCP screen of 108 normal individuals. Col11a2-mutant mice We carried out click-evoked auditory brainstem response (ABR) testing on eight animals (3 homozygotes, Col11a2–/–; 3 heterozygotes, Col11a2+/–; 2 wild type). Col11a2–/– mice had moderateto-severe hearing impairment; Col11a2+/– and wild-type mice had similar hearing thresholds. The decrease in hearing sensitivity in homozygous mice compared with wild-type mice averaged 43 decibels (dB; range of 40 to 50 dB). The only morphologic inner-ear abnormality seen at the macroscopic or light microscopic levels was in the tectorial membrane, which appeared by light microscopy to be larger and less compact in homozygotes than in heterozygotes or wild-type mice (Figs 6a and 7a). Electron microscopy of the tectorial membrane in homozygotes showed collagen fibrils coursing through the tectorial membrane in an atypical and disorganized pattern (Fig. 7b). In the heterozygous and wild-type mice, these fibres followed a parallel course and were evenly spaced (Fig. 6b). There were no detectable differences in the inner and outer hair cells, non-sensory epithelial cells, organ of Corti, neural structures or stria vascularis. In situ hybridization The Col11a2 anti-sense probe hybridized strongly to the cartilaginous otic capsule of embryonic day (E) 15.5 mice (Fig. 8a) and only weakly to the cristae ampullaris (data not shown). Hybridization to the cochlear duct was not different from that observed with the sense probe (Fig. 8a,b). At P5, diffuse homogeneous hybridization was observed in the spiral limbus region and lateral wall of the cochlea (Fig. 8c,d) and confirmed under higher

a

article

magnification (data not shown). We detected weak Col11a2 RNA expression in the cristae ampullaris (Fig. 8e), as well as the saccular and utricular maculae (data not shown).

Discussion Autosomal dominant non-syndromic hearing loss is associated with mutations in genes that encode proteins involved in cytokinesis and actin polymerization (DIAPH1), gap junctions (GJB2, GJB3, GJB6), ion channels (KCNQ4), the extracellular matrix (COCH, TECTA), transcription factors (POU4F3) and unconventional myosins (MYO7A; Hereditary Hearing Loss Homepage, http://dnalab-www.uia.ac.be/dnalab/hhh/). We have shown here that mutations in COL11A2 result in congenital, non-progressive, non-syndromic sensorineural hearing loss greatest in the mid-frequencies, and that Col11a2–/– mice have moderate-to-severe hearing impairment in association with altered architecture of the tectorial membrane. Sensorineural hearing loss appears common to COL11A2 diseases and has been documented in all individuals reported with autosomal dominant or recessive OSMED syndrome (27/27), with the exception of two persons who were not tested13–15. All affected members of the American (24/24) and Dutch (21/21) DFNA13 families also had hearing loss, but without the symptomatic joint abnormalities, palatal clefting and midface hypoplasia characteristic of OSMED syndrome, suggesting that non-syndromic hearing loss is the mildest phenotype in the continuum of COL11A2 diseases. The observed clinical differences may be a consequence of mutation type and location, as well as other modifying factors. The Arg549Cys substitution in the American DFNA13 family is noteworthy for several reasons. First, cysteine residues in the carboxy and amino termini of COL11A2 are highly conserved across species and form intra- and inter-chain disulphide bonds. Second, cysteine residues are absent in the triple-helical region, where their phenotypic consequence is positionally dependent. For

b Fig. 7 Col11a2–/– mice. a, Cochlear turn of Col11a2–/– mice showed a normal organ of Corti with a slightly enlarged tectorial membrane (×400). b, Tectorial membrane (middle portion, radial section) in Col11a2–/– mice showed disorganized and widely spaced collagen fibrils by electron microscopy (×10,000; scale bar, 500 nm).


417


article


a

b

c

d

e

f

Fig. 8 In situ hybridization analysis of Col11a2 expression within the mouse inner ear. Temporal bones of E15.5 C57Bl/6J mice hybridized with antisense (a) or sense (b) riboprobes showed strong Col11a2 expression in the cartilaginous otic capsule (a, arrow). c–f, Temporal bones of P5 C57Bl/6J mice hybridized with antisense (c,e) or sense (d,f) riboprobes showed strong Col11a2 expression in the cartilaginous otic capsule, spiral limbus (c, arrows), lateral wall of the cochlea (c, arrowheads) and cristae ampullaris (e) (scale bar b,d, 0.5 mm; f, 50 m).

example, in osteogenesis imperfecta, a cysteine in the X or Y positions of the -G-X-Y- repeat results in mild disease, whereas replacement of a glycine with a cysteine in a similar triple-helical region results in perinatal lethality23. X or Y cysteine substitutions also result in stable type I collagen chains that are transported extracellularly23. Third, a mild arthritis phenotype is associated with an arginine-to-cysteine mutation in COL2A1 (ref. 24). These data suggest that the arginine-to-cysteine substitution in the American DFNA13 family results in a dominant-negative effect. The Gly323Glu substitution in exon 31 of the Dutch DFNA13 family is notable because a glycine-to-glutamate change in exon 59 (Gly955Glu) also causes a dominant OSMED phenotype14. The most common missense mutations in collagen genes result in glycine substitutions, and their phenotypic consequence reflects the importance of glycine in the normal carboxy-toamino propagation of the triple helix. Post-translational modification of the collagen backbone begins at the 3´ end and proceeds in a 5´ direction25. If this process is arrested by delayed helix propagation, protein hydroxylation continues unchecked. The more 5´ Gly323Glu DFNA13 mutation would not be expected to delay fibril formation to the same extent as the more 3´ Gly955Glu OSMED mutation, and as a result, over-hydroxylation would be less. This type of positional effect also has been reported with missense mutations in COL2A1 that alter glycine residues, causing phenotypes that range from isolated ocular abnormalities26 (exon 10, Gly67Asp) to lethal chondrodysplasias27 (exon 22, Gly310Asp). 418

The in-situ-hybridization studies of Col11a2 in the developing mouse cochlea showed a strong and diffuse expression pattern, consistent with biochemical analyses that detected type XI collagen in micro-dissected guinea pig cochleas28. Col11a2 expression did not appear to be higher in the region of the inner ridge cells, postulated to be the main source of type II collagen for the tectorial membrane29. Shorter exposure times may reveal subtle differences in Col11a2 expression levels between different cell populations in this region. Hybridization was not seen in the tectorial membrane, an expected finding as this structure is acellular. Col11a2 RNA expression also was detected in the neurosensory organs of the vestibular labyrinth, indicating that the observed vestibular areflexia in some affected members of the Dutch DFNA13 family may be due to abnormal COL11A2 protein in these structures. Although the function of type XI collagen in the inner ear is unknown, its association with type II collagen, which is known to be present in the tectorial membrane, led us to hypothesize that type XI collagen is essential for appropriate spacing of type II collagen within this structure. Three facts suggested that this hypothesis might be correct. First, approximately 40% of the protein content of guinea pig tectorial membrane consists of type II collagen, with lesser amounts of type IX and XI (ref. 28). Second, mutations in TECTA, encoding a major non-collagenous component of the tectorial membrane, also cause congenital, non-progressive autosomal dominant hearing impairment that can be worse in the mid-frequencies30 (DFNA8/12). Third, in both DFNA13 families, the hearing impairment is prelingual and nonprogressive, suggesting a congenital, permanent structural defect. The altered structural architecture of the tectorial membrane in Col11a2–/– mice supports this hypothesis. Normally the tips of the tallest stereocilia of the outer hair cells are embedded in the tectorial membrane, whereas the tips of the inner hair cells rest adjacent to this structure. Differential movement between the basilar membrane, on which the hair cells rest, and the tectorial membrane results in mechanical displacement of the stereocilia of the inner hair cells, opening mechanosensitive transduction channels. By changing the arrangement of the collagen fibrils in the tectorial membrane from an ordered parallel array to a more random pattern, the mechanical properties of the tectorial membrane are modified. We propose that the secondary effect is a sound-transduction apparatus that is less sensitive, which is identifiable as congenital sensorineural hearing impairment. Our data also suggest that tectorial membrane abnormalities may cause hearing loss that is greatest in the mid-frequencies.

Methods Family data. We ascertained the American family through the Department of Otolaryngology-Head and Neck Surgery, University of Iowa, and the Dutch family through the Department of Otorhinolaryngology, University Hospital, Nijmegen, The Netherlands. We collected family and medical history, physical examination results and audiometric profiles after obtaining informed consent from each individual (American family, n=48; Dutch family, n=49). Peripheral venous blood was collected by venipuncture from consenting individuals. Procedures complied with accepted protocols from the Institutional Review Boards at the respective institutions. PCR analysis for genotyping and fine-mapping. We performed PCR amplification of DNA for genotyping as described21. In general, samples were subjected to 1 min at 95 °C and then 30 cycles of 94 °C for 30 s, 53 °C for 30 s and 72 °C for 30 s. We resolved reaction products on 6% denaturing polyacrylamide gels (7.7 M urea) and visualized by autoradiography. Contig construction. We obtained YAC addresses by screening selected primer pairs against DNA from samples in the CEPH A and CEPH B YAC nature genetics • volume 23 • december 1999


screening sets; YAC clone Y42 was provided by Y.Y. Kikuti31. P1-artificial chromosome addresses were obtained by screening human PAC pools (Genome Systems).


Mutation analysis. We tested genes within the DFNA13 candidate interval for evidence of inner-ear expression by PCR amplification against a human fetal cochlear cDNA library22, and completed a mutation screen of three cochlear-expressed genes, RING1, RXRB and COL11A2, by SSCP analysis and bi-directional sequencing. We performed SSCP analysis using described PCR conditions21. Products were resolved on 0.5×MDE (FMC BioProducts) gels run at 20 watts with fan cooling (∼15 °C) for 6 h and visualized by autoradiography; band shifts were evaluated by sequencing using an Applied Biosystems (ABI) model 373 automated sequencer. Sequence data were compared with published sequences for COL11A2, RING1 and RXRB using the Sequencer 3.1 software program package (Gene Codes). Controls consisted of 108 CEPH grandparents who were evaluated by SSCP screening of exons 31 and 42 of COL11A2. Col11a2-mutant mice . The Col11a2 transgenic mouse line was created by insertion of a neomycin-resistance cassette in the reverse orientation between exons 27 and 28 of Col11a2, and maintained on the FVB/N mouse strain (D.J.P. et al., manuscript in preparation). Three-primer PCR was used to differentiate the mutant and normal Col11a2 alleles in individual mice, as described32. We performed ABR analyses in mice between five and six months of age housed in similar environments as described33,34. All testing was carried out in a soundproof chamber. For histologic and electron microscopic analyses, we collected temporal bones from six animals (2 homozygotes, 2 heterozygotes and 2 wild-type) following a lethal dose of ketamine, and prepared them using standard procedures35–38. All animal experiments were performed in a humane manner according to standards set forth by the National Institutes of Health.

1. 2. 3. 4. 5. 6. 7.

8.

9. 10.

11.

12.

13. 14.

15.

16. 17.

18. 19. 20.

Morton, N.E. Genetic epidemiology of hearing impairment. Ann. NY Acad. Sci. 630, 16–31 (1991). Gates, G.A., Couropmitree, N.N. & Myers, R.H. Genetic associations in age-related hearing thresholds. Arch. Otolaryngol. Head Neck Surg. 125, 654–659 (1999). Van Camp, G., Willems, P. & Smith, R.J.H. Nonsyndromic hearing loss: unparalleled heterogeneity. Am. J. Hum. Genet. 60, 758–764 (1997). Kivirikko, K.I. Collagens and their abnormalities in a wide spectrum of diseases. Ann. Med. 25, 113–126 (1993). Slepecky, N.B., Savage, J.E. & Yoo, T.J. Localization of type II, IX and V collagen in the inner ear. Acta Otolaryngol. (Stockh.) 112, 611–617 (1992). Ala-Kokko, L. & Prockop, D.J. in Kelly’s Textbook of Rheumatology (eds Kelly, W.N., Harris, E.D. Jr, Ruddy, S. & Sledge, C.B.) (W.B. Saunders, St. Louis, in press). Mendler, M., Eich-Bender, S.G., Vaughan, L., Winterhalter, K.H. & Bruckner, P.J. Cartilage contains mixed fibrils of collagen types II, IX, and XI. Cell Biol. 108, 191–197 (1989). Eikenberry, E.F., Mendler, M., Burgin, R., Winterhalter, K.H. & Bruckner, P. in Articular Cartilage and Osteoarthritis (ed. Keuttner, K.E.) 133–149 (Raven Press, New York, 1991). Li, Y. et al. A fibrillar collagen gene, Col11a1, is essential for skeletal morphogenesis. Cell 80, 423–430 (1995). Vuoristo, M.M. et al. Complete structure of the human COL11A2 gene: the exon sizes and other features indicate the gene has not evolved with genes for other fibriller collagens. Ann. NY Acad. Sci. 785, 343–344 (1996). Zhidkova, N.I., Justice, S.K. & Mayne, R. Alternative mRNA processing occurs in the variable region of the pro-α 1(XI) and pro-α 2(XI) collagen chains. J. Biol. Chem. 21, 9486–9493 (1995). Kimura, T. et al. The human α 2(XI) collagen (COL11A2) chain. Molecular cloning of cDNA and genomic DNA reveals characteristics of a fibrillar collagen with differences in genomic organization. J. Biol. Chem. 264, 13910–13916 (1989). Vikkula, M. et al. Autosomal dominant and recessive osteochondrodysplasias associated with the COL11A2 locus. Cell 80, 431–437 (1995). Pihlajamaa, T. et al. Heterozygous glycine substitution in the COL11A2 gene in the original patient with the Weissenbacher-Zweymuller syndrome demonstrates its identity with heterozygous OSMED (nonocular Stickler syndrome). Am. J. Med. Genet. 80, 115–120 (1998). Sirko-Osadsa, D.A. et al. Stickler syndrome without eye involvement is caused by mutations in COL11A2, the gene encoding the α-2 (XI) chain of type XI collagen. J. Pediatr. 132, 368–371 (1998). Jacobson, J., Jacobson, C. & Gibson, W. Hearing loss in Stickler’s syndrome: a family case study. J. Am. Acad. Audiol. 1, 37–40 (1990). Mayne, R., Brewton, R.G., Mayne, P.M. & Baker, J.R. Isolation and characterization of the chains of type V/type XI collagen present in bovine vitreous. J. Biol. Chem. 268, 9381–9386 (1993). Spranger, J. The type XI collagenopathies. Pediatr. Radiol. 28, 745–750 (1998). Kunst, D., Kunst, H.P.M., Brunner, H. & Cremers, C. Audiological analysis of the phenotype of DFNA13. Laryngoscope (in press). van Steensel, M.A., Buma, P., de Waal Malefijt, M.C., van den Hoogen, F.H. & Brunner, H.G. Oto-spondylo-megaepiphyseal dysplasia (OSMED): clinical


article

In situ hybridization. We generated a hybridization probe for the 5´-UTR of Col11a2 mRNA by PCR amplification of NIH 3T3 mouse genomic DNA (100 ng) with primers 5´–CTCCAGGAGTAGGGGTGTACCATTC–3´ and 5´–CACCAGAGGTAGGAAAAGGAGG–3´. The resulting 424-bp product (corresponding to nt 1,325–1,750 of the Col11a2 cDNA) was cloned into pGEM-T Easy (Promega) and sequenced to confirm the identities and orientations of the inserts. We confirmed specificity of the antisense probe by hybridization to a single restriction fragment in Southern-blot analyses of mouse genomic DNA. Sense and antisense riboprobes for in situ hybridization were generated with T7 RNA polymerase in the presence of [35S]-UTP and [35S]-ATP (Amersham). Hybridization tissue substrates were temporal bones from C57BL/6J mice at E15.5, post-natal day (P) 1 and P5. We fixed temporal bones overnight in 4% paraformaldehyde/1×PBS at 4 °C, and processed them essentially as described36. Transverse sections (10 µm) of paraffinembedded tissue were used as hybridization substrates. GenBank accession numbers. COL11A2, HSU32169, J04974 and AL031128 (derived from BAC 1033B10); RING1 and RXRB, AL031228 and J04974; Col11a2 cDNA, U16790; Col11A2, MMU16789, S54563 and AF100956. Acknowledgements

We thank B. Robinson for technical assistance; S. Sullivan, D. Wu and D. Anderson for technical advice; and T. Friedman and R. Morell for comments and suggestions. Supported in part by NIH Otolaryngology Research Training Grant 5-T32-DC00040 (W.T.M.), Heinsius Houbolt Foundation, Nijmegan KNO Research Fund, NIH intramural research fund Z01-DC00054-01 (A.J.G.) and RO1-DC03544 (R.J.H.S.).

Received 19 July; accepted 25 October 1999.

21. 22.

23.

24. 25. 26.

27.

28. 29.

30. 31.

32. 33. 34. 35. 36. 37. 38.

description of three patients homozygous for a missense mutation in the COL11A2 gene. Am. J. Med. Genet. 70, 315–323 (1997). Brown, M.R. et al. A novel locus for autosomal dominant nonsyndromic hearing loss, DFNA13, maps to chromosome 6p. Am. J. Hum. Genet. 61, 924–927 (1997). Robertson, N.G., Khetarpal, U., Guitierrez-Espelata, G.A., Bieber, F.R. & Morton, C.C. Isolation of novel and known genes from a human fetal cochlear cDNA library using subtractive hybridization and differential screening. Genomics 23, 42–50 (1994). Steinmann, B., Nicholls, A. & Pope, F.M. Clinical variability of osteogenesis imperfecta reflecting molecular heterogeneity: cysteine substitutions in the α 1(I) collagen chain producing lethal and mild forms. J. Biol. Chem. 261, 8958–8964 (1986). Bleasel, J.F. et al. Five families with arginine 519-cysteine mutation in COL2A1: evidence for three distinct founders. Hum. Mutat. 12, 172–176 (1998). Fessler, J.H. & Fessler, L.I. Biosynthesis of procollagen. Annu. Rev. Biochem. 47, 129–162 (1978). Korkko, J. et al. Mutation in type II procollagen (COL2A1) that substitutes aspartate for glycine α 1-67 and that causes cataracts and retinal detachment: evidence for molecular heterogeneity in the Wagner syndrome and the Stickler syndrome (arthro-ophthalmopathy). Am. J. Hum. Genet. 53, 55–61 (1993). Bonaventure, J. et al. Substitution of aspartic acid for glycine at position 310 in type II collagen produces achondrogenesis II, and substitution of serine at position 805 produces hypochondrogenesis: analysis of genotype-phenotype relationships. Biochem. J. 307, 823–830 (1995). Thalmann, I. Collagen of accessory structures of organ of Corti. Connect. Tissue Res. 29, 191–201 (1993). Khetarpal, U. & Morton, C.C. Inner ridge cells may be the main source of tectorial membrane type II collagen: evidence from quantitative mRNA in situ hybridization. Acta Otolaryngol. (Stockh.) 118, 177–184 (1998). Verhoeven, K. et al. Mutations in the human α-tectorin gene cause autosomal dominant non-syndromic hearing impairment. Nature Genet. 19, 60–62 (1998). Kikuti, Y.Y. et al. Physical mapping 220 kb centromeric of the human MHC and DNA sequence analysis of the 43-kb segment including the RING1, HKE6, and HKE4 genes. Genomics 42, 422–435 (1997). Busler, D.E. & Li, S.W. Rapid screening of transgenic type II and type XI collagen knock-out mice with three-primer PCR. Biotechniques 21, 1002–1004 (1996). Erway, L.C., Willott, J.F., Archer, J.R. & Harrison, D.E. Genetics of age-related hearing loss in mice: I. Inbred and F1 hybrid strains. Hear. Res. 65, 125–132 (1993). Miller, C.A., Abbas, P.J. & Robinson, B.K. The use of long-duration current pulses to assess nerve survival. Hear. Res. 78, 11–26 (1994). Spurr, A.R. A low-viscosity epoxy resin embedding medium for electron microscopy. Ultrastruct. Res. 26, 31 (1969). Spoendlin, H. & Brun, J.P. The block surface technique for evaluation of cochlear pathology. Arch. Otol. Rhinol. Laryngol. 208, 137–145 (1974). Leake, P.A. & Hradek, G.T. Cochlear pathology of long-term neomycin induced deafness in cats. Hear. Res. 33, 11–34 (1988). Tsuprun, V. & Santi, P. Ultrastructural organization of proteoglycans and fibrillar matrix of the tectorial membrane. Hear. Res. 110, 107–118 (1997).

419