Mycobacteriosis in marine- and freshwater fishes: characterization of the disease and identification of the infectious agents
Mulualem Adam Zerihun
Thesis for the degree of Philosophiae Doctor (Ph.D)
Norwegian School of Veterinary Science
Norwegian Veterinary Institute
Oslo 2012
DEDICATION To my late father, Meri-Geta Adam Zerihun
Table of contents 1. Acknowledgements ..................................................................................................................... 4 2. Abbreviations .............................................................................................................................. 6 3. List of papers .............................................................................................................................. 7 4. Summary in English ................................................................................................................... 8 5. Summary in Norwegian (sammendrag) ................................................................................. 10 6. Introduction .............................................................................................................................. 12 6.1. Norwegian fisheries and aquaculture .................................................................................. 12 6.2. Disease and disease control in Norwegian aquaculture ...................................................... 13 6.2.1. Infectious diseases in farmed Atlantic salmon ............................................................. 14 6.2.2. Infectious diseases in farmed Atlantic cod ................................................................... 15 6.2.3. Use of antibiotics in Norwegian aquaculture ............................................................... 16 6.3. Mycobacteria and mycobacterial infections ........................................................................ 17 6.3.1. The genus Mycobacterium ........................................................................................... 17 6.3.2. Classification of mycobacteria ..................................................................................... 18 6.3.3. Human infections ......................................................................................................... 22 6.3.4. Piscine mycobacteriosis ............................................................................................... 23 6.3.5. The immune response in fish and pathogenesis of mycobacteriosis ............................ 28 6.3.6. Diagnosis of mycobacteriosis....................................................................................... 32 7. Aim of the study........................................................................................................................ 35 8. Design of the study ................................................................................................................... 36 9. Summary of papers .................................................................................................................. 37 9.1. Paper I ................................................................................................................................. 37 9.2. Paper II ................................................................................................................................ 37 9.3. Paper III ............................................................................................................................... 38 9.4. Paper IV............................................................................................................................... 38 10. Discussion ................................................................................................................................ 40 10.1. Methods ............................................................................................................................. 40 10.1.1. Experimental infection ............................................................................................... 40 10.1.2. Sample handling and processing ................................................................................ 42 10.1.3. Culture ........................................................................................................................ 42 10.1.4. Histopathological examination ................................................................................... 44 10.1.5. Genus-level detection of mycobacteria during infections .......................................... 45 10.1.6. Identification of field isolates to the species level ..................................................... 48 10.2. The disease ........................................................................................................................ 49 10.2.1. Aetiology .................................................................................................................... 49 10.2.2. Piscine hosts susceptible to Mycobacterium salmoniphilum infection ...................... 49 10.2.3. Clinical signs and histopathological lesions ............................................................... 51 10.2.4. Transmission and source of infection ......................................................................... 53 10.2.5. Are there contributory factors to piscine mycobacteriosis? ....................................... 54 11. Main conclusions .................................................................................................................... 57 12. Future work ............................................................................................................................ 58 13. References ............................................................................................................................... 59
1. Acknowledgements This work was conducted at the then Section for Fish Health, Norwegian Veterinary Institute (NVI) in Oslo, Norway. The project was financed by the Research Council of Norway, Strategic Institute Program- Bacterial challenges in aquaculture of marine fish diseases (grant nr. 158882).
First of all I am indebted to NVI, especially the Section for Fish Health, for providing the opportunity for study and the Norwegian Research Council for financing the project.
My special thanks go to my first supervisor, Dr. Duncan J. Colquhoun for his help with planning of experiments, labwork, co-authorship, critical review of the thesis and his encouragement throughout the study period, Thanks Duncan!; Prof. Henning Sørum, my cosupervisor for his excellent contribution in planning the experiments, follow-up, critical reading of manuscripts and the thesis. I am also indebted to Dr. Ole-Bendik Dale my third supervisor for critically reviewing my thesis. I thank Hanne Nilsen for providing field samples which played a central role in this project, and her contributions to the salmon experiment and her co-authorship.
My gratitude goes to Dr. Atle Lillehaug, head of the then Section for Fish Health, for always being at my side for all academic and administrative matters and critically reviewing the manuscripts and this thesis. My special thanks go to Agnar Kvellestad, who taught me fish pathology and the ABC of Photoshop. I would also like to thank my co-authors Dr. Knut Falk, Prof. Trygve T. Poppe, Vidar Berg, Dr. Jan L. Lyche, Monika J. Hjortaas and Synnøve Hodneland for their co-authorship.
My gratitude goes to Mona Gjessing, Hilde Welde, Anne Kristin Jøranlid for their assistance in fish sampling during experimental infections and Inger-Lise Engen, Nora M. Tandstad and Cathrine F. Melvold for assistance with labwork. I also express my thanks to Drs. Birgit Dannevig and Tore Tollersrud, previous and current superiors, respectively for their patience and providing me the time I needed to write this thesis. Drs. Ingrid Olsen and my friend Johan Åkerstedt are acknowledged for reviewing my thesis. The technical staff at the Section for Pathology at NVI are also acknowledged for processing tissue sections. Drs. Irene Ørpetveit, Turhan Markussen, Terje Steinum and Stig Tollefsen are acknowledged for technical 4
assistance during writing of the thesis. I thank my colleagues Katrine Håland, Drs. Siv Klevar and Anne Nordstoga for sharing my duties at section for immunology during the long process of writing this thesis.
My special thanks also go to Dr. Jorun Tharaldsen, former head of the Section for Virology and Serology, who gave me the first opportunity to start working at the Norwegian Veterinary Institute; in this respect I am also indebted to Dr. Jorun Jarp.
I am grateful to the staff of the Department for Environmental Aquatic Animal Health at the Virginia Institute of Marine Sciences, USA, for hosting and assisting me with administrative and academic matters while I stayed there as a visiting scientist.
The moral support of my mother, Yitayish Yirdaw, my sisters and brothers and my friends was very special to me, thank you all! My very special thanks go to my wife, Etagegnehu Belete, for her love, patience and care during the long study period. My little princess, Abigail- thank you for energizing me with your love!
Mulualem Adam Zerihun Oslo, 2012
5
2. Abbreviations AFB
Acid-fast bacilli
ATCC
American type culture collection
bp
base pair(s)
CFU
Colony forming unit
DNA
Deoxyribonucleic acid
FFPE
Formalin fixed paraffin-embedded
g
Gram
Hsp65
Heat shock protein 65 kDa
IHC
Immunohistochemistry
i.p.
Intra-peritoneal
ITS
Internal transcribed spacer
MDA
Middlebrook 7H10 Agar
MHC
Major histocompatibility complex
µm
Micro-meter
NTM
Nontuberculosis (Nontuberculous) mycobacteria
NVI
Norwegian Veterinary Institute
PCR
Polymerase chain reaction
rDNA
Ribosomal deoxyribonucleic acid
RNA
Ribonucleic acid
rpoB
RNA polymerase beta (β) subunit
sp.
Species
spp.
Species (plural)
ssp.
Subspecies
ZN
Ziehl-Neelsen
6
3. List of papers Paper I
Zerihun M.A., Hjortaas M.J., Falk K. & Colquhoun D.J. (2011) Immunohistochemical and Taqman real-time PCR detection of mycobacterial infections in fish. Journal of Fish Diseases 34, 235-246.
Paper II
Zerihun M.A., Nilsen H., Hodneland S. & Colquhoun D.J. (2011) Mycobacterium salmoniphilum infection in farmed Atlantic salmon, Salmo salar L. Journal of Fish Diseases 34, 769-781 and erratum in 34, 959-960.
Paper III
Zerihun M.A., Berg V., Lyche Y.L., Colquhoun D.J. & Poppe T.T. (2011) Mycobacterium salmoniphilum infection in burbot Lota lota. Diseases of Aquatic Organisms 95, 57-64.
Paper IV
Zerihun M.A., Colquhoun D.J. & Poppe T.T. (2012) Experimental Mycobacteriosis in Atlantic cod, Gadus morhua L. Journal of Fish Diseases 35, 365-377.
The papers are referred in the text by their Roman numbers
7
4. Summary in English Mycobacterial infections in fish are invariably referred to as piscine tuberculosis or mycobacteriosis, irrespective of the specific identity of the causal Mycobacterium sp. The disease is largely sub-acute to chronic in nature and affects fish in fresh-, brackish- and seawater. The disease may cause both external and internal lesions, which can easily be confused with other diseases unless mycobacteria-specific diagnostic tools are employed to detect the pathogen.
Sensitive and truly genus-wide real-time polymerase chain reaction (real-time PCR) and immunohistochemical diagnostic tools, which are applicable both in disease diagnosis and research, were established (Paper I). Mycobacterium salmoniphilum was found to be an important fish pathogen of both gadoid and salmonid fishes. The clinical and pathological features of mycobacteriosis caused by M. salmoniphilum were characterized in farmed Atlantic salmon (Paper II), burbot (Paper III) and Atlantic cod (Paper IV). The mycobacterial infection described in burbot (Paper III) is the first of its kind. The infection study in Atlantic cod has shown that mycobacteriosis is a prospectively important future disease in farming of this fish species. Pathological lesions characterized by severe granuloma formation were identified in cod and burbot infections, while this type of lesion was identified as either mild or even absent in Atlantic salmon. Granulomatous lesions attributed to mycobacterial infection in Atlantic cod showed a series of developmental stages, the identification and characterisation of which comprise important knowledge in relation to assessment of disease progression and estimation of time of infection.
Prior to the present study, very few studies have been performed relating to piscine mycobacteriosis in aquaculture in Norway. Reports of piscine mycobacteriosis were at best sporadic and were mainly from ornamental and wild fish. These diagnoses were limited to Ziehl-Neelsen (ZN) staining of tissue sections and basic phenotypical testing of bacterial isolates on the rare occasions that the responsible bacterium was cultured. The prevalence of the disease and associated losses in Atlantic salmon and a cold-water gadoid fish species i.e. burbot and Atlantic cod identified in the present study, may indicate a wider distribution of the disease both in terms of host range and climate range than previously considered. Although an epidemiological study on a larger scale is required to more accurately describe the prevalence, particularly in farmed fish, the previously insignificant numbers of reports 8
from Norway may be due in part, to low awareness of the clinical features of piscine mycobacteriosis in different fish species. Current diagnostic practices for mycobacteriosis depend to a greater or lesser reliance on the presence of granulomatous lesions. In salmonids, therefore, the infrequency or absence of „typical‟ mycobacterial related pathological changes combined with the less sensitive diagnostic tools currently available in most fish disease investigation laboratories and the dominance of other differential diagnostically important diseases, there is a risk that mycobacterial related disease may be overlooked. The present study has broadened the knowledge base related to mycobacterial infections of fish, particularly in cold water environments. The results should, therefore, draw the attention of fish pathologists and other fish health professionals to the possibilities of mycobacterial infections in fish; thereby increasing the likelihood of further diagnosis of the disease and implementation of loss minimization strategies.
9
5. Summary in Norwegian (sammendrag) Mykobakterieinfeksjoner i fisk kalles fisketuberkulose eller mykobakteriose, uavhengig av den spesifikke Mycobacterium sp. som forårsaker sykdommen. Sykdommen er i stor grad subakutt til kronisk, og påvirker fisk i fersk-, brakk- og sjøvann. Symptomer omfatter både eksterne og interne lesjoner som lett kan forveksles med andre sykdommer, med mindre mykobakterier påvises med spesifikke diagnostiske verktøy.
To sensitive diagnostiske metoder basert på henholdsvis real-time polymerase chain reaction (real-time PCR) og immunhistokjemi, ble etablert (Paper I). Begge metodene detekterer et bredt spektrum av mykobakterier, og er anvendelige for både diagnostiske formål og forskningsformål. Studiet har vist at M. salmoniphilum er en viktig patogen både i lakse- og torskefisk. Fremtredende patologiske funn ved mykobakteriose forårsaket av M. salmoniphilum er karakterisert i oppdrettslaks (Paper II) oppdrettstorsk (Paper IV) og lake (Paper III). Mykobakterieinfeksjon i lake, en vill torskefisk, er beskrevet for første gang. Infeksjonsstudiet i paper IV har vist at mykobakteriose er en potensielt viktig sykdom hos oppdrettstorsk i fremtiden (Paper IV). Patologiske lesjoner i form av alvorlige granulomdannelser ble påvist hos torsk og lake med M. salmoniphilum-infeksjon, mens bare milde eller noen ganger ingen av denne type lesjoner ble identifisert hos atlantisk laks. Granulomatøse lesjoner forårsaket av mykobakterieinfeksjon hos torsk ble vist å gjennomgå flere utviklingsstadier. Identifisering og karakterisering av de ulike stadiene er viktig for vurdering av sykdomsutviklingen, og for å kunne anslå smittetidspunktet.
Kunnskap om betydningen av mykobakteriose for norsk fiskeoppdrettsnæring har så langt vært begrenset. Innrapportering av fiskemykobakteriose til offentlig forvaltning har i beste fall vært sporadisk, og de fleste tilfellene har vært påvist hos akvariefisk og villfisk. Diagnostisering av sykdommen har tidligere vært begrenset til Ziehl-Neelsen (ZN) farging av vevssnitt, i tillegg til klassiske fenotypiske tester i de få tilfellene hvor bakteriedyrking er utført. Forekomsten av sykdom hos atlantisk laks i oppdrett med påfølgende økonomisk tap, og forekomst av sykdom hos torskefisk, slik som beskrevet i denne studien, tyder på at sykdommen er mer utbredt både med hensyn til vertsspekter og klimavariasjoner enn tidligere antatt. Fiskemykobakteriose i oppdrettsnæringen antas å være underrapportert, noe som sannsynligvis skyldes liten kunnskap om patologiske forandringer som følger av sykdommen. En større epidemiologisk studie er derfor nødvendig for å beskrive utbredelsen av bakterien 10
mer presist, spesielt i oppdrettsfisk. Dagens praksis for diagnostisering av mykobakteriose avhenger i større eller mindre grad av tilstedeværelse av granulomatøse lesjoner. Risikoen er stor for at sykdom hos laksefisk forårsaket av mykobakterier kan bli oversett. Grunnen til dette er at hos laksefisk mangler de typiske granulomatøse patologiske forandringer som normalt forårsakes av mykobakterieinfeskjoner hos andre dyrearter. I tillegg har de fleste fiskehelselaboratorier kun lite sensitive diagnostiske verktøy tilgjengelig og siden forekomsten av de viktigste differensialdiagnostiske sykdommer er vanligere enn infeksjoner med mykobakterier gjør dette at mykobakterieinfeskjoner hos fisk trolig er underdiagnostisert. Denne studien bidrar til økt kunnskap om mykobakterieinfeksjon hos fisk, spesielt i kaldtvannsmiljøer. Resultatene fra denne studien vil forhåpentligvis føre til at fiskepatologer og annet fiskehelsepersonell får økt oppmerksomhet og større fokus på mykobakterieinfeksjoner hos fisk. Dette vil også øke sannsynligheten for en økende påvisning av mykobakterioser hos fisk i fremtiden. Resultatet vil bli en økende oppmerksomhet omkring sykdommen og utvikling av strategier for å minimere tap som følge av mykobakterioser.
11
6. Introduction 6.1. Norwegian fisheries and aquaculture Fish play an important role in satisfying the ever-increasing world-wide demand for protein. On a global basis, 117.8 million tonnes of fish harvested from wild catch and aquaculture were channelled to human consumption in 2009, of which 46.7% was produced in aquaculture settings (FAO 2010). In the years 2004-2009, annual increases were registered in production of fish in aquaculture, while harvests from wild catches hovered between stagnation and decline (Table 1).
Table 1. World fisheries and aquaculture production and utilization. Reprinted with permission from Food and Agriculture Organization (FAO 2010), slightly modified. Production
2004
2005
2006
2007
2008
2009*
(Million tonnes) Inland Capture Aquaculture Total inland
8.6 25.2 33.8
9.4 26.8 36.2
9.8 28.7 38.5
10.0 30.7 40.6
10.2 32.9 43.1
10.1 35.0 45.1
Marine Capture Aquaculture Total marine
83.8 16.7 100.5
82.7 17.5 100.1
80.0 18.6 98.6
79.9 19.2 99.2
79.5 19.7 99.2
79.9 20.1 100.0
Total capture Total aquaculture Total world fisheries
92.4 41.9 134.3
92.1 44.3 136.4
89.7 47.4 137.1
89.9 49.9 139.8
89.7 52.5 142.3
90.0 55.1 145.1
Utilization Human consumption Non-food uses Per capita food fish supply (kg)
104.4 29.8 16.2
107.3 29.1 16.5
110.7 26.3 16.8
112.7 27.1 16.9
115.1 27.2 17.1
117.8 27.3 17.2
*provisionally estimated data
Fisheries and aquaculture production in Norway is favoured by the country‟s long coastline with its large number of protected fjords and year round suitable seawater conditions. Norway is now the world‟s largest producer and exporter of farmed salmonid fish. Norwegian wild fisheries management is based on sound fishing practices and comprehensive and stringent monitoring systems to avoid over-fishing. In 2010, close to 2.7 million tonnes of fish were harvested from the wild in Norway. The same year, close to 950 000 tonnes of farmed fish,
12
mainly salmon, trout and cod, were produced which generated around 4 billion Euros (Anonymous 2011).
Technological innovation in the field of larval production combined with regulated wildfisheries make farming of both salmonid and marine fish species increasingly commercially attractive. The main farmed fish species in Norway are Atlantic salmon, Salmo salar L. rainbow trout, Oncorhynchus mykiss (Walbum) and the newly introduced Atlantic cod, Gadus morhua L. Atlantic cod farming remains a prospectively important aquaculture industry to many other countries in the Northern Atlantic region (Standal and Utne 2007; Bleie 2009). As early as in 1997 the production volume of farmed salmonids in Norway was already greater than the total production of pigs, cattle and poultry (Gjøen and Bentsen 1997). As production of farmed fish has increased, the number of seawater fish farm companies has, however, decreased from 1607 in 2007 to 1241 in 2010, illustrating the change from smaller family owned businesses to large multi-national companies. The Marine Harvest group is one example of a multi-national company operating aquaculture facilities in eighteen countries around the world with around 7500 employees (Anonymous 2009b).
6.2. Disease and disease control in Norwegian aquaculture In both land-based livestock farming and aquaculture, intensification of production is characterised by containment of large numbers of animals in limited spaces. Although hygienic measures and minimization of stress are part of normal routines in modern aquaculture, large numbers of fish can be a hinder to the execution of daily supervision, treatment and recovery of dead fish. This situation therefore may create ideal conditions for spread of disease within the cage-population (Poppe et al. 2007). Adjustment of management practices and industry structure in aquaculture settings is one of the focuses of the Norwegian Ministry of Fisheries and Coastal Affairs in an effort to minimize production losses. Moreover, selection for disease resistance traits has also become one of the focuses in fish breeding goals (Moen et al. 2009) which may help alleviate the challenges in intensive farming of both established (Atlantic salmon and rainbow trout) and newly introduced fish species including Atlantic cod. However, breeding for disease resistance is complex and resistance against one infection does not necessarily imply increased protection against infections in general (Midtlyng et al. 2002). Besides technological innovations and genetic improvement for disease resistance, biological disease control strategies are already in use in 13
Norwegian aquaculture. Use of cleaner fish e.g. wrasse and lumpsucker, against the salmon louse (Lepeophtheirus salmonis; Olsen and Hellberg 2012) represents a practical example of biological disease control.
With the establishment of new species in fish farming, there is good reason to believe that bacterial infections will hamper early development of such culture considerably. Bacterial agents caused significant losses during the initial phases of salmon farming industry. This trend has already been confirmed in initial cod farming mainly with heavy losses related to francisellosis, vibriosis and atypical furunculosis. It is, therefore, vitally important that intensive research be conducted to meet the challenges faced by bacterial pathogens at an early stage of development of this fragile new industry. Besides development of rapid and reliable diagnostic tools, it is important to evaluate thoroughly the risk of spread of bacterial diseases from one fish species to another and from farmed to wild stocks and vice versa. Although tremendous achievements have been made related to the control of bacterial diseases which historically constrained the Norwegian aquaculture industry through extensive vaccination and improved management practices, infectious diseases still remain one of the main challenges in aquaculture. Of total losses in 2007 (mortality due to diseases, predation, escapes and condemnations at slaughter), around 90% were disease related (Anonymous 2009a).
6.2.1. Infectious diseases in farmed Atlantic salmon In the early years of intensive Atlantic salmon farming, severe problems with bacterial infections, in particular coldwater vibriosis (Vibrio salmonicida), to some extent vibriosis (Vibrio anguillarum), and later furunculosis (Aeromonas salmonicida ssp. salmonicida) emerged. These diseases were initially treated with antibiotics, with varying degrees of success, but were later successfully controlled by vaccination (Lillehaug 1991). Bacterial kidney disease (BKD; Renibacterium salmoninarum) increased from the first few outbreaks in 1980 to become a serious problem during that decade with many chronically infected stocks. There are in practice neither efficient antibiotics nor vaccines for BKD, but sanitation of infected stocks and establishment of BKD free broodstocks brought this disease under control to a large degree (Table 2). The bacterial disease winter ulcer caused by Moritella viscosa continues to cause significant economic losses (Grove et al. 2010).
14
Viral diseases became and remain economically important in aquaculture of salmonids (Table 2). Pancreas disease (PD), infectious pancreatic necrosis (IPN) and infectious salmon anaemia (ISA) are the most important, together with heart and skeletal muscle inflammation (HSMI) and cardiomyopathy syndrome (CMS; Palacios et al. 2010; Haugland et al. 2011).
The parasitic salmon louse seriously affects salmon production (Pike and Wadsworth 1999). Although the salmon louse problem is long-standing, the development of sustainable methods of control and treatment are unable to keep pace with the intensification of production and the therapeutic resistance developed by the parasite (Denholm et al. 2002; Lees et al. 2008). Clinical problems caused by sea lice in Norwegian salmonid aquaculture are more or less under control. However, the infection pressure towards wild salmonids in coast-near waters, exerted by the sea lice larvae produced on numerous salmonids in aquaculture, is a serious threat to wild stocks (Bjørn and Finstad 2002; Krkošek et al. 2006; Marty et al. 2010).
Table 2. Diseases of farmed Atlantic salmon diagnosed by the Norwegian Veterinary Institute (NVI) 2005-2011. Figures indicate numbers of affected localities each year (Hellberg et al. 2008; Johansen et al. 2009; Bornø and Sviland 2010; Bornø and Sviland 2011; Olsen and Hellberg 2012). Disease 2005 2006 2007 2008 2009 2010 2011 Heart and skeletal muscle inflammation 83 94 162 144 139 131 162 Infectious pancreatic necrosis 208 207 165 158 223 198 154 Pancreas disease 45 58 98 108 75 88 89 Cardiomyopathy syndrome NS NS 85 75 76 53 74 Winter ulcer 34 30 NS 44 34 47 69 Infectious salmon anaemia 11 4 7 17 10 7 1 Furunculosis 1 3 4 3 0 0 0 Bacterial kidney disease 2 0 0 1 1 0 3 NS: No statistics available
6.2.2. Infectious diseases in farmed Atlantic cod The Atlantic cod is a relatively newly introduced fish species to intensive aquaculture, and farming of new species is inevitably followed by challenges from new diseases. A range of bacterial pathogens such as V. anguillarum (Larsen 1983) and atypical furunculosis (i.e. atypical A. salmonicida, including A. salmonicida ssp. achromogenes; Magnadóttir et al. 2002) were already known to be pathogens of farmed cod in addition to viral diseases like viral nerval necrosis/viral encephalopathy and retinopathy (VNN/VER; Hellberg et al. 2010; Table 3). Vibriosis caused by V. anguillarum has been the most frequently awarded diagnosis 15
in Atlantic cod, farmed in Norwegian fish farms since 2005. In 2006, the disease, francisellosis, caused by Francisella noatunensis ssp. noatunensis was first reported (Nylund et al. 2006; Olsen et al. 2006; Mikalsen et al. 2007). This disease has since become one of the major threats to Atlantic cod farming (Ottem et al. 2008) with outbreaks experienced in several regions of Norway.
Table 3. Diseases of farmed Atlantic cod diagnosed by the NVI from 2005 to 2011. Figures within each year indicate number of affected localities (Hellberg et al. 2008; Johansen et al. 2009; Bornø and Sviland 2010; Bornø and Sviland 2011; Olsen and Hellberg 2012). Disease Vibriosis Atypical furunculosis Francisellosis VNN/VER
2005 18 3 4 0
2006 19 13 7 3
2007 19 9 8 6
2008 21 16 14 3
2009 22 16 8 1
2010 10 5 3 0
2011* 5 5 3 0
*Number of farms sending samples to NVI was low compared to previous years
6.2.3. Use of antibiotics in Norwegian aquaculture Previously, prior to the development and widespread use of effective vaccines, antibiotic treatment was one of the main measures used to combat the bacterial challenges faced in salmon farming. As problems associated with bacterial infections increased with the growth of the Atlantic salmon farming industry, antibiotic use reached a peak in 1987 with close to 50 tonnes of active substance used (Grave et al. 2002; Lillehaug et al. 2003). The development of vaccines against V. salmonicida during the late 1980‟s and an improved vaccine against Aeromonas salmonicida ssp. salmonicida, from 1993, resulted in a dramatic drop in antibiotics used. The consumption of antibiotics in Norwegian aquaculture decreased to less than 1000 kilograms in less than 10 years (Grave et al. 2002; Lillehaug et al. 2003; Figure 1). However, due to problems associated with winter ulcer (caused by Moritella viscosa), use of antibiotics increased again slightly in 2002 (Lillehaug et al. 2003). In 2008, a total of 905 kilograms of antibiotics were used in Norwegian aquaculture, of which 342 kilograms were used for Atlantic salmon and rainbow trout, while the remainder 563 kilograms were used for marine species, mainly cod (Anonymous 2009a). The current decline in number of cod farms related to both disease and poor economy generally in the industry may also have contributed to decreased use of antibiotics.
Although successful vaccination program is undoubtedly important, other management and production related developments such as selection of optimal farm sites, strict on-farm 16
hygienic practices together with effective disease management practices contribute to the sustainability of Norwegian aquaculture and minimal use of antibiotics.
Figure 1. Annual consumption of antibiotics in the Norwegian aquaculture (1987-2007). Source: http://www.bellona.org/aquaculture/artikler/Antibiotics.
6.3. Mycobacteria and mycobacterial infections 6.3.1. The genus Mycobacterium Mycobacteria belong to the genus Mycobacterium within the family Mycobacteriaceae in the order Actinomycetales (Pitulle et al. 1992). Mycobacteria are aerobic, non-motile with diverse phenotypical characteristics and variable pathogenic potential. The genome of the genus Mycobacterium has a high G + C content. Mycobacteria may use intracellular growth to obtain nutrients and escape the immune system of the host (Amer and Swanson 2002). These bacteria are usually slightly curved or straight rods [0.2-0.6×1.0-10 μm (Holt and Bergey 1984; Frerichs 1993)]. They are acid alcohol fast at some stages of growth, and although they do not stain easily, are considered Gram-positive. Many species form white or cream-coloured colonies, while others produce yellow to orange carotenoid pigments. The majority of species are saprophytic organisms, found in soil and in aquatic environments (Falkinham 1996).
Mycobacterium spp. have a unique cell wall composed of peptidoglycan, arabinogalactan, and mycolic acids. The outer layer of this cell wall comprises an array of glycolipids, lipoglycans, and apolar lipids, which are closely associated with mycolic acids (Brennan and Nikaido 1995). This structure of tightly packed lipophilic molecules and highly branched 17
polysaccharides is largely responsible for the low permeability of the mycobacterial cell envelope (Figure 2). The mycolic acid content of the cell wall of the Genus Mycobacterium is similar to that of the genera Nocardia, Rhodococcus and Corynebacterium. The high lipid content of the cell wall gives mycobacterial species a hydrophobic nature and confers resistance to acids, disinfectants, many antibiotics as well as desiccation.
Figure 2. Schematic diagram of the mycobacterial cell wall. Source: http://en.wikipedia.org/wiki/Mycobacterium.
(1) outer lipids, (2) mycolic acid, (3) polysaccharides (arabinogalactan), (4) peptidoglycan, (5) cytoplasm, (6) lipoarabinomannan, (7) phosphatidylinositol mannoside and (8) cell wall skeleton
6.3.2. Classification of mycobacteria Classification and taxonomy of mycobacterial species is complicated and requires a combination of several approaches including bacterial colony characterization, biochemical and molecular analyses (Tortoli et al. 2001; Adékambi and Drancourt 2004; Wallace et al. 2005). Currently, the genus Mycobacterium includes 154 species in J.P. Euzéby‟s List of Bacterial Names with Standing in Nomenclature (http://www.bacterio.cict.fr/m/mycobacterium.html). The International Working Group on Mycobacterial Taxonomy (IWGMT) leads a co-ordinated approach to determination of the taxonomy of the genus Mycobacterium.
Based on pathogenicity, mycobacteria are divided into tuberculous (= tuberculosis) and nontuberculous (= nontuberculosis) mycobacteria (Eisenstadt and Hall 1995). The tuberculous 18
mycobacteria comprise the highly related M. tuberculosis-complex (M. tuberculosis, M. bovis, M. africanum, M. caprae, M. canettii, M. pinnipedii and M. microti). The nontuberculous mycobacteria (NTM) are commonly referred as atypical mycobacteria, mycobacteria other than tuberculosis mycobacteria (MOTT) or environmental mycobacteria (Dawson 2000), to which relevant fish pathogenic species such as M. chelonae, M. marinum and M. fortuitum belong. Based on colony pigmentation, three groups i.e. photochromogenic, scotochromogenic and nonchromogenic mycobacteria, are recognised (Runyon 1959). The photochromogens produce pigment only when exposed to light while scotochromogenes produce pigment irrespective of light exposure. The nonchromogenic mycobacteria are those which do not produce pigment under any circumstances. This differentiation, however, lacks robustness, due to the fact that pigmentation is recognised to be temperature dependent in some cases and that not all strains of a species share pigment producing abilities (Skrypnyk 2010).
Mycobacteria can also be grouped into slow and rapidly growing mycobacteria. Rapidgrowers are species which under optimal nutrient and temperature regimes produce visible colonies on solid media in less than seven days, while slow-growers take more than seven days to give visible colonies (Holt and Bergey 1984; Lévy-Frébault and Portaels 1992; Goodfellow and Jenkins 1998). These divisions equate to rapidly growing mycobacteria having culture doubling times of 60 minutes to 5 hours, and slow growing mycobacteria with culture doubling times of over five hours (Colston and Cox 1999). While all mycobacteria are closely related (> 95%) at the 16S rDNA level (Stahl and Urbance 1990; Goodfellow and Jenkins 1998; Devulder et al. 2005), sequence analysis of this gene can give rapid classification of both slow and rapid growers (Figure 2). The majority of slowly growing mycobacteria contain a long helix 18 at position 430-500 (Escherichia coli 16S rDNA numbering), which is absent in rapidly growing mycobacteria (Springer et al. 1996; Tortoli 2003). It is not known if this sequence difference originated from a deletion or an insertion event. There are, however, „intermediate‟ species, possessing a short helix 18 (due to a 12 bp deletion), which are classified as slow growers (Tortoli 2003).
All species of the genus are believed to share a common ancestor, a rapidly growing saprophytic organism, and that evolutionary pressure has resulted in divergence into a lineage including slowly growing animal pathogens (Pitulle et al. 1992). One hypothesis for this divergence is that the ancestral species became adapted to survival within amoeba, with 19
subsequent evolution of the ability to survive within animal macrophages and other leucocytes (Cirillo et al.1997). Evidence that slowly growing species diverged from a rapidly growing ancestor are based on DNA/DNA hybridization analyses, and that slowly growing pathogenic species retain genes or partial genes more typically found in saprophytic organisms (Cole 1999). A multi-locus phylogenetic analysis by Devulder et al. (2005) supports the hypothesis that the slowly growing group branch from the rapidly growing mycobacteria.
20
Figure 2. Differentiation of fast- and slow growing mycobacteria using 16S rDNA sequences of selected isolates. The tree was constructed using Maximum likelihood MEGA V5.05, utilising the Kimura 2 parameter model with 1000 bootstraps. Missing data was deleted from the analysis. Numbers at nodes represent bootstrap values (values < 50% are omitted). The tree shows (A) Rapid growers (B) Slow growers. Source of M. salmoniphilum isolates: AUS = Australia, US = United States, UK = United Kingdom, NO = Norway. Bar, 0.005 substitutions per site.
21
6.3.3. Human infections Mycobacteriosis caused by M. tuberculosis is one of the most serious health problems in humans worldwide. It is considered that around one third of the world population has latent tuberculosis infection, which represents a huge reservoir for further transmission of the disease (Supply et al. 2001). In the 1980's, many experts felt that the days of tuberculosis as a threat to humankind had passed, despite the fact that the disease remained the leading infectious cause of death worldwide, as the incidence of new cases was slowly decreasing. The situation in the 1990's changed dramatically, primarily due to the association of tuberculosis with acquired immunodeficiency syndrome (AIDS). At the same time, multiple drug-resistant strains of M. tuberculosis appeared and continue to appear regularly. Based on a 2011 World Health Organization (WHO 2011) report, there were 8.8 million cases of tuberculosis in 2010, of which close to 1.1 million cases were among people with human immunodeficiency virus (HIV). The majority of cases were distributed throughout Asia (59%) and Africa (26%) with the remainder in the Eastern Mediterranean (7%), Europe (5%) and North and South America (3%). The report further pointed out that a total of 1.45 million deaths were registered in 2010, of which 350,000 were HIV associated tuberculosis cases. Reduction of human tuberculosis is one of the targets of the Millennium Development Goal and the incidence of cases has fallen since 2002, in many parts of the world with the exception of Africa. Nontuberculosis mycobacteria, to which the fish pathogenic species and the M. aviumcomplex (MAC; includes M. avium and M. intracellulare) belong, cause severe health problems in humans and are now recognized as one of the leading opportunistic infections associated with HIV and immunosuppressive treatments. Usually, atypical mycobacterial species cause local infections, which do not heal; however, they can also cause serious systemic disease in immunocompromised individuals. Infections caused by M. chelonae, M. kansasii, MAC and M. xenopi have been frequently reported in association with diverse diseases, including arthritis, tenosynovitis and osteomyelitis (Arend et al. 2001; Brutus et al. 2001; Nakamura et al. 2001; Villella et al. 2001; Lidar et al. 2003). Further, primary and/or secondary M. chelonae/abscessus, M. kansasii, M. fortuitum and M. marinum infections are reported to cause skin lesions (Anonymous 1997; De Smet 2008; Tigges et al. 2009). Catheterization associated infections in the urogenital system, granulomatous hepatitis and occasional pulmonary infections are reported in association with M. fortuitum (Smith et al.
22
2001). Skin granulomatoses due to M. marinum infection from public swimming pools were commonly diagnosed prior to improvement of sanitation measures in such settings and the disease was commonly referred to as „swimming pool granuloma‟ (Durborow 1999). Today, such outbreaks are rarely observed and such infections are now generally termed “fish tank granuloma” and “fish handler‟s disease” due to the association of the infections with home aquaria (Wheeler and Graham 1989) and water-related activities such as swimming, fishing and boating (Ang et al. 2000).
6.3.4. Piscine mycobacteriosis Piscine mycobacteriosis (fish mycobacteriosis) is a name given to any disease caused by mycobacteria in fish. Piscine mycobacteriosis was first described in 1897 and it is one of the oldest known fish diseases (Bataillon et al. 1897). Mycobacterial infections have been reported in more than 160 fish species (Chinabut 1999). Outbreaks varying between mild and severe (with high mortality) are experienced and fishes of high commercial value may be affected (Ashburner 1977; Hedrick et al. 1987; Bruno et al. 1998; Whipps et al. 2003). Mycobacteriosis is one of the few diseases in fish that can pose a zoonotic hazard (Novotny et al. 2004). In tropical areas, mycobacterial infections are among the most common chronic diseases of freshwater and marine fishes (Noga 2000). Piscine mycobacteriosis has been rarely reported from the Atlantic Ocean. Recent documented reports are limited to the mackerel, Scomber scombrus L. from the North-East Atlantic (Mackenzie 1988), Atlantic cod from Danish coastal waters (Dalsgaard et al. 1992) and Atlantic salmon from Scottish marine fish farms (Bruno et al. 1998). In Norway, documented cases of piscine mycobacteriosis are limited to sporadic archived laboratory reports. Until the present study, no documented field cases can be found in the literature.
Mycobacterium spp. are widely distributed in the environment including marine, brackish and freshwaters (Frerichs 1993; Dailloux et al. 2003; Primm et al. 2004). Fish may therefore be in frequent contact with the bacteria. However, cannibalism and feeding with untreated fish carcases prior to introduction of pasteurized fish meal to aquaculture were previously considered major sources of infection (Wood and Ordal 1958; Parisot and Wood 1960). Biofilm forming capability (Hall-Stoodley and Lappin-Scott 1998), survival and replication in protozoan organisms including free living amoebas (Strahl et al. 2001) are assumed to be
23
among the survival strategies outside the host. Ingestion of biofilm or aquatic detritus is therefore considered another likely source of infection. In addition to oral infection, transovarian transmission in viviparous fishes (Conroy 1966) and dermal infection (including contact with infected fish), may also be significant.
Mycobacteriosis in fish is described as a sub-acute to chronic wasting disease that may take years to develop into a clinically obvious illness (Hedrick et al. 1987; Knibb et al. 1993; Austin and Austin 2007b; Austin and Austin 2007a). The disease in fish is characterised by diffuse clinical signs including, loss of appetite, emaciation, pigmentary change, debilitation, growth retardation and solitary behaviour (Noga et al. 1990; Frerichs 1993; Heckert et al. 2001; Austin and Austin 2007b; Austin and Austin 2007a). In addition, asymptomatic infections are not uncommon (Colorni 1992). The type and extent of pathological lesions associated with mycobacterial infections may vary depending on host and mycobacterial species as well as the developmental stage of the disease (Wolf and Smith 1999; Gauthier et al. 2003; Harms et al. 2003; Jacobs et al. 2009).
Chronic infections in fish are known to induce granulomatous lesions mainly in the spleen, kidney and liver, which are thus considered the primary target organs (van Duijn 1981; Frerichs 1993). Granulomatous lesions, mainly of a miliary type (well described in mammals) are considered the classical pathological manifestation of mycobacterial infections. Such lesions, though rarely seen in salmonids (Bruno et al. 1998) may be characteristic, particularly in long standing infections in many piscine hosts. Advanced granulomas may be characterized by certain structural features i.e. a necrotic centre surrounded by inflammatory cells (macrophages), epitheloid cells and an outer layer consisting of mostly fibrous connective tissue (Diamant et al. 2000; Gauthier et al. 2003). Visible dermal lesions including nodulation, scale loss, haemorrhage and ulceration have been reported in a number of piscine mycobacteriosis cases (Noga et al. 1990; Herbst et al. 2001; Gauthier et al. 2008). Nodular, haemorrhagic and ulcerative dermal lesions (Figure 3) may, however, be primarily related to particular mycobacterial species and piscine hosts (Herbst et al. 2001; Rhodes et al. 2003).
As there is no currently widely accepted treatment for fish mycobacteriosis, the recommended measure is to eliminate affected fish population and replacement with a new batch after proper cleaning and disinfection of facilities (Decostere et al. 2004; Gauthier and Rhodes 2009; Jacobs et al. 2009). 24
Figure 3. Suspected M. shottsii infection, as previously described by Rhodes et al. (2001), in striped bass from Chesapeake Bay, USA, displaying multifocal dermal ulceration. (Photo: M.A. Zerihun)
Figure 4. Atlantic cod experimentally infected with M. salmoniphilum showing swelling and miliary granulomatous lesions in kidney (a) and spleen (b). (Photo: M.A. Zerihun)
25
6.3.4.1. Aetiological agents of piscine mycobacteriosis The number of Mycobacterium spp. affecting fish has recently increased from a very few recognized species, namely M. marinum, M. fortuitum and M. chelonae (Belas et al. 1995) to the current situation in which a number of mycobacterial species have been isolated from different fish species. The majority of mycobacterial species implicated in disease in fish are shown in Table 4. The first Mycobacterium sp. isolated from fish was M. marinum (Aronson 1926). This species has been isolated from many fish species both from freshwater and the marine environment and is one of the most frequently isolated fish pathogenic mycobacteria (Colorni 1992; Diamant et al. 2000). In the early 1950s, the second mycobacterial species recognized as a fish pathogen, M. fortuitum, was isolated from neon tetra, Paracheirodon innesi (Ross and Brancato 1959). Piscine infections caused by M. fortuitum are currently rarely reported.
Mycobacterium salmoniphilum (Ross 1960) is associated with disease in salmonids. However, due to similarities in biochemical characteristics with M. chelonae and M. fortuitum (Gordon and Mihm 1959; Tsukamura et al. 1967), this mycobacterial species was initially considered to represent „M. chelonae ssp. piscarium‟ (Arakawa and Fryer 1984). This subspecies name was subsequently withdrawn as serological analyses could not separate „M. chelonae ssp. piscarium‟ from M. chelonae ssp. chelonae or M. chelonae ssp. abscessus (Arakawa et al. 1986). Recently, the name, „Mycobacterium salmoniphilum’ was reinstated based on molecular and biochemical analyses conducted by Whipps et al. (2007a).
Herbst et al. (2001) reported granulomatous skin lesions in moray eels, Gymnothorax funebris and G. moringa caused by a novel Mycobacterium species related to M. triplex, which has subsequently been identified as M. montefiorense (Levi et al. 2003). In addition, a M. triplexlike organism has been proposed to be responsible for „Poeciliid granulomatous disease‟ in poeciliid fish, including shortfin molly, Poecilia mexicana (Poort et al. 2006). An epizootic disease condition in striped bass, Morone saxatilis (Walbum) in Chesapeake Bay, characterized by skin ulceration was reported and M. shottsii and M. pseudoshottsii were isolated and characterised as the aetiological agents (Rhodes et al. 2003; Rhodes et al. 2005). Another new fish pathogenic species, M. haemophilum has been isolated and characterised following a disease outbreak in zebrafish research facilities (Whipps et al. 2007b).
26
Table 4. Review of Mycobacterium spp. identified from fin-fish (Gauthier et al. 2009, reprinted with permission, slightly modified). Species M. abscessus
M. avium M. chelonae* M. salmoniphilum „M. chesapeaki‟ M. fortuitum M. gordonae
M. haemophilum „M. lentiflavum-like‟ M. marinum M. montefiorense „M. montefiorense-like‟ M. peregrinum/septicum M. neoaurum M. pseudoshottsii M. scrofulaceum
M. shottsii M. simiae „M. triplex-like‟ M. szulgai
Host Zebrafish, Danio rerio; Medaka, Oryzias latipes; Milkfish, Chanos chanos Dwarf Cichlid, Apistogramma cacatuoides Multiple
Striped bass Multiple Goldfish, Carassius auratus; Guppy, Poecilia reticulate; Angelfish, Pterophyllum scalare and others Zebrafish Swordtail, Xiphophorus hellerii Multiple Moray eel, Gymnothorax funebris Rockfish, Sebastes spp.; Rainbow trout Zebrafish Cichlid, Pseudotropheus lombardoi Chinook salmon, Oncorhynchus tschawytscha Striped bass Pacific staghorn sculpin, Leptocottus armatus Silver mullet, Mugil curema Striped bass Black acara, Cichlasoma bimaculatum Striped bass Striped bass
Reference (Teska et al. 1997; Astrofsky et al. 2000; Chang et al. 2006) (Lescenko et al. 2003) (Ashburner 1977; Arakawa and Fryer 1984; Bruno et al. 1998; Whipps et al. 2007a) (Heckert et al. 2001) (Lescenko et al. 2003; Pate et al. 2005; Sakai et al. 2005)
(Whipps et al. 2007b) (Poort et al. 2006) (Ucko et al. 2002; Ucko and Colorni 2005; Ranger et al. 2006) (Herbst et al. 2001; Levi et al. 2003) (Whipps et al. 2003) (Kent et al. 2004; Pate et al. 2005) (Backman et al. 1990) (Rhodes et al. 2004; Rhodes et al. 2005) (Lansdell et al. 1993; Perez et al. 2001) (Rhodes et al. 2003; Rhodes et al. 2004; Rhodes et al. 2005) (Lansdell et al. 1993) (Rhodes et al. 2004) (Rhodes et al. 2004)
* Isolates of M. chelonae from salmonids are subsequently named M. salmoniphilum in recent publications
27
6.3.5. The immune response in fish and pathogenesis of mycobacteriosis Pathogenesis of the disease is dependent on a balance between bacterial virulence and the host immune response. Anti-mycobacterial immune responses initiate complex pathological processes, mainly resulting in granulomatous lesions with caseation, and in higher vertebrates cavitation (Hunter et al. 2006). Considering the close relationship between immune responses and pathogenesis against mycobacterial infections, the two topics are highlighted in combination in this section.
Pathogenesis is the interplay between pathogen and host that creates a process of pathological changes resulting in disease. A cascade of processes involving infection, inflammation, tissue damage and pathogen distribution within the host are involved. Multiple factors including infection dose, virulence of the infectious agent, immune status of the host and environmental factors contribute to pathogenesis of a disease. As different fish hosts and mycobacterial species may interplay in different manners, adaptable model systems, mimicking natural infections, are important for the study of host-pathogen interactions in both aquatic and terrestrial vertebrates. A number of such models have been used in the past. M. marinum, due to its pathogenicity in both fish and mammals combined with its ease of handling in the laboratory, is utilised as a model organism for many mycobacterial infections (Gao et al. 2003; Prouty et al. 2003), although the existence of intraspecies virulence variation (Talaat et al. 1999) may be a problem. Zebrafish is among the most preferred model hosts for study of host-pathogen interaction in mycobacterial infections (Carvalho et al. 2011).
Intracellular survival and replication of the pathogen are important elements of virulence of mycobacteria and pathogenesis of mycobacterial diseases. Pathogenic strains, which survive the primary innate immune defences, enter and multiply or simply survive in membranebound macrophage organelles (phagosomes). Pathogenic mycobacteria-harbouring phagosomes undergo a process that inhibits fusion with lysosomes, thus creating conducive environment and avoid the host immune system (Moulder 1985; McDonough et al. 1993; Da Silva et al. 2002). El-Etr et al. (2001) demonstrated uptake and intracellular replication and survival (involving inhibition of phagolysosomal fusion) of M. marinum in carp monocytes, while the non-pathogenic M. smegmatis were only poorly taken up by the monocytes and were subsequently eliminated. This demonstrated the ability of monocytes to distinguish between pathogenic and non-pathogenic mycobacteria, which may be influenced by factors 28
coded for by virulence genes in pathogenic mycobacterial species (Arruda et al. 1993). Mycobacteria enter macrophages through endocytosis. This process is mediated by macrophage receptors, including mannose receptors, which bind to a glycolipid of the bacterial cell membrane and complement receptors binding opsonized mycobacteria.
Complex mechanisms are believed to be responsible for the process of intracellular survival and replication. M. tuberculosis blocks phagolysosomal fusion by blocking Ca2+ signals and inhibiting synthesis of fusion promoter proteins. Expression of Rab5 protein on phagosomal membranes (Clemens et al. 2000), sulfatides of mycobacteria (Goren 1977) and production of ammonia by mycobacteria (Gordon et al. 1980) are reported to prohibit phagolysosomal fusion. One of the mechanisms responsible for making the phagosomal environment conducive for mycobacteria is failure of acidification, which is considered to be due to deficient accumulation of proton-ATPase complexes in these structures (Sturgill-Koszycki et al. 1994; Singh et al. 2006). Maintenance of tryptophan-aspartate containing protein (TACO) on the walls of mycobacteria-harbouring phagosomes prohibits the bactericidal effect of macrophages (Ferrari et al. 1999). However, evidence of fusion of M. marinum-harbouring phagosomes with lysosomes in striped bass macrophages has been presented (Gauthier et al. 2004). Escape of M. tuberculosis and M. leprae from fused phagolysosomes into the cytoplasm of human macrophages (van der Wel et al. 2007) has also been reported. Stamm et al. (2003) described transmission of M. marinum from mouse phagosomes to other cells. Other virulence related factors in mycobacteria include mycolactone A/B, secreted by M. ulcerans, which is cytopathic and inhibits cytokines, phagocytosis and promotes skin necrosis in Buruli ulcer disease of humans (George et al. 1999). However, mycolactone F produced by some fish pathogenic mycobacterial species was not reported to cause such damage to host cells. This strategy may therefore be unique to M. ulcerans, which may be predominantly found extracellularly (Pahlevan et al. 1999), unlike other species of the genus Mycobacterium.
Teleosts respond against pathogens with both innate (non-specific) and adaptive (specific) immune responses and the two immune mechanisms function inter-dependently of each other. Humoral (related to body fluids) and cellular components are involved in both innate and adaptive responses (Ellis 2001b). In teleosts, the head kidney is the most important organ and performs immunological functions equivalent to those performed by the lymph nodes and bone marrow of higher vertebrates (Press and Evensen 1999; Ellis 2001a). The other 29
immunologically important organs in fish include the spleen and thymus (Zapata and Amemiya 2000). Mucus, epidermis and epithelial layers of the skin, gills and GIT provide primary physical and chemical defence barriers. When these surface barriers are compromised and pathogens access the tissues, the systemic innate immune system takes over the defence task. In addition to primary defence against pathogens, the innate immune system support the sophisticated adaptive immune response (Ellis 2001b). The innate humoral defence includes deployment of components such as antiproteases (anti-microbial enzyme agents), transferrin (deprives microbes of iron), complement (mediate vasodilation, phagocytosis and bactericidal functions), antibodies and lytic factors (Alexander and Ingram 1992; Morgan et al. 2005; Saurabh and Sahoo 2008). The innate cellular immune response, encompassing phagocytosis and cellular inflammatory reactions, involves mainly macrophages/monocyte, neutrophils and non-specific (natural) cytotoxic cells (NCCs), the latter are reported to resemble mammalian natural killer cells (NK cells) and respond to viral and protozoan infections (Secombes 1996).
The adaptive immune response in fish involves T-and B-lymphocytes, T-cell receptors (TCR), major histocompatibility complex (MHC) and immunoglobulins (Ig; antibodies). Tlymphocytes initiate specific cell-mediated immunity (CMI) and B-lymphocytes and mast cells produce antibodies (Zelikoff 1998). In teleost fish, IgM was believed to be the only isotype until IgD and IgT/IgZ were identified recently (reviewd in Salinas et al. 2011), which are functional both systemically and locally on surfaces of the skin, gills and GIT. Identification of different cytokines such as interleukins, interferons, tumour necrosis factor, transforming growth factor and differentiation of T-cell into diverse subtypes (based on T-cell markers CD3, CD4, CD8, CD28, CTLA-4) in fish is considered confirmatory to the similarity of the CMI in teleosts to that in higher vertebrates (Castro et al. 2011).
Mycobacterial infections in the first few weeks of primary infection (e.g. 0-3 weeks in M. tuberculosis infection in humans) are mainly characterized by uncontrolled intracellular bacterial multiplication. This phase of infection may however be variable in different host species depending on the possible existence of polymorphism in natural (innate) resistance within host species. The natural resistance-associated macrophage proteins (Nramp), which belong to a highly conserved family of proteins, are known to partially control innate resistance to intracellular pathogens including mycobacteria (Gros et al. 1981; Goto et al. 1984; Chen et al. 2006). Nramp‟s function is assumed to inhibit bacterial growth through controlling the availability of iron to the parasitizing pathogens (Zwilling et al. 1999). Nramp 30
has been identified in a limited number of studied teleosts, although its exact contribution to disease resistance is not as well studied in fish as in mammals (Chen et al. 2006). Burge et al. (2004a; 2004b) identified short-term expression of Nramp in striped bass following intraperitoneal injection of a lipopolysaccharide (LPS) and in vivo and in vitro experimental infections by M. marinum.
After initial mycobacterial infection (> 3 weeks in humans), infected hosts respond with Thelper 1 cells (TH1) influenced by interleukin (IL-12, in humans). TH1 cells produce interferon gamma (IFN-) that promotes containment of mycobacteria in activated macrophages and destruction of bacterial cells by a variety of mechanisms including secretion of reactive nitrogen and oxygen species (Co et al. 2004). In fish, IL-1 is secreted by phagocytes and epithelial cells in response to bacterial lipopolysaccharides and promotes recruitment of T lymphocytes and stimulates antibody production. The TH1 mediated immune response is also associated with hypersensitivity and tissue damage in the form of granuloma formation. Activated macrophages may fuse to form giant cells and differentiate into epitheloid cells, which are characteristic of mycobacteria-induced granulomas, mainly in higher vertebrates (reviewed in Martinez et al. 2009).
Granuloma is considered the hallmark of chronic mycobacterial infections, and this response controls mycobacterial proliferation without elimination of the bacterium (Ulrichs and Kaufmann 2006). Granulomas are complex structures formed by aggregation of various types of immune cells including lymphocytes, granulocytes, fibroblasts and macrophages in response to chronic stimuli by infectious or non-infectious agents (Secombes et al. 1985; Roberts 2001). Granulomas have important functions in host defence including prevention of pathogen dissemination, and restriction of further inflammatory tissue damage. To the pathogen‟s advantage, these lesions are also known to create favourable survival and replication sites (Co et al. 2004). In a study conducted in mycobacteria infected zebrafish embryos, granulomas were demonstrated to be formed without involvement of the adaptive immune response (Davis et al. 2002). Two individual genes, i.e. the macrophage-activated gene and the granuloma-activated gene, are involved in formation of granuloma (Chan et al. 2002; Davis et al. 2002). Volkman et al. (2004) demonstrated failure of granuloma formation in mycobacterial species deficient of the genomic locus called „Region of difference 1‟ (RD1), which encodes a virulence factor that promotes granuloma. In cod, granuloma formation is a characteristic feature against many bacterial and fungal infections, which is 31
believed to be a reflection of innate cellular and humoral parameters and relatively high respiratory burst activity of leucocytes in this species (Nikoskelainen et al. 2006). The presence of abundant phagocytic neutrophils in cod‟s blood (Rønneseth et al. 2007; Øverland et al. 2010) and the enhanced respiratory burst activity of cod leukocytes (Nikoskelainen et al. 2006) may explain the importance of phagocytic cells and granuloma formation in this fish species.
6.3.6. Diagnosis of mycobacteriosis Precise diagnosis of piscine mycobacteriosis and identification of the aetiological agent normally involves a combination of clinical signs and both macroscopic and histological examination of fish tissues, together with phenotypic characterization (Kent and Kubica 1985), and/or molecular analysis (Kox et al.1995; Stinear et al.1999) of the pathogen. Diagnosis based on clinical signs is usually difficult mainly due to the diffuse clinical signs that may be shared with other diseases. While granulomatous lesions are considered important for presumptive diagnosis, this lesion is most commonly manifested in long-standing infections, and may be attributed to other causative agents. Ziehl-Neelsen staining (Bishop and Neumann 1970) is commonly used to detect acid-fast bacilli (AFB) in tissue sections and to discriminate AFB from other bacteria. Acid-fastness may however be dependent on the physiological state of mycobacteria (Harada 1973; Harada 1977; Seiler et al. 2003). The presence of other acid-fast bacteria such as Nocardia may also be a limitation to ZiehlNeelsen (ZN) staining. The use of enzyme-linked immunosorbent assay (ELISA) in the detection of mycobacteria is reported previously, however, this methodology is not yet part of routine diagnostic applications. Immunohistochemical detection of mycobacterial antigens in tissue sections is reported as a better alternative to ZN staining (Gómez et al. 1996; Sarli et al. 2005; Das et al. 2007).
Culture and subsequent phenotypic and biochemical characterization has been used as the main diagnostic and speciation tool for disease investigation laboratories and the IWGMT (Wayne 1981; Wayne et al. 1991). Culture is however time consuming and has disadvantages related to uncultivable, dead and attenuated mycobacteria (Stabel et al. 1997; Kalis et al. 1999; Rhodes et al. 2003). Moreover, phenotypic and biochemical characterization is now becoming difficult to use mainly because of the increasing number of new mycobacterial species. 32
During the last decade, there has been an enormous development within nucleic acid-based diagnostics, which has led to an increasing frequency of speciation of pathogenic mycobacteria (Mackay 2004; Kaattari et al. 2006; Barken et al. 2007). DNA probe hybridization and PCR-restriction analysis (PRA) remain popular, but have narrow applicability mainly due to low specificity and sensitivity (Tortoli 2003; Tortoli 2010). Amplification and subsequent sequencing of conserved genetic loci is considered the gold standard for mycobacterial identification (Böttger 1996). Among the recognised target genes, 16S rDNA has been widely used for identification and speciation of mycobacteria (McNabb et al. 2004). The 16S rDNA, in particular the first 500 bp of the gene, is considered the first choice (Tortoli 2010), however high interspecies homology displayed by some species within the genus Mycobacterium and the existence of more than one 16S rDNA allele (Turenne et al. 2001) indicates a need for additional and better discriminator genes. Genes including the 65kDa heat shock protein (Hsp65), RNA polymerase β subunit (rpoB) and 16S-23S internal transcribed spacer (ITS) are among the genes most commonly used for mycobacterial speciation, either separately or in combination. The Hsp65 gene, particularly the highly variable (400 bp) fragment (McNabb et al. 2004), is considered an alternative to 16S rDNA. Other loci, like ITS, are useful for differentiation of mycobacterial species and members of the Mycobacterium avium-complex in particular (Roth et al. 2000; Mijs et al. 2002), while the rpoB gene is recommended for differentiation of rapidly growing mycobacterial species (Adékambi et al. 2003; Kim et al. 2005). Although sequencing requires specialized equipment, this technology is becoming rapidly less expensive.
Recent real-time based PCR advances have provided major contributions to the rapid and accurate identification and in some cases quantification of Mycobacterium species (Torres et al. 2000; Kraus et al. 2001; Lim et al. 2008). Most currently available real-time PCR tools have been developed for specific mycobacterial species in a particular host range (Lewin et al. 2003; Bruijnesteijn Van Coppenraet et al. 2004; Khan and Yadav 2004; Parashar et al. 2006; Pakarinen et al. 2007; van Coppenraet et al. 2007; Lim et al. 2008; Truman et al. 2008). Hence, there is a need for a truly genus-wide PCR assay, allowing detection of infections caused by a broad spectrum of Mycobacterium spp. in a variety of piscine hosts.
Granulomatous lesions obviously are considered as important features of mycobacterial infections, as mentioned in section 6.3.5. For this reason, other diseases manifesting granulomatous lesions are important from a differential diagnostic point of view. Francisella 33
spp. affect a number of fish species including Atlantic cod; Atlantic salmon; tilapia, Oreochromis sp.; hybrid striped bass, Morone chrysops × M. saxatilis and three-lined grunt, Parapristipoma trilinineatum (reviewed in Colquhoun and Duodu 2011). Francisella infections in wild-caught Atlantic cod were earlier considered as „presumptive mycobacteriosis‟ based on development of extensive visceral granuloma (van Banning 1987; Bucke 1989; MAFF 1991; Cefas 2003). Clinical and pathological examinations may not clearly differentiate the two infections prior to identification of F. noatunensis ssp. noatunensis as the aetiological agent. Today, the two diseases can be differentiated successfully using sensitive detection tools including culture, immunohistochemistry (IHC) and real-time PCR (Olsen et al. 2006; Mikalsen et al. 2007; Ottem et al. 2008; Zerihun et al. 2011). Atypical furunculosis caused by atypical Aeromonas salmonicida in Atlantic cod is also characterised by development of extensive granuloma (Magnadóttir et al. 2002; Holm 2009), and may be confused with other diseases causing granulomatous lesions. Piscirickettsia salmonis, Renibacterium salmoninarum and Nocardia spp. can also cause granulomatous lesions similar to those caused by mycobacterial infections. Diverse other infections including Gram-negative bacteria, fungus, protozoa and migrating helminthes (Dulin 1979; Anderson et al.1987; Plumb 1994; Noga 2000) are also known to result in granulomatous lesions. Granuloma formation following intra-peritoneal (i.p.) vaccination of oil-adjuvanted vaccines is a well-known side effect in farmed fishes, which may be some times differentiated from the mycobacteria induced granuloma by the possible presence of oil drops within the lesions (Midtlyng and Lillehaug 1998; Koppang et al. 2005). The large and irregularly shaped granulomas surrounded by a thick tissue capsule during infections with migrating helminthes are suggested to be discriminative (Anderson et al.1987). Infections with Gram-negative bacteria, protozoa (Myxosporidia) and Nocardia lack the characteristic epitheloid cells within the granuloma which is suggested as a differentiating characteristic (Anderson et al. 1987). However, as the morphological structure of granulomas may be highly dependent on the type of host fish, the pathogen species and developmental stage of the lesion (Gauthier et al. 2003), it may be difficult to rely on granuloma morphology to identify the aetiological agent. Microscopical examination of tissues may easily differentiate large parasites as well as fungal hyphae stained using Gomori‟s methenamine silver stain (Noga 2000).
34
7. Aim of the study The main aim of the study was generation of knowledge on features of mycobacteriosis in different fish species relevant to cold water aquaculture and establishment of rapid and sensitive diagnostic tools, primarily to enhance routine diagnostic procedures and fish disease research activities. The aim was approached by targeting the following sub-goals: A.
Characterisation of piscine mycobacteriosis and the responsible Mycobacterium spp. in Norway (Papers II and III)
B.
Development of a genus wide applicable real-time PCR tool for rapid diagnosis and screening purposes (Paper I)
C.
Development of an immunohistochemistry method for in situ detection of Mycobacterium spp. (Paper I)
D.
Investigation of the possible implications of mycobacteriosis for cultured Atlantic cod using a long-term experimental infection (Paper IV)
35
8. Design of the study The present study was initiated against a background of limited information relating to the status and importance of mycobacterial disease in Norwegian aquaculture. As „presumptive mycobacteriosis‟ was expected to impact (to a greater or lesser degree) the blooming yet young Norwegian cod-farming industry, the present study was financed as a means of exploring the current prevalence and possible future impact of mycobacteriosis in Norwegian aquaculture, with a focus on marine fish species and Atlantic cod in particular. Piscine mycobacteriosis can be caused by a number of mycobacterial species. Few sensitive diagnostic tools currently exist for detection of mycobacterial disease in fish, and little knowledge was available of the individual mycobacterial species which were likely to be involved. It was considered that the limited time available to the doctoral project would be best utilised through development of genus specific assays, combined with characterisation of the disease and aetiological agents involved in any outbreaks identified in the course of the study. Further it was decided that the virulence of any mycobacterial species identified in Norwegian marine aquaculture should be tested in farmed Atlantic cod. In this way the study would contribute to a greater understanding of the mycobacterial situation in Norwegian aquaculture and assess the nature of the threat of mycobacteriosis to future large scale codfarming.
36
9. Summary of papers 9.1. Paper I Immunohistochemical and Taqman real-time PCR detection of mycobacterial infections in fish The real-time PCR and immunohistochemical tools established in this paper are widely applicable within the genus Mycobacterium. The primers and probe for the real-time PCR assay were developed using an alignment of sequences of the RNA polymerase beta subunit (rpoB) from a range of slow- and fast-growing mycobacteria. Mycobacterium salmoniphilum isolated from an outbreak in farmed Atlantic salmon was used to produce the polyclonal antiMycobacterium serum in a rabbit. The two assays in combination provided simple, rapid aids to disease diagnosis prior to use of more specific tools to identify the specific Mycobacterium sp. involved. Both assays were found to be more sensitive than Ziehl-Neelsen (ZN) staining, with detection limits below 8 x 103 CFU g-1 tissue. The assays are applicable in formalinfixed paraffin-embedded (FFPE) tissue, which is the major sample type in fish disease investigation laboratories. During real-time PCR amplification, cross-reaction was encountered against pure DNA extracted from Nocardia seriolae and Rhodococcus erythropolis. It is considered possible, but unlikely, that these bacteria could be detected in clinical cases, particularly in FFPE tissues containing inherently low DNA concentrations.
9.2. Paper II Mycobacterium salmoniphilum infection in farmed Atlantic salmon, Salmo salar L. In this paper, mycobacterial infection attributed to Mycobacterium salmoniphilum is described in farmed Atlantic salmon based on a field outbreak and an experimental infection of naïve fish. The disease was studied using both clinical observations and macroscopic and histological examination of tissues. The bacterial isolates were characterized using phenotypic, biochemical and molecular tools and were identified as M. salmoniphilum, a bacterium previously isolated from salmonid fish species. Partial sequences of 16S rDNA, 16S-23S internal transcribed spacer (ITS), 65-kDa heat shock protein (Hsp65) and rpoB genes revealed 97-99% similarity with M. salmoniphilum type strain ATCC 13758T. A number of sequences from field isolates were deposited in the public database (GenBank). While the 37
field outbreak was characterized by relatively high mortality, the experimental infection remained sub-clinical in the majority of affected fish over the 131 days of the experiment and the death rate was below 1%. Formation of well-defined granuloma (granuloma with central necrosis and capsular margin) was less characteristic of the infection in this fish species. The injected mycobacterial species was isolated from few cohabiting fish.
9.3. Paper III Mycobacterium salmoniphilum infection in burbot, Lota lota L.
This study added burbot to the list of fish species susceptible to mycobacteria and describes Mycobacterium salmoniphilum infection in a non-salmonid fish for the first time. Burbot sampled from lakes Mjøsa and Losna in south-eastern Norway between 2005 and 2008 were found to be infected with M. salmoniphilum at a culture-positive prevalence of 19 and 3.3%, respectively. Mycobacterial isolates recovered on Middlebrook 7H10 agar were confirmed as M. salmoniphilum using both phenotypical investigation and partial sequencing of the 16S rDNA, rpoB and Hsp65 genes as well as the ITS locus. A number of multi-locus sequences are deposited in the public database (GenBank). Externally visible pathological changes included skin ulceration, petechiae, exophthalmia and cataract. Internally the infections were associated with capsulated, centrally necrotic granulomas, containing large numbers of acidfast bacilli, found mainly in the mesenteries, spleen, heart and swim bladder.
9.4. Paper IV Experimental mycobacteriosis in Atlantic cod, Gadus morhua L. In this paper, susceptibility and features of mycobacterial infection were studied using Atlantic cod challenged with M. salmoniphilum isolated from diseased Atlantic salmon. The study confirmed the relevance of M. salmoniphilum as a pathogen of non-salmonid fishes. The study was conducted over a one-year period and allowed the opportunity to follow disease progression and transmission of infection to cohabitant fish. The fish were supervised daily and samples were taken at 2, 7, 14, 23, 34 and 53 weeks post-infection and were examined histologically, bacteriologically and using molecular biological tools. Death attributable to mycobacterial infection was observed in both intra-peritoneal (i.p.) infected 38
(47%) and cohabitant (28%) fish groups. Extensive development of granuloma in visceral organs, mainly the mesenteries, spleen, kidney and liver and at later stages of the infection in heart tissues and gills, were observed both in i.p. infected and cohabitant fish. Granulomas developed with a series of distinct morphological stages being observed. This study shows the possible threat mycobacterial infections may represent to farmed Atlantic cod, and, has allowed deeper understanding of the features of the diseases in relation to time post infection.
39
10. Discussion 10.1. Methods 10.1.1. Experimental infection Despite the fact that fish mycobacteriosis is widely distributed, there remain knowledge gaps in terms of the possible pathogenicity of many mycobacterial species for fish and susceptibility of many economically important fish species to mycobacteriosis. Experimental infection studies are useful to generate knowledge on host-pathogen interactions, particularly in fulfilling Koch‟s postulates (Koch 1882) during new disease outbreaks.
While the experimental infection in Atlantic cod (Paper IV) demonstrated severe disease with high mortality rates in i.p. infected and cohabitant fish, that in Atlantic salmon (Paper II) developed only a mild infection with less than 1% mortality. The experimental infection in Atlantic salmon contrasts substantially from the 21% mortality observed in the same fish species during the field outbreak despite an infective dose much higher than naturally plausible (Paper II). A similar situation has been observed in other experimental infections when isolates from severe natural cases have been found to be non-pathogenic or caused only mild disease when injected under experimental circumstances (Bruno et al. 1998; Gauthier et al. 2003; Watral and Kent 2007). Among previous experiments, the one conducted by Bruno et al. (1998) was most similar in terms of design and duration to the experiment conducted on Atlantic salmon in the present study. The controlled environmental factors and good host health status before and during the experimental challenge unlike the uncontrolled conditions during field infections may have played a contributory role and explain some of the differences observed in severity of the disease in Atlantic salmon during experimental and field infections (Paper II). One other possible reason may be reduced virulence of the field isolate after a number of passages during original isolation, identification and preparation of the inoculum for experimental infections (Steenken and Gardner 1946; Smith 1988).
While mortality levels of 47% and 28% were registered in i.p. infected and cohabitating Atlantic cod, respectively, the total mortality in experimentally infected Atlantic salmon was less than 1% and was restricted to i.p. infected fish. This result alone suggests that Atlantic cod is more susceptible than Atlantic salmon to M. salmoniphilum experimental infection. Since similar mycobacterial studies do not exist in Atlantic cod and the present study represents the first such knowledge, the results presented here should be interpreted with 40
caution, however, until future studies test reproducibility under different experimental conditions. However, the results from experimental infection in Atlantic cod indicates a possible scenario in which mycobacteriosis may at some point in the future become a problem for farmed cod. The long-term experiment in striped bass infected by M. marinum described by Gauthier et al. (2003) was an important basis for comparison of the development of pathological changes in Atlantic cod (Paper IV). Such long-term studies, although costly, are very important since mycobacteriosis can take years to manifest clinically (Decostere et al. 2004). Due to practical constraints in long term studies, sampling intervals are often long.
On examination of the results of the experimental infections in the present study, the following points should be considered: a) The long sampling intervals during the Atlantic cod experiment may have resulted in aspects of pathological changes which passed unnoticed and were consequently uncharacterized; b) the shorter challenge in Atlantic salmon compared with that of Atlantic cod may have resulted in different platforms for evaluation of development of infection in the two fish species. Another consideration during experimental infections is the „tank effect‟ as reported previously in rainbow trout (Speare et al. 1995).
In contrast to controlled challenge experiments, field outbreaks represent real disease conditions and adequate knowledge can be generated if supported by study of outbreaks in different populations with regular sampling of affected populations throughout the outbreaks. However, controlled experimental infections are important tools for selective study of disease caused by any given aetiological agent without intervention of uncontrolled factors that may influence disease development during field outbreaks. Currently, there is a need to develop modern substitutive alternatives to experimental animal infections due to increasing awareness of ethical obligations and animal welfare. Arguments supporting experimentation include, however, that while the infections undoubtedly result in disease or death of a relatively small number of experimental fish, the results generated may in the long term lead to more rapid recognition of the disease with subsequent reduction in the number of fish clinically suffering and dying during field outbreaks. All experiments in the present study were approved by- and conducted according to guidelines provided by the Norwegian Animal Research Authority.
41
10.1.2. Sample handling and processing The main sources of samples for development and testing of the diagnostic tools and characterisation of the disease were the experimental infections described in papers II and IV and the field infections described in papers II and III. Measures including surface cleaning, disinfection and aseptic dissection were important procedures during sampling to reduce possible contaminations both by non-pathogenic environmental mycobacteria and other microbes during the present study. One of the most challenging tasks in diagnosis of mycobacterial infections is securing samples of sufficient quality. Appropriate sampling procedures providing good quality samples provide in turn credible results and generate valuable information. Both pathogenic and non-pathogenic mycobacteria are present in the aquatic environment. Hence, external surfaces, gills and the gastrointestinal tract (GIT) of fish may be contaminated or passively inhabited by mycobacteria that are not associated with disease. Contamination with non-pathogenic environmental mycobacteria may consequently highly affect interpretation of culture and molecular investigations.
In the present study, all samples intended for culture and molecular analyses were adequately homogenized (Papers I-IV). Since pathogenic mycobacteria are generally intracellular and may be commonly contained in well encapsulated granulomas, physical disruption (homogenization) of tissues is required to release bacterial cells and allow direct contact between bacteria and culture media and to make bacterial cells readily available for nucleic acid extraction. Owing to the unique mycobacterial cell wall, standard methods for isolation of DNA from Gram-negative and Gram-positive bacteria are generally not optimal for this group (Belisle and Sonnenberg 1998). Hence, further physical and chemical homogenization procedures are needed to destroy the robust cell wall structure and release nucleic acid for molecular analyses.
10.1.3. Culture In the present study, mycobacteria were successfully cultured on Middlebrook 7H10 agar (MDA) from infected fish tissues (Papers I-IV). Despite continuous methodological improvements, detection of mycobacteria by culture can be problematic due to long incubation periods particularly on solid media compared to broth (Morgan et al.1983). Cultivation of mycobacteria from infected hosts has long been considered the gold standard in mycobacterial related disease diagnosis (Ruddy et al. 2002). Bacterial culture media and 42
culturing techniques used in routine fish disease diagnostic laboratories are generally geared towards more commonly and easily cultured bacterial agents, e.g. Vibrio and Aeromonas, and use of media selective for mycobacterial species, e.g. MDA is, in most cases, not a routine practice. Thus, mycobacterial culture often appears restricted to reference laboratories or laboratories with a special focus on mycobacteria. This situation is changing slowly, however, as an increasing number of fastidious bacteria are now recognised to be fish pathogenic and the range of agar types utilised in routine diagnostics is increasing.
Almost pure cultures of mycobacteria were recovered without use of decontaminating agents in a number of primary cultures investigated in the present study, particularly during the experimental infections (Papers II and IV; Figure 5). Decontamination of homogenized tissue samples for mycobacterial culture is practiced using acidic and basic chemicals as well as hypochlorite and benzalkonium chloride compounds (Brooks et al. 1984; Rhodes et al. 2004). This procedure, depending on the type of chemical/compound and contact time, can also affect mycobacterial survival and consequently reduce the chance of isolation, particularly from samples with low bacterial density (Brooks et al. 1984). In addition to the sampling precautions indicated above, we cultured serially diluted sample homogenates to reduce overgrowth by other microbes and to conduct colony counts for estimation of bacterial load in tissues.
The mycobacterial field isolates in the present study were characterised using a limited range of biochemical tests and growth characteristics at variable temperatures (Papers II and III). Biochemical characterization has been used for many years as the major basis for classification by the IWGMT, but is fraught with complexity as mentioned in section 6.3.6. However, phenotypic characterisation can still be an important approach, especially in laboratories where PCR and sequencing assays are not in place although exact speciation may not be achieved.
43
Figure 5. Mycobacterium salmoniphilum colonies on Middlebrook 7H10 agar after 5 days incubation at 22ºC. The samples are taken from kidney, spleen and mesentery homogenates of experimentally infected Atlantic salmon (Photo: M.A. Zerihun)
10.1.4. Histopathological examination Histopathological examination plays a central role in fish disease diagnosis, and was also a central component of the present study (Papers I-IV). As fish samples rapidly decompose at ambient temperatures, diagnostic samples from the field are normally fixed in preservatives such as 10% buffered formalin. Despite the fact that microbial culturing is not possible from such samples, histopathological examination of formalin fixed paraffin-embedded (FFPE) tissue samples is the most frequently employed assay in intensive aquaculture related diagnostic and fish disease investigations. The type, extent of tissue damage, the abundance of mycobacteria in tissues and association of bacteria with pathological lesions can be easily examined using this methodology. However, histopathological evaluation is subjective and requires experience and knowledge of the disease process for accurate interpretation of results. Pathological changes are usually graded semi-quantitatively as „slight‟, „moderate‟ or „extensive‟ when dealing with severity or extent (Talaat et al. 1998), and „few‟, „some‟ or „many‟ when dealing with numbers. Possible complications that may arise from fish to fish variation, post-mortem changes, tissue fixation time, type of fixative, concurrent infections as well as similarities to differential diagnostic conditions require consideration when conducting histopathological examination. Results from histopathological examinations in the present study are discussed in detail in section 10.2.3. of this thesis. 44
10.1.5. Genus-level detection of mycobacteria during infections Real-time PCR The real-time PCR assay (Paper I) is truly genus-wide and an important tool for primary diagnostic investigations. Previously established „genus-wide‟ assays were validated against only a limited range of Mycobacterium spp. (Khan and Yadav 2004; Pakarinen et al. 2007). The assay in the present study can be employed for initial population screening and epidemiological studies in addition to its diagnostic applications. The possibility of application of this assay in testing of formalin-fixed tissue samples is an advantage, as FFPE samples dominate in routine fish disease diagnosis laboratories. We assume that the real-time PCR assay may be applicable in non-piscine hosts after proper standardization as a diversity of mycobacterial species relevant to mammals and birds were tested in addition to fish pathogens (Table 4). An inherent problem of genus-wide mycobacterial assays is cross reaction with closely related bacterial species (Roth et al. 2000; Pakarinen et al. 2007). In the present study, cross-reactions were encountered during the validation process against phylogenetically related bacteria i.e. Nocardia asteroides and Rhodococcus erythropolis. Sensitivity of detection levels for these species was, however, approximately 100x lower than that identified for the M. avium ssp. avium the Mycobacterium species for which the assay was least sensitive.
In the context of the present study, the real-time PCR has the added potential advantage of measurement of mycobacterial load by template quantification in clinical samples, leading to estimation of load of infection. Ct-values [defined as number of cycles required for the fluorescent signal to exceed the background level (threshold)] of real-time PCR, which are inversely proportional to the amount of target nucleic acids in a given sample, help estimation of bacterial load that may be correlated to infections or contamination. On analysis of FFPE tissues, much higher Ct-values (low bacterial density) were registered compared to that of parallel fresh tissues, which reflects the obvious negative effect of sample preservatives on quality and quantity of extracted nucleic acids (Rissanen et al. 2010). Because of the fact that positive PCR results alone cannot precisely demonstrate association with disease conditions (Ulrichs et al. 2005), use of assays which can detect pathogen-host interactions in situ may therefore be an essential approach. Hence, in addition an IHC assay was established in the present study (Paper I).
45
Table 4. Mycobacterial pathogens detected by the real-time PCR, developed in the present study. Bacterial species
Host
I. Rapidly growing M. abscessus M. chelonae M. fortuitum M. immunogenicum M. phlei M. phocaicum M. salmoniphilum M. wolinskyi
Fish, humans Fish, mammals, amphibians, reptiles Fish, amphibians, mammals Humans Cats Humans Fish Humans
II. Slowly growing M. avium ssp. avium M. bohemicum M. farcinogenes M. flavescens M. gastri M. gordonae M. malmoense M. marinum M. montefiorense M. pseudoshottsii M. senegalense M. shottsii M. smegmatis M. szulgi
Fish, birds, mammals Humans Mammals (cattle) Fish, humans, Humans Fish, humans Humans Fish, mammals, amphibians Fish Fish Fish, mammals Fish Mammals Fish, Mammals
Immunohistochemistry versus Ziehl-Neelsen staining In the present study ZN staining was less sensitive than the developed IHC assay (Paper I). The acid-fastness of mycobacteria is attributed to peptidoglycolipids, which are components of the mycolic acid structure of the bacterial cell wall (Daffe and Draper 1998); the name „acid-fast‟ is related to the ability of resisting decolourization by mineral acids after staining with Aryl Methane dyes. When the acid residues of the cell wall and the dye combine, a complex, which is resistant to decolourization by mineral acids or alcohol is formed. This complex absorbs the dye and awards e.g. when using carbol fuchsin, a red colour to bacterial cells. For the IHC assay, formation of an antigen-antibody complex is the working mechanism. The primary antibody produced in a rabbit, targets mycobacterial structures (antigens) in tissue sections. The secondary antibody, which is normally labelled with Horseradish Peroxidase (HRP), targets the primary antibody thereby the antigen/primary antibody-complex. Binding of the secondary antibody to the primary antibody-complex produces a colour signal that indicates presence of the antigen (Kiernan 1999). 46
When defining the detection limit of the IHC developed in the present study, we found that IHC was capable of identifying infections at bacterial concentrations as low as 102 CFU g-1 tissue, while the lower detection level for ZN staining was 8×103 CFU g-1 tissue (constituting an 80x improvement over the ZN stain). Despite considerable improvements to ZN staining and pre-treatment of tissue sections before application of the stain (Allen 1992; Selvakumar et al. 2002; Gauthier et al. 2003), weaknesses related to sensitivity and specificity are inherent problems of this assay. The inability of ZN staining to detect AFB in all developmental stages of pathological lesions (Gauthier et al. 2003; Paper IV) may be related to the physiological state of mycobacterial cells as reported in previous studies and mentioned earlier in this thesis. Recent studies have shown formation of spore-like structures in vitro in mycobacterial species, including the fish pathogen M. marinum (Ghosh et al. 2009; Singh et al. 2010; Lamont et al. 2012). It could be speculated that spore formation may contribute to false negative ZN staining in vivo.
The IHC assay developed on a polyclonal anti-serum produced in rabbit in paper I detects a wide range of mycobacteria in a wide range of fish species. Previous studies have reported IHC methods with improved diagnostic potential over ZN stain (Gómez et al. 1996; Sarli et al. 2005; Ulrichs et al. 2005). The main advantage of the IHC assay over ZN staining, also in the present study, is assumed to be related to the broad range of antigen recognition of the polyclonal antibodies that do not depend on presence of an intact cell wall as is the case with ZN staining or any one particular cell epitope as is the case with the use of monoclonal antibodies. However ZN staining remains an important tool, mainly due to its simplicity of application and low cost, although it should be interpreted with great care. The alternative in situ detection tool (IHC) developed in the present study represents a useful addition to current routine diagnostic practices in fish disease laboratories with histopathology competence and facilities.
The tools developed in paper I are widely applicable for detection of bacteria within the genus Mycobacterium and these assays in combination provided useful aids to achieve rapid disease diagnosis. As no approved or widely accepted chemotherapy is currently available, diagnosis of piscine mycobacteriosis in aquaculture normally results in destruction of affected populations and replacement with new batches after sterilization of cages and utensils (Decostere et al. 2004; Gauthier and Rhodes 2009; Jacobs et al. 2009). Genus level 47
confirmation of the mycobacterial nature of any particular disease outbreak may therefore constitute a satisfactory early warning which will allow either rapid minimization of losses (i.e. destruction) and/or provide the first step towards characterisation of the pathogen to the species level.
10.1.6. Identification of field isolates to the species level As the ancient Chinese warrior Sun Tzu taught his soldiers, knowing and understanding the enemy is the first important step before going to war. Although genus level identification may satisfy current piscine mycobacterial disease management, as mentioned in section 6.3.4., speciation of the isolates is an important step in distinguishing disease causing agents from non-pathogenic environmental mycobacteria that may inhabit and/or contaminate fish and to identify species with zoonotic potential. Speciation and further characterization of field isolates is also an important step in epidemiological studies. In papers II and III, the discriminatory power of the multi-gene approach of molecular characterization (Stackebrandt et al. 2002) was exploited using 16S rDNA, ITS, Hsp65 and rpoB genes based on a similar study by Whipps et al. (2007a). Sequencing and phylogenetic analyses confirmed that the pathogen responsible for the infections studied in this thesis (Papers II and III) was Mycobacterium salmoniphilum (ex Ross 1960). Details of this pathogen are presented in sections 6.3.4.1. and 10.2.1. of this thesis. As identification of mycobacterial isolates to the species level using phenotypic including biochemical tests is difficult and complicated due to the reasons mentioned in section 6.3.6., PCR amplification and sequence analyses of bacterial genes commonly dominates current investigations (Patel et al. 2000; Turenne et al. 2001; Tortoli 2003; Herdman and Steele 2004; Devulder et al. 2005).
48
10.2. The disease 10.2.1. Aetiology Mycobacterium salmoniphilum was confirmed to be the aetiological agent of piscine mycobacteriosis in the present study (Papers II-IV). Hence, this bacterial species is a potentially important fish pathogen in Norway. M. salmoniphilum is previously reported only in salmonid fish species (Ross 1960; Ashburner 1977; Arakawa and Fryer 1984; Bruno et al. 1998; Brocklebank et al. 2003). The isolates from the present study were homogenous and closely related but not identical to the type strain at the 16S rDNA level. Until the recent study by Ingen et al. (2010), M. salmoniphilum had not been isolated from the environment. All known isolates until this point originated from diseased fish. Although undoubtedly pathogenic to the fish species studied, slight differences registered in Hsp65 and rpoB gene sequences amongst the isolates were registered within the same outbreak (Papers II and III). Most acute disease episodes tend to be associated with single specific bacterial clones. The available evidence suggests, however, a mixed population of virulent M. salmoniphilum clones in the present study.
Prior to the present study, only a limited number (< 10) of sequences of 16S rDNA, ITS, Hsp65 and rpoB genes were available from isolates assigned „Mycobacterium salmoniphilum‟ in the public databases (Whipps et al. 2007a). In phylogenetic analysis of the isolates from the present study and previous sequences retrieved from public databases (GenBank), the isolates clustered mainly according to the geographic source of the isolates (Figure 2). Whether these groupings represent different ecotypes must be studied in the future. Among fish pathogenic mycobacterial species, existence of virulence, phenotypic and genetic variability is known within M. marinum (Sechi et al. 2002; Ucko et al. 2002). Perhaps unsurprisingly, given the geographic proximity and host species similarity, phylogenic analysis (papers II and III) identified a close relationship between Norwegian and Scottish isolates affecting Atlantic salmon, with the geographically more distant isolates from USA and Australia, clustering closely but separately.
10.2.2. Piscine hosts susceptible to Mycobacterium salmoniphilum infection Atlantic salmon, Atlantic cod and burbot are susceptible to infection with M. salmoniphilum (Papers II-IV). Prior to the present study, only salmonid fishes comprising Atlantic salmon, Pacific salmon, Oncorhynchus spp. and freshwater whitefish, Prosopium spp. were known to 49
be affected by this mycobacterial species. Outbreaks have been reported most commonly in Pacific salmon fed unpasteurised broodfish carcases (Wood and Ordal 1958; Parisot and Wood 1960). Relatively few cases have been documented in Atlantic salmon (Bruno et al. 1998; Brocklebank et al. 2003). To the best of our knowledge, the present study (Paper III) also represents the first report of mycobacterial infection in burbot. Mycobacterium salmoniphilum infection in Atlantic cod has not been reported prior to the present study. Alexander (1931) and Dalsgaard et al. (1992) reported mycobacteriosis in wild populations of Atlantic cod. However, these reports were based solely on observation of nodules in visceral organs and demonstration of acid-fast bacilli without culture of the responsible bacteria. As other bacteria e.g. Nocardia spp. are also acid-fast and cause granulomatous lesions (Paperna et al. 1980; Secombes et al. 1985), the aetiological agent/s in these cases must be considered at least of uncertain identity. On testing of an admittedly limited number of clinical samples using the methods established in the present study, natural mycobacterial infections were not detected in Atlantic cod (data not published). Furthermore, outbreaks of mycobacteriosis were not detected in farmed cod during the study period. Production related diseases often seem to take some years to manifest, however, and cod farming is still relatively young.
The results of the present study (Paper IV) suggest that Atlantic cod may be more susceptible to M. salmoniphilum than Atlantic salmon. Although the diversity among known piscine species susceptible to mycobacteria indicates that all teleosts may be considered possible hosts (Bruno et al. 1998), variations in susceptibility amongst different piscine hosts are known to exist (Prouty et al. 2003; Broussard and Ennis 2007). Susceptibility variation to M. chelonae within salmonids was demonstrated between juvenile Chinook salmon, Onchorhynchus tshawytscha (Walbaum) and rainbow trout during an experimental infection (Arakawa and Fryer 1984). The susceptibilities demonstrated in the present study are, therefore important knowledge, particularly for Atlantic cod as a newly introduced species to aquaculture. Susceptibility and disease development may, however, be highly influenced by other factors including the environment and immune status of the host organism.
50
10.2.3. Clinical signs and histopathological lesions Gross clinical signs The major observations associated with the infections in the present study were mainly increased mortality rates and loss of body weight (Papers II and IV). Mycobacteriosis in fish is known to be a wasting disease that takes long time to manifest clinically (Hedrick et al. 1987; Knibb et al. 1993; Austin and Austin 2007b) hence, the long-term study in Atlantic cod (Paper IV) created an ideal platform for identification of clinical signs. Disease signs including loss of appetite, pigmentary changes of the skin, debilitation, growth retardation, solitary behaviour and ascites were observed in Atlantic cod (Paper IV) as in previous studies in other fish species (Noga et al. 1990; Frerichs 1993; Heckert et al. 2001). In cod, macroscopic granulomas (miliary type) were prominent visceral lesions. While macroscopic lesions are rarely observed or even absent in considerable number of infected Atlantic salmon (Paper II), the lesions in burbot (Paper III) represented granulomatous conditions similar to that in Atlantic cod. Most of the lesions in burbot were long standing granulomas, similar to those observed at later stages of the infection in Atlantic cod. Histopathological lesions Formation of visceral granulomatous lesions was the major response to Mycobacterium salmoniphilum infection in salmon, cod and burbot (Papers II-IV). Burbot and Atlantic cod granulomas (Papers III and IV) displayed classical stratification, i.e. a necrotic core surrounded by inflammatory cells and epitheloid cells encapsulated by fibrous connective tissue at later stages of the infection. In Atlantic salmon (Paper II), in addition to loosely organized, non-encapsulated and mostly non-necrotizing granulomas, diffuse proliferation of immune cells in multiple organs was most commonly observed. In a considerable proportion of infected salmon, granulomatous lesions were absent. Although this type of response is mentioned in the limited reports available for salmonids previously, it is not a well-known and characteristic response to mycobacterial infections in general. This type of response may therefore be unique to salmonids and may explain the rare reports of mycobacteria attributed gross lesions in this fish group.
51
Granuloma formation may be a dominant immune response in cod in contrast to Atlantic salmon. The present study concludes that granulomas formed in response to M. salmoniphilum infection vary in morphology and extent in different fish species (Papers II-IV). This observation is in agreement with previous studies relating variation in structure and dissemination of granuloma to susceptibility and/or the immune response of the host species, the developmental stage of the disease and the pathogen (Wolf and Smith 1999; Gauthier et al. 2003; Harms et al. 2003). Formation of granulomatous lesions had been demonstrated to be related to the interaction between the disease causing agent and the innate immune system (Davis et al. 2002). The extensive granulomatous response of Atlantic cod to M. salmoniphilum infection is likely associated with unique features of the immune system in this fish species. Formation of extensive granuloma in response to infections is reported to be characteristic to cod and described to be due to the vital role of the innate cellular immune response in this fish species (Magnadóttir et al. 2011). MHC II and CD4+ are important molecules in triggering wider immune responses; hence, lack of genes coding these important molecules in the cod genome (Star et al. 2011) may influence the acquired immune response.
Granuloma dissemination The granulomas in Atlantic cod (Paper IV) were much more disseminated to multiple organs and the dissemination within individual organs was extensive compared to that in Atlantic salmon (Paper II). Talaat et al. (1998) differentiated the extent of organ involvement as minimal, mild, moderate, marked and severe in goldfish infected with M. marinum. In the present study, minimal to mild organ involvement was observed in Atlantic salmon, while severe organ involvement was observed in Atlantic cod. Disintegration of granulomas is one mechanism that may give rise to dissemination of mycobacteria in the fish body and pave the way for replication of the lesion and fulminant disease development (Gauthier et al. 2003).
Granulomas were observed in the heart of Atlantic cod during the later stages of M. salmoniphilum infection (Paper IV). Although pathological lesions attributed to mycobacterial infections have been reported beyond the primary target organs i.e. spleen, kidney and liver, mycobacteria-associated cardiac granulomas are rarely reported. Cardiac lesions may physically obliterate ventricles and atrium and consequently negatively affect the myocardial blood pumping activity. Dissemination of the infection (and therefore lesions) to the heart could explain, as suggested in earlier studies (Sakanari et al. 1983; Hedrick et al. 52
1987; Heckert et al. 2001) the considerably increased mortality rate shortly after manifestation of granulomas in the heart and gills of Atlantic cod (Paper IV). Development of mycobacteria-associated granulomas in the heart may, therefore, indicate that the disease is approaching the terminal stage.
A series of developmental stages of granuloma were observed in Atlantic cod. Using Gauthier’s granuloma staging, five distinct developmental stages (stages I-V) of granuloma were identified in Atlantic cod (Paper IV). The five stages were compatible with those described as primary focus, epitheloid, spindle-cell, bacillary granulomas and recrudescent lesions in striped bass experimentally infected with M. marinum (Gauthier et al. 2003). Based on knowledge generated from studies of granuloma development in Atlantic cod and observed morphology of lesions in the related gadoid, burbot (Paper III), we assume that granuloma in burbot probably go through similar developmental stages as in Atlantic cod.
In Atlantic salmon (Paper II), granulomas became solitary or totally absent (possibly resolved) eighteen weeks post infection in most i.p. infected fish, which may reflect an increased resistance of the host immune system against the infection. However, three forms of granulomas i.e. diffuse aggregation of inflammatory cells, loose granuloma without distinct boundary and granuloma with central necrosis and distinct non capsular boundary, were observed. These granuloma types in Atlantic salmon were not related to time post infection that may indicate a developmental stage as observed in Atlantic cod. Granulomas defined as ‘compact’ and ‘soft nodules’ have been reported previously in salmon (Hedrick et al. 1987; Bruno et al. 1998). Whether these two forms represent developmental stages in salmon is not well known.
10.2.4. Transmission and source of infection The experimental infections in papers II and IV showed that the infection was horizontally transmitted from infected to naïve cohabitant fishes. However, it was not confirmed whether the infection was truly waterborne as has been demonstrated previously for M. marinum infection in striped bass (Gauthier et al. 2003) or whether fish to fish contact is necessary. Both mechanisms may, however, be plausible in transmission of natural infections. The exact source of infection and mode of transmission could not be identified in the field cases described in papers II and III. The field outbreak in Atlantic salmon (Paper II) was detected in
53
only one cage of a total of eight cages on the affected farm. The reason why the infection was limited to one cage and did not transmit to the adjacent cages was not properly understood. Some (previous) aquaculture practices have been directly associated with and contributed to mycobacteriosis. Most, if not all mycobacterial outbreaks described in salmonids are reported from aquaculture. This is probably due in part to the diagnostic attention given to farmed fishes compared to wild. Feeding unpasteurized fish meal was blamed for several mycobacterial outbreaks and the prevalence decreased following termination of such feeding practices. The outbreak described in paper II, in farmed salmon as with previously described outbreaks (Ashburner 1977; Arakawa and Fryer 1984; Bruno et al. 1998; Brocklebank et al. 2003) is assumed to have its source of infection from the environment and wild fishes (Nigrelli and Vogel 1963; Chinabut et al. 1990). Further study may be needed to specifically locate the exact source.
10.2.5. Are there contributory factors to piscine mycobacteriosis? Disease is always a balance between host, environment and pathogen (Figure 5). Development of tuberculosis/mycobacteriosis in humans is commonly associated with immune suppression caused by infectious and non-infectious agents including HIV/AIDS infection (De Cock et al. 1992; Nunn et al. 1994). While the variable infection dynamics observed in the field and experimental infections in the present study cannot be easily explained, ultimate mortality levels may well depend on the interaction between extrinsic and intrinsic factors.
Severity (mortality rate) of the field outbreak in Atlantic salmon in paper II was much higher than the other similar field outbreaks in salmon caused by the same pathogen in the same fish species (Bruno et al. 1998; Brocklebank et al. 2003). High water temperature is one of the known factors that favour piscine mycobacteriosis (Colorni 1992) and the 1-3ºC higher water temperature registered during the present study (Paper II) compared to that described by Bruno et al. (1998) may have played a contributory role in variations in severity of disease in the two populations. Genetic variation within Atlantic salmon populations (Verspoor 1997) may be of relevance. Polymorphisms and high- and low-resistant MHC alleles (Langefors et al. 2001; Lohm et al. 2002; Grimholt et al. 2003) have been related to furunculosis- (Kjøglum et al. 2008) and IPN- (so-called QTL stocks; Gheyas et al. 2010) resistance in different Atlantic salmon stocks.
54
Figure 5. A triad showing contribution of environment, host and pathogen interaction for disease development. The relative contribution of each component to the disease development may be highly influenced by factors affecting each component. Adopted from (Hueffer et al. 2011). In paper III, a significantly higher number of fish from Lake Mjøsa compared to from Lake Losna (P > 0.05; Fisher‟s exact test) displayed mycobacterial infection (bacteriological results). While the reason for this significant difference was not identified, it could conceivably be related to the high level of environmental pollution in Lake Mjøsa compared to Lake Losna (Gregoraszczuk et al. 2008; Mariussen et al. 2008) inducing immunosuppression of the fish population (Anderson 1996). Previous reports of an association between presumptive mycobacterial infections in Atlantic cod in Danish coastal waters (Dalsgaard et al. 1992) and carbohydrate contamination of coastal waters support a hypothesis relating pollution and poor water quality with mycobacterial outbreaks in piscine hosts.
Possible variation in virulence between the various isolates of M. salmoniphilum (Figure 2) may also explain variation in outcome of infection, although the differences in field versus experimental factors are probably more significant. As acute bacterial infections are often clonal in nature, one scenario which could explain the strain variation involved was that the fish immune status and or the environmental conditions contributed to a situation which allowed „environmental‟ mycobacteria to become pathogenic. Studying variability within M. salmoniphilum isolates from different geographic locations may be one of the focuses for future studies. 55
Vibriosis, winter ulcer, furunculosis, IPN, PD, HSMI, CMS, proliferative gill inflammation (PGI) and other frequently diagnosed diseases in aquaculture may contribute to immune suppression in affected stocks. Taken together stress related to transportation, crowding and handling activities in aquaculture may consequently increase the susceptibility of fish to other infections including mycobacteriosis (Iversen et al. 2005). Predisposing and contributory factors that may supress the immune system may therefore play an important role in development of piscine mycobacteriosis, but the degree to which they are „necessary‟ remains unclear.
56
11. Main conclusions o The real-time PCR developed in the present study is truly genus wide and can detect a wide range of Mycobacterium spp. The assay is particularly important for testing fixed tissue samples (FFPE), the most common sample type in routine fish disease investigation laboratories. o The immunohistochemical assay of the present study is more sensitive compared to traditional ZN staining. This assay can therefore be used in routine fish disease diagnostic and research laboratories as a better alternative for in situ detection of mycobacterial infections. o M. salmoniphilum is demonstrated to be a potentially important pathogen for fish both in fresh- and probably marine water in Norway. In the present study, this bacterial species is confirmed to be pathogenic to non-salmonid fishes (Atlantic cod and burbot) for the first time. o In the present study, Atlantic cod was demonstrated to be highly susceptible to M. salmoniphilum, and this reflects the possible threat mycobacterial infections may pose to the cod farming in the future. o Comparative macroscopic and microscopic observations in salmonid and gadoid fishes in the present study confirmed the existence of variations in pathological responses to mycobacterial (M. salmoniphilum) infections in the two fish groups. While the primary pathological response in burbot and Atlantic cod was extensive granuloma development with well stratified structure and dissemination in multiple organs, the granuloma in Atlantic salmon was mild (poorly structured and not highly disseminated) and may on occasion, be absent. The contrasting observations may lead to better disease diagnosis in piscine hosts in the future. These observations will help to avoid misdiagnosis of mycobacterial infections which do not result in manifestation of granulomatous lesions. o A series of developmental stages of granuloma, which is characteristic to the cod infection, may function as an estimate of time of infection and disease progress in a given piscine host.
57
12. Future work o The present study has revealed the importance of mycobacterial infection both in aquaculture and wild fish in marine and freshwater environments in Norway; however a broader epidemiological study could provide a better understanding of prevalence and relevance of the disease and associated mycobacterial species in Norway. o This study has confirmed that M. salmoniphilum caused infections both in marine and freshwater fishes. Beyond assumptions and speculations, the real source of infection is not known. Identification of sources of infection and determination of whether M. salmoniphilum is a true “pathogen” or an “opportunist” requiring an immunocompromised piscine host may be one of the focuses of future work. o Mycobacterial infections, especially in Atlantic salmon manifest very diffuse pathology which may complicate the diagnosis in this fish species. One future study should therefore focus on studying the clinical and pathological features of the disease using a long-term experimental infection in salmonid fish. o Characterization of the different M. salmoniphilum isolates from various geographic locations may be essential to look for variable strains with variable virulence.
58
13. References 1.
2.
3.
4. 5. 6. 7.
8. 9.
10.
11.
12. 13. 14.
15. 16.
17.
Adékambi, T., P. Colson and M. Drancourt (2003). "rpoB-based identification of nonpigmented and late-pigmenting rapidly growing mycobacteria." Journal of Clinical Microbiology 41, 5699-5708. Adékambi, T. and M. Drancourt (2004). "Dissection of phylogenetic relationships among 19 rapidly growing Mycobacterium species by 16S rRNA, hsp65, sodA, recA and rpoB gene sequencing." International Journal of systematic and Evolutionary Microbiology 54, 2095-2105. Alexander, D. M. (1931). "A review of piscine tubercle, with a description of an acidfast bacillus found in the cod." Transactions of the Liverpool Biological Society 27, 219-226. Alexander, J. B. and G. A. Ingram (1992). "Noncellular nonspecific defence mechanisms of fish." Annual Review of Fish Diseases 2, 249-279. Allen, J. L. (1992). "A Modified Ziehl-Neelsen Stain for Mycobacteria." Medical Laboratory Sciences 49, 99-102. Amer, A. O. and M. S. Swanson (2002). "A phagosome of one's own: a microbial guide to life in the macrophage." Current Opinion in Microbiology 5, 56-61. Anderson, D. P. (1996). Environmental factors in fish health immunological aspects. In The fish immune system: Organism, Pathogen and Environment (G. Iwama and T. Nakanishi, eds), pp. 289-305. Academic Press, San Diego, USA. Anderson, I. G., M. Shariff and M. N. Shamsudin (1987). "Ornamental fish mycobacteriosis in Malaysia." Kajian Veterinar 19, 61-70. Ang, P., N. Rattana-Apiromyakij and C. L. Goh (2000). "Retrospective study of Mycobacterium marinum skin infections." International Journal of Dermatology 39, 343-347. Anonymous (1997). "Diagnosis and Treatment of Disease Caused by Nontuberculous Mycobacteria." American Journal of Respiratory and Critical Care Medicine 156, S1S25. Anonymous (2009a). "Strategi for en miljømessig bærekraftig havbruksnæring." Fiskeri og Kystdepartementet (Norwegian Ministry of Fisheries and Coastal Affairs). http://www.regjeringen.no/upload/FKD/Vedlegg/Brosjyrer/2009/Brosjyre_strategi_baer ekraftig_havbruk.pdf. Anonymous (2009b). "A world leader in aquaculture." Nortrade. http://www.nortrade.com/sectors/articles/a-world-leader-in-aquaculture/. Anonymous (2011). "Fiskeoppdrett". Sentral statistiksbyrå, Norway. http://www.ssb.no/vis/emner/10/05/fiskeoppdrett/art-2011-12-01-01.html. Arakawa, C. K. and J. L. Fryer (1984). "Isolation and characterization of a new subspecies of Mycobacterium chelonei; infectious for salmonid fish." Helgoland Marine Research 37, 329-342. Arakawa, C. K., J. L. Fryer and J. E. Sanders (1986). "Serology of Mycobacterium chelonei isolated from salmonid fish." Journal of Fish Diseases 9, 269-271. Arend, S. M., R. Janssen, J. J. Gosen, H. Waanders, T. de Boer, T. H. Ottenhoff and J. T. van Dissel (2001). "Multifocal osteomyelitis caused by nontuberculous mycobacteria in patients with a genetic defect of the interferon-gamma receptor." The Netherlands Journal of Medicine 59, 140-151. Aronson, J. D. (1926). "Spontaneous Tuberculosis in Salt Water Fish." Journal of Infectious Diseases 39, 312-320.
59
18.
19.
20.
21.
22.
23.
24. 25.
26.
27. 28. 29.
30. 31.
32.
33. 34.
Arruda, S., G. Bomfim, R. Knights, T. Huima-Byron and L. W. Riley (1993). "Cloning of an M. tuberculosis DNA fragment associated with entry and survival inside cells." Science 261, 1454-1457. Ashburner, L. D. (1977). "Mycobacteriosis in hatchery–confined chinook salmon (Oncorhynchus tshawytscua Walbaum) in Australia." Journal of Fish Biology 10, 523528. Astrofsky, K. M., M. D. Schrenzel, R. A. Bullis, R. M. Smolowitz and J. G. Fox (2000). "Diagnosis and management of atypical Mycobacterium spp. infections in established laboratory zebrafish (Brachydanio rerio) facilities." Comparative Medicine 50, 666672. Austin, B. and D. A. Austin (2007a). Characteristics of the diseases. In Bacterial fish pathogens - Diseases of farmed and wild fish (B. Austin and D. A. Austin, eds), pp. 1546. Springer and Praxis Publishing Ltd., Chichester, UK. Austin, B. and D. A. Austin (2007b). Diagnosis. In Bacterial fish pathogens - Diseases of farmed and wild fish (B. Austin and D. A. Austin, eds), pp. 185-235. Springer and Praxis Publishing Ltd., Chichester, UK. Backman, S., H. W. Ferguson, J. F. Prescott and B. P. Wilcock (1990). "Progressive Panophthalmitis in Chinook Salmon, Oncorhynchus-Tshawytscha (Walbaum) - a CaseReport." Journal of Fish Diseases 13, 345-353. Barken, K. B., J. A. J. Haagensen and T. Tolker-Nielsen (2007). "Advances in nucleic acid-based diagnostics of bacterial infections." Clinica Chimica Acta 384, 1-11. Bataillon, E., J. Dubard and L. Terre (1897). "Un nouveau type de tuberculose." Comptes Rendus Hebdomadaires des Séances et Mémoires de la Société de Biologie. 49, 446-449. Belas, R., P. Faloon and A. Hannaford (1995). "Potential applications of molecular biology to the study of fish mycobacteriosis." Annual Review of Fish Diseases 5, 133173. Belisle, J. T. and M. G. Sonnenberg (1998). "Isolation of genomic DNA from mycobacteria." Methods in Molecular Biology 101, 31-44. Bishop, P. J. and G. Neumann (1970). "The history of the Ziehl-Neelsen stain." Tubercle 51, 196-206. Bjørn, P. A. and B. Finstad (2002). "Salmon lice, Lepeophtheirus salmonis (Krøyer), infestation in sympatric populations of Arctic char, Salvelinus alpinus (L.), and sea trout, Salmo trutta (L.), in areas near and distant from salmon farms." ICES Journal of Marine Science: Journal du Conseil 59, 131-139. Bleie, H. (2009). "Cod farming with a bright future!" http://www.fiskeriforum.no/uploads/media/COD_ACF.pdf. Bornø, G. and C. Sviland (2010). "Farmed Fish Health Report 2009." Norwegian Veterinary Institute. http://www.vetinst.no/eng/Research/Publications/Fish-HealthReport/Farmed-Fish-Health-Report-2009. Bornø, G. and C. Sviland (2011). "Farmed Fish Health Report 2010". Norwegian Veterinary Institute. http://www.vetinst.no/eng/Research/Publications/Fish-HealthReport/Farmed-Fish-Healt-Report-2010. Brennan, P. J. and H. Nikaido (1995). "The Envelope of Mycobacteria." Annual Review of Biochemistry 64, 29-63. Brocklebank, J., S. Raverty and J. Robinson (2003). "Mycobacteriosis in Atlantic salmon farmed in British Columbia." Canadian Veterinary Journal-Revue Veterinaire Canadienne 44, 486-489.
60
35.
36.
37.
38.
39.
40.
41.
42.
43. 44.
45.
46.
47.
48.
49.
Brooks, R. W., K. L. George, B. C. Parker, J. O. Falkinham, 3rd and H. Gruff (1984). "Recovery and survival of nontuberculous mycobacteria under various growth and decontamination conditions." Canadian Journal of Microbiology 30, 1112-1117. Broussard, G. W. and D. G. Ennis (2007). "Mycobacterium marinum produces longterm chronic infections in medaka: A new animal model for studying human tuberculosis." Comparative Biochemistry and Physiology: Toxicology & Pharmacology 145, 45-54. Bruijnesteijn Van Coppenraet, E. S., J. A. Lindeboom, J. M. Prins, M. F. Peeters, E. C. Claas and E. J. Kuijper (2004). "Real-time PCR assay using fine-needle aspirates and tissue biopsy specimens for rapid diagnosis of mycobacterial lymphadenitis in children." Journal of Clinical Microbiology 42, 2644-2650. Bruno, D. W., J. Griffiths, C. G. Mitchell, B. P. Wood, Z. J. Fletcher, F. A. Drobniewski and T. S. Hastings (1998). "Pathology attributed to Mycobacterium chelonae infection among farmed and laboratory-infected Atlantic salmon Salmo salar." Diseases of Aquatic Organisms 33, 101-109. Brutus, J. P., Y. Baeten, N. Chahidi, L. Kinnen, P. Ledoux and J. P. Moermans (2001). "Atypical mycobacterial infections of the hand: report of eight cases and literature review." Chirurgie de la Main 20, 280-286. Bucke, D. (1989). "Observations on visceral granulomatosis and dermal necrosis in populations of North Sea cod (Gadus morhua)." International Council for the Exploration of the Sea, Marine Environmental Quality Committee (ICES CM) 1989/E:17. Burge, E. J., D. T. Gauthier, C. A. Ottinger and P. A. Van Veld (2004a). "Mycobacterium-inducible Nramp in striped bass (Morone saxatilis)." Infection and Immunity 72, 1626-1636. Burge, E. J., D. T. Gauthier and P. A. Van Veld (2004b). "In vitro response of the striped bass natural resistance-associated macrophage protein, Nramp, to LPS and Mycobacterium marinum exposure." Comparative Biochemistry and Physiology Part C: Toxicology & Pharmacology 138, 391-400. Böttger, E. C. (1996). "Approaches for identification of microorganisms." American Society for Microbiology News 62, 247-250. Carvalho, R., J. de Sonneville, O. W. Stockhammer, N. D. Savage, W. J. Veneman, T. H. Ottenhoff, R. P. Dirks, A. H. Meijer and H. P. Spaink (2011). "A high-throughput screen for tuberculosis progression." PLoS One 6, e16779. Castro, R., D. Bernard, M. P. Lefranc, A. Six, A. Benmansour and P. Boudinot (2011). "T cell diversity and TcR repertoires in teleost fish." Fish and Shellfish Immunology 31, 644-654. Cefas (2003). "Monitoring of the quality of the marine environment, 1999-2000." Science Series Aquatic Environment Monitoring Report 54, Centre for Environment, Fisheries and Aquaculture Science (Cefas), Lowestoft, UK. Chan, K., T. Knaak, L. Satkamp, O. Humbert, S. Falkow and L. Ramakrishnan (2002). "Complex pattern of Mycobacterium marinum gene expression during long-term granulomatous infection." Proceedings of the National Academy of Sciences of the United States of America 99, 3920-3925. Chang, T. C., C. Y. Hsieh, C. D. Chang, Y. L. Shen, K. C. Huang, C. Tu, L. C. Chen, Z. B. Wu and S. S. Tsai (2006). "Pathological and molecular studies on mycobacteriosis of milkfish Chanos chanos in Taiwan." Diseases of Aquatic Organisms 72, 147-151. Chen, S. L., Z. J. Wang, M. Y. Xu and J. F. Gui (2006). "Molecular identification and expression analysis of natural resistance associated macrophage protein (Nramp) cDNA
61
50.
51. 52.
53.
54. 55. 56.
57. 58.
59. 60.
61. 62.
63. 64.
65.
66. 67.
from Japanese flounder (Paralichthys olivaceus)." Fish and Shellfish Immunology 20, 365-373. Chinabut, S. (1999). Mycobacteriosis and nocardiosis. In Fish Diseases and Disorders: Viral, Bacterial, and Fungal Infections (P.T.K. Woo and D.W. Bruno, eds). pp. 319-340. CAB International, New York, USA. Chinabut, S., C. Limsuwan and P. Chanratchakool (1990). "Mycobacteriosis in the snakehead, Channa striatus (Fowler)." Journal of Fish Diseases 13, 531-535. Cirillo, J. D., S. Falkow, L. S. Tompkins and L. E. Bermudez (1997). "Interaction of Mycobacterium avium with environmental amoebae enhances virulence." Infection and Immunity 65, 3759-3767. Clemens, D. L., B. Y. Lee and M. A. Horwitz (2000). "Deviant expression of Rab5 on phagosomes containing the intracellular pathogens Mycobacterium tuberculosis and Legionella pneumophila is associated with altered phagosomal fate." Infection and Immunity 68, 2671-2684. Co, D. O., L. H. Hogan, S. I. Kim and M. Sandor (2004). "Mycobacterial granulomas: keys to a long-lasting host-pathogen relationship." Clinical Immunology 113, 130-136. Cole, S. T. (1999). "Learning from the genome sequence of Mycobacterium tuberculosis H37Rv." FEBS Letters 452, 7-10. Colorni, A. (1992). "A Systemic Mycobacteriosis in the European sea bass Dicentrarchus labrax Cultured in Eilat (Red-Sea)." Israeli Journal of AquacultureBamidgeh 44, 75-81. Colquhoun, D. J. and S. Duodu (2011). "Francisella infections in farmed and wild aquatic organisms." Veterinary Research 42, 47. Colston, M. J. and R. A. Cox (1999). Mycobacterial growth and dormancy. In Mycobacteria: Molecular Biology and Virulence (C. Ratledge and J. Dale, eds), pp. 198-219. Blackwell Science, London, UK. Conroy, D. A. (1966). "Observations on spontaneous cases of tuberculosis in fish." Microbiologia Española 19, 93-113. Da Silva, T. R., J. R. De Freitas, Q. C. Silva, C. P. Figueira, E. Roxo, S. C. Leao, L. A. De Freitas and P. S. Veras (2002). "Virulent Mycobacterium fortuitum restricts NO production by a gamma interferon-activated J774 cell line and phagosome-lysosome fusion." Infection and Immunity 70, 5628-5634. Daffe, M. and P. Draper (1998). "The envelope layers of mycobacteria with reference to their pathogenicity." Advances in Microbial Physiology 39, 131-203. Dailloux, M., M. Albert, C. Laurain, S. Andolfatto, A. Lozniewski, P. Hartemann and L. Mathieu (2003). "Mycobacterium xenopi and drinking water biofilms." Applied and Environmental Microbiology 69, 6946-6948. Dalsgaard, I., S. Mellergaard and J. L. Larsen (1992). "Mycobacteriosis in Cod (Gadus morhua L.) in Danish Coastal Waters." Aquaculture 107, 211-219. Das, B. K., K. K. Nayak, M. Fourrier, B. Collet, M. Snow and A. E. Ellis (2007). "Expression of Mx protein in tissues of Atlantic salmon post-smolts - An immunohistochemical study." Fish and Shellfish Immunology 23, 1209-1217. Davis, J. M., H. Clay, J. L. Lewis, N. Ghori, P. Herbomel and L. Ramakrishnan (2002). "Real-time visualization of Mycobacterium-macrophage interactions leading to initiation of granuloma formation in zebrafish embryos." Immunity 17, 693-702. Dawson, D. J. (2000). "Mycobacterial terminology." Journal of Clinical Microbiology 38, 3913. De Cock, K. M., B. Soro, I. M. Coulibaly and S. B. Lucas (1992). "Tuberculosis and HIV infection in sub-Saharan Africa." The Journal of the American Medical Association 268, 1581-1587. 62
68. 69.
70.
71.
72.
73. 74. 75. 76. 77. 78. 79. 80. 81. 82.
83.
84.
85. 86.
De Smet, L. (2008). "Mycobacterium marinum infections of the hand: A report of three cases." The Acta Chirurgica Belgica 108, 779-782. Decostere, A., K. Hermans and F. Haesebrouck (2004). "Piscine mycobacteriosis: a literature review covering the agent and the disease it causes in fish and humans." Veterinary Microbiology 99, 159-166. Denholm, I., G. J. Devine, T. E. Horsberg, S. Sevatdal, A. Fallang, D. V. Nolan and R. Powell (2002). "Analysis and management of resistance to chemotherapeutants in salmon lice, Lepeophtheirus salmonis (Copepoda: Caligidae)." Pest Management Science 58, 528-536. Devulder, G., M. Perouse de Montclos and J. P. Flandrois (2005). "A multigene approach to phylogenetic analysis using the genus Mycobacterium as a model." International Journal of Systematic and Evolutionary Microbiology 55, 293-302. Diamant, A., A. Banet, M. Ucko, A. Colorni, W. Knibb and H. Kvitt (2000). "Mycobacteriosis in wild rabbitfish Siganus rivulatus associated with cage farming in the Gulf of Eilat, Red Sea." Diseases of Aquatic Organisms 39, 211-219. Dulin, M. P. (1979). "A review of tuberculosis (mycobacteriosis) in fish." Veterinary Medicine, Small Animal Clinician 74, 731-735. Durborow, R. M. (1999). "Health and safety concerns in fisheries and aquaculture." Occupational Medicine 14, 373-406. Eisenstadt, J. and G. S. Hall (1995). "Microbiology and classification of mycobacteria." Clinics in Dermatology 13, 197-206. El-Etr, S. H., L. Yan and J. D. Cirillo (2001). "Fish monocytes as a model for mycobacterial host-pathogen interactions." Infection and Immunity 69, 7310-7317. Ellis, A. E. (2001a). The immunology of teleosts. In Fish Pathology (R. J. Roberts, ed), pp. 133-150. W.B. Saunders, Edinburgh, UK. Ellis, A. E. (2001b). "Innate host defense mechanisms of fish against viruses and bacteria." Developmental and Comparative Immunology 25, 827-839. Falkinham, J. O. (1996). "Epidemiology of infection by nontuberculous mycobacteria." Clinical Microbiology Reviews 9, 177-215. FAO (2010). "The State of World Fisheries and Aquaculture -2010". Food and Agriculture Organization (FAO). http://www.fao.org/docrep/013/i1820e/i1820e.pdf. Ferrari, G., H. Langen, M. Naito and J. Pieters (1999). "A coat protein on phagosomes involved in the intracellular survival of mycobacteria." Cell 97, 435-447. Frerichs , G. N. (1993). Mycobacteriosis: Nocardiosis. In Bacterial diseases of fish (V. Inglis, R. J. Roberts and N. R. Bromage, eds), pp. 219-233. Halsted Press, New York, USA. Gao, L. Y., R. Groger, J. S. Cox, S. M. Beverley, E. H. Lawson and E. J. Brown (2003). "Transposon mutagenesis of Mycobacterium marinum identifies a locus linking pigmentation and intracellular survival." Infection and Immunity 71, 922-929. Gauthier, D. T., R. J. Latour, D. M. Heisey, C. F. Bonzek, J. Gartland, E. J. Burge and W. K. Vogelbein (2008). "Mycobacteriosis-associated mortality in wild striped bass (Morone saxatilis) from Chesapeake Bay, USA." Ecological Applications 18, 17181727. Gauthier, D. T. and M. W. Rhodes (2009). "Mycobacteriosis in fishes: A review." Veterinary Journal 180, 33-47. Gauthier, D. T., M. W. Rhodes, W. K. Vogelbein, H. Kator and C. A. Ottinger (2003). "Experimental mycobacteriosis in striped bass Morone saxatilis." Diseases of Aquatic Organisms 54, 105-117.
63
87.
88.
89.
90.
91. 92.
93.
94. 95. 96.
97.
98.
99.
100.
101. 102.
103.
Gauthier, D. T., W. K. Vogelbein and C. A. Ottinger (2004). "Ultrastructure of Mycobacterium marinum granuloma in striped bass Morone saxatilis." Diseases of Aquatic Oranisms 62, 121-132. George, K. M., D. Chatterjee, G. Gunawardana, D. Welty, J. Hayman, R. Lee and P. L. Small (1999). "Mycolactone: a polyketide toxin from Mycobacterium ulcerans required for virulence." Science 283, 854-857. Gheyas, A. A., C. S. Haley, D. R. Guy, A. Hamilton, A. E. Tinch, J. C. Mota-Velasco and J. A. Woolliams (2010). "Effect of a major QTL affecting IPN resistance on production traits in Atlantic salmon." Animal Genetics 41, 666-668. Ghosh, J., P. Larsson, B. Singh, B. M. Pettersson, N. M. Islam, S. N. Sarkar, S. Dasgupta and L. A. Kirsebom (2009). "Sporulation in mycobacteria." Proceedings of the National Academy of Sciences of the United States of America 106, 10781-10786. Gjøen, H. M. and H. B. Bentsen (1997). "Past, present, and future of genetic improvement in salmon aquaculture." ICES Journal of Marine Science 54, 1009-1014. Gómez, S., J. A. Navarro, M. A. Gómez, J. Sánchez and A. Bernabé (1996). "Comparative study of immunohistochemical methods to diagnose mycobacteriosis in swordtail Xiphophorus helleri." Diseases of Aquatic Organisms 24, 117-120. Goodfellow, M. and P. A. Jenkins (1998). Taxonomy of mycobacteria. In Mycobacteria: Vol.1, Basic aspects, (P.R.J. Gangadharam and P.A. Jenkins, eds), pp. 175. Chapman and Hall, London, UK. Gordon, A. H., P. D. Hart and M. R. Young (1980). "Ammonia inhibits phagosomelysosome fusion in macrophages." Nature 286, 79-80. Gordon, R. E. and J. M. Mihm (1959). "A comparison of four species of mycobacteria." Journal of General Microbiology 21, 736-748. Goren, M. B. (1977). "Phagocyte lysosomes: interactions with infectious agents, phagosomes, and experimental perturbations in function." Annual Review of Microbiology 31, 507-533. Goto, Y., R. M. Nakamura, H. Takahashi and T. Tokunaga (1984). "Genetic control of resistance to Mycobacterium intracellulare infection in mice." Infection and Immunity 46, 135-140. Grave, K., I. Litleskare and B. T. Lunestad (2002). "Forbruksmønsteret for legemidler til oppdrettfisk i Norge i perioden 1996-2001: et gullkantet eksportsertifikat for norsk oppdrettsnæring." Norsk Veterinær Tidsskrift 114, 564-567. Gregoraszczuk, E. L., A. Rak, K. Kawalec and E. Ropstad (2008). "Steroid secretion following exposure of ovarian follicular cells to single congeners and defined mixture of polybrominateddibenzoethers (PBDEs), p,p'-DDT and its metabolite p,p'-DDE." Toxicology Letters 178, 103-109. Grimholt, U., S. Larsen, R. Nordmo, P. Midtlyng, S. Kjøglum, A. Storset, S. Saebo and R. J. Stet (2003). "MHC polymorphism and disease resistance in Atlantic salmon (Salmo salar); facing pathogens with single expressed major histocompatibility class I and class II loci." Immunogenetics 55, 210-219. Gros, P., E. Skamene and A. Forget (1981). "Genetic control of natural resistance to Mycobacterium bovis (BCG) in mice." Journal of Immunology 127, 2417-2421. Grove, S., C. R. Wiik-Nielsen, T. Lunder, H. S. Tunsjo, N. M. Tandstad, L. J. Reitan, A. Marthinussen, M. Sorgaard, A. B. Olsen and D. J. Colquhoun (2010). "Previously unrecognised division within Moritella viscosa isolated from fish farmed in the North Atlantic." Diseases of Aquatic Organisms 93, 51-61. Hall-Stoodley, L. and H. Lappin-Scott (1998). "Biofilm formation by the rapidly growing mycobacterial species Mycobacterium fortuitum." FEMS Microbiology Letters 168, 77-84. 64
104. Harada, K. (1973). "Effect of prior oxidation on the acid-fastness of mycobacteria." Stain Technology 48, 269-273. 105. Harada, K. (1977). "Staining mycobacteria with periodic acid-carbol-pararosanilin: principle and practice of the method." Microscopica Acta 79, 224-236. 106. Harms, C. A., K. E. Howard, J. C. Wolf, S. A. Smith and S. Kennedy-Stoskopf (2003). "Transforming growth factor-beta response to mycobacterial infection in striped bass Morone saxatilis and hybrid tilapia Oreochromis spp." Veterinary Immunology and Immunopathology 95, 155-163. 107. Haugland, O., A. B. Mikalsen, P. Nilsen, K. Lindmo, B. J. Thu, T. M. Eliassen, N. Roos, M. Rode and O. Evensen (2011). "Cardiomyopathy syndrome of Atlantic salmon (Salmo salar L.) is caused by a double-stranded RNA virus of the Totiviridae family." Journal of Virology 85, 5275-5286. 108. Heckert, R. A., S. Elankumaran, A. Milani and A. Baya (2001). "Detection of a new Mycobacterium species in wild striped bass in the Chesapeake Bay." Journal of Clinical Microbiology 39, 710-715. 109. Hedrick, R. P., T. McDowell and J. Groff (1987). "Mycobacteriosis in cultured striped bass from California." Journal of Wildlife Diseases 23, 391-395. 110. Hellberg, H., D. Colquhoun, H. Hansen, H. Nilsen, G. Bornø, H. K. Skjelstad, K. Flesjå, M. A. Wasmuth and B. Hjeltnes (2008). "The health situation in farmed fish in Norway 2007". Norwegian Veterinary Institute. http://www.vetinst.no/eng/Publications/FishHealth-Report/Farmed-Fish-Health-Report-2007. 111. Hellberg, H., A. Kvellestad, B. Dannevig, G. Bornø, I. Modahl, R. N. Haldorsen, F. Vik-Mo, K. Ottesen, E. M. Saetre and H. Sindre (2010). "Outbreaks of viral nervous necrosis in juvenile and adult farmed Atlantic cod, Gadus morhua L., in Norway." Journal of Fish Diseases 33, 75-81. 112. Herbst, L. H., S. F. Costa, L. M. Weiss, L. K. Johnson, J. Bartell, R. Davis, M. Walsh and M. Levi (2001). "Granulomatous skin lesions in moray eels caused by a novel Mycobacterium species related to Mycobacterium triplex." Infection and Immunity 69, 4639-4646. 113. Herdman, A. V. and J. C. H. Steele (2004). "The new mycobacterial species - emerging or newly distinguished pathogens." Clinics in Laboratory Medicine 24, 651-690. 114. Holm, J. A. (2009). "Cod with francisellosis and/or atypical furunculosis (In Norwegian)." Norsk Fiskeoppdrett 3, 68-70. 115. Holt, J. G. and D. H. Bergey (1984). Genus Mycobacterium Lehmann and Neumann 1896, 363AL. In Bergey's manual of systematic bacteriology (J. G. Holt and D. H. Bergey, eds). pp. 1436-1457. Williams & Wilkins, Baltimore, Md., USA. 116. Hueffer, K., T. M. O'Hara and E. H. Follmann (2011). "Adaptation of mammalian hostpathogen interactions in a changing arctic environment." Acta Veterinaria Scandinavica 53, 17. 117. Hunter, R. L., M. R. Olsen, C. Jagannath and J. K. Actor (2006). "Multiple roles of cord factor in the pathogenesis of primary, secondary, and cavitary tuberculosis, including a revised description of the pathology of secondary disease." Annals of Clinical and Laboratory Science 36, 371-386. 118. Iversen, M., B. Finstad, R. S. McKinley, R. A. Eliassen, K. T. Carlsen and T. Evjen (2005). "Stress responses in Atlantic salmon (Salmo salar L.) smolts during commercial well boat transports, and effects on survival after transfer to sea." Aquaculture 243, 373382. 119. Jacobs, J. M., C. B. Stine, A. M. Baya and M. L. Kent (2009). "A review of mycobacteriosis in marine fish." Journal of Fish Diseases 32, 119-130.
65
120. Johansen, R., R. T. Kongtrop, G. Bornø, H. K. Skjelstad, A. B. Olsen, K. Flesjå, D. Colquhoun, I. Ørpetveit, H. Hansen, Å. H. Garseth and B. Hjeltnes (2009). "The health situation in farmed fish in Norway 2008". Norwegian Veterinary Institute. http://www.vetinst.no/eng/Publications/Fish-Health-Report/Farmed-Fish-HealthReport-2008. 121. Kaattari, I. M., M. W. Rhodes, S. L. Kaattari and E. B. Shotts (2006). "The evolving story of Mycobacterium tuberculosis clade members detected in fish." Journal of Fish Diseases 29, 509-520. 122. Kalis, C. H., J. W. Hesselink, E. W. Russchen, H. W. Barkema, M. T. Collins and I. J. Visser (1999). "Factors influencing the isolation of Mycobacterium avium subsp. paratuberculosis from bovine fecal samples." Journal of Veterinary Diagnostic Investigation 11, 345-351. 123. Kent, M. L., C. M. Whipps, J. L. Matthews, D. Florio, V. Watral, J. K. Bishop-Stewart, M. Poort and L. Bermudez (2004). "Mycobacteriosis in zebrafish (Danio rerio) research facilities." Comparative Biochemistry and Physiology Patr C: Toxicology & Pharmacology 138, 383-390. 124. Kent, P. T. and G. P. Kubica (1985). Public health mycobacteriology : a guide for the level III laboratory. US Deptartment of Health and Human Services, Public Health Service, Centers for Disease Control. Atlanta, Ga., USA. 125. Khan, I. U. H. and J. S. Yadav (2004). "Real-time PCR assays for genus-specific detection and quantification of culturable and non-culturable mycobacteria and pseudomonads in metalworking fluids." Molecular and Cellular Probes 18, 67-73. 126. Kiernan, J. A. (1999). Histological and histochemical methods: Theory and practice. Butterworth Heinemann, Oxford, UK. 127. Kim, H., S. H. Kim, T. S. Shim, M. N. Kim, G. H. Bai, Y. G. Park, S. H. Lee, G. T. Chae, C. Y. Cha, Y. H. Kook and B. J. Kim (2005). "Differentiation of Mycobacterium species by analysis of the heat-shock protein 65 gene (hsp65)." International Journal of Systematic and Evolutionary Microbiology 55, 1649-1656. 128. Kjøglum, S., S. Larsen, H. G. Bakke and U. Grimholt (2008). "The effect of specific MHC class I and class II combinations on resistance to furunculosis in Atlantic salmon (Salmo salar)." Scandinavian Journal of Immunology 67, 160-168. . 129. Knibb, W., A. Colorni, M. Ankaoua, D. Lindell, A. Diamant and H. Gordin (1993). "Detection and identification of a pathogenic marine Mycobacterium from the European seabass Dicentrarchus labrax using polymerase chain reaction and direct sequencing of 16S rDNA sequences." Molecular Marine Biology and Biotechnology 2, 225-232. 130. Koch, R. (1882). "Die Aetiologie der Tuberculose." Berliner Klinische Wochenschrift 19, 221-230. 131. Koppang, E. O., E. Haugarvoll, I. Hordvik, L. Aune and T. T. Poppe (2005). "Vaccineassociated granulomatous inflammation and melanin accumulation in Atlantic salmon, Salmo salar L., white muscle." Journal of Fish Diseases 28, 13-22. 132. Kox, L. F., J. van Leeuwen, S. Knijper, H. M. Jansen and A. H. Kolk (1995). "PCR assay based on DNA coding for 16S rRNA for detection and identification of mycobacteria in clinical samples." Journal of Clinical Microbiology 33, 3225-3233. 133. Kraus, G., T. Cleary, N. Miller, R. Seivright, A. K. Young, G. Spruill and H. J. Hnatyszyn (2001). "Rapid and specific detection of the Mycobacterium tuberculosis complex using fluorogenic probes and real-time PCR." Molecular and Cellular Probes 15, 375-383. 134. Krkošek, M., M. A. Lewis, A. Morton, L. N. Frazer and J. P. Volpe (2006). "Epizootics of wild fish induced by farm fish." Proceedings of the National Academy of Sciences of the United States of America 103, 15506-15510. 66
135. Lamont, E. A., J. P. Bannantine, A. Armien, D. S. Ariyakumar and S. Sreevatsan (2012). "Identification and characterization of a spore-like morphotype in chronically starved Mycobacterium avium subsp. paratuberculosis cultures." PLoS One 7, e30648. 136. Langefors, Å., J. Lohm, M. Grahn, Ø. Andersen and T. von Schantz (2001). "Association between major histocompatibility complex class IIB alleles and resistance to Aeromonas salmonicida in Atlantic salmon." Proceedings of the Royal Society Biological Sciences 268, 479-485. 137. Lansdell, W., B. Dixon, N. Smith and L. Benjamin (1993). "Isolation of Several Mycobacterium Species from Fish." Journal of Aquatic Animal Health 5, 73-76. 138. Larsen, J. L. (1983). "Vibrio anguillarum: a comparative study of fish pathogenic, environmental, and reference strains." Acta Veterinaria Scandinavica 24, 456-476. 139. Lees, F., M. Baillie, G. Gettinby and C. W. Revie (2008). "The Efficacy of Emamectin Benzoate against Infestations of Lepeophtheirus salmonis on Farmed Atlantic Salmon (Salmo salar L) in Scotland, 2002–2006." PLoS One 3, e1549. 140. Lescenko, P., L. Matlova, L. Dvorska, M. Bartos, O. Vavra, S. Navratil, L. Novotny and I. Pavlik (2003). "Mycobacterial infection in aquarium fish." Veterinarni Medicina 48, 71-78. 141. Levi, M. H., J. Bartell, L. Gandolfo, S. C. Smole, S. F. Costa, L. M. Weiss, L. K. Johnson, G. Osterhout and L. H. Herbst (2003). "Characterization of Mycobacterium montefiorense sp. nov., a novel pathogenic Mycobacterium from moray eels that is related to Mycobacterium triplex." Journal of Clinical Microbiology 41, 2147-2152. 142. Lévy-Frébault, V. V. and F. Portaels (1992). "Proposed minimal standards for the genus Mycobacterium and for description of new slowly growing Mycobacterium species." International Journal of Systematic Bacteriology 42, 315-323. 143. Lewin, A., B. Freytag, B. Meister, S. Sharbati-Tehrani, H. Schafer and B. Appel (2003). "Use of a quantitative TaqMan-PCR for the fast quantification of mycobacteria in broth culture, eukaryotic cell culture and tissue." Journal of Veterinary Medicine 50, 505-509. 144. Lidar, M., O. Elkayam, D. Goodwin, M. Yaron and D. Caspi (2003). "Protracted Mycobacterium kansasii carpal tunnel syndrome and tenosynovitis." The Israel Medical Association Journal 5, 453-454. 145. Lillehaug, A. (1991). "Vaccination of Atlantic Salmon (Salmo Salar L.) against ColdWater Vibriosis - Duration of Protection and Effect on Growth-Rate." Aquaculture 92, 99-107. 146. Lillehaug, A., B. T. Lunestad and K. Grave (2003). "Epidemiology of bacterial diseases in Norwegian aquaculture - a description based on antibiotic prescription data for the ten-year period 1991 to 2000." Diseases of Aquatic Organisms 53, 115-125. 147. Lim, S. Y., B. J. Kim, M. K. Lee and K. Kim (2008). "Development of a real-time PCRbased method for rapid differential identification of Mycobacterium species." Letters in Applied Microbiology 46, 101-106. 148. Lohm, J., M. Grahn, Å. Langefors, Ø. Andersen, A. Storset and T. von Schantz (2002). "Experimental evidence for major histocompatibility complex-allele-specific resistance to a bacterial infection." Proceedings of the Royal Society - Biological Sciences 269, 2029-2033. 149. Mackay, I. M. (2004). "Real-time PCR in the microbiology laboratory." Clinical Microbiology and Infection 10, 190-212. 150. Mackenzie, K. (1988). "Presumptive Mycobacteriosis in North-east Atlantic Mackerel, Scomber Scombrus L." Journal of Fish Biology 32, 263-275. 151. MAFF (1991). Monitoring and Surveillance of Non-radioactive Contaminants in the Aquatic Environment and Activities Regulating the Disposal of Wastes at Sea, 1988-89.
67
152.
153.
154.
155.
156.
157.
158.
159.
160.
161.
162.
163.
164.
165.
Aquatic environment monitoring report 26. Ministry of Agriculture, Fisheries and Food (MAFF), Directorate of Fish Research. Lowestoft, UK. Magnadóttir, B., S. S. Audunsdóttir, B. T. Bragason, B. Gisladóttir, Z. O. Jonsson and S. Gudmundsdóttir (2011). "The acute phase response of Atlantic cod (Gadus morhua): Humoral and cellular response." Fish & Shellfish Immunology 30, 1124-1130. Magnadóttir, B., S. H. Bambir, B. K. Gudmundsdóttir, L. Pilstrøm and S. Helgason (2002). "Atypical Aeromonas salmonicida infection in naturally and experimentally infected cod, Gadus morhua L." Journal of Fish Diseases 25, 583-597. Mariussen, E., E. Fjeld, K. Breivik, E. Steinnes, A. Borgen, G. Kjellberg and M. Schlabach (2008). "Elevated levels of polybrominated diphenyl ethers (PBDEs) in fish from Lake Mjøsa, Norway." Science of the Total Environment 390, 132-141. Martinez, F. O., L. Helming and S. Gordon (2009). "Alternative activation of macrophages: an immunologic functional perspective." Annual Review of Immunology 27, 451-483. Marty, G. D., S. M. Saksida and T. J. Quinn (2010). "Relationship of farm salmon, sea lice, and wild salmon populations." Proceedings of the National Academy of Sciences of the United States of America 107, 22599-22604. McDonough, K. A., Y. Kress and B. R. Bloom (1993). "Pathogenesis of tuberculosis: interaction of Mycobacterium tuberculosis with macrophages." Infection and Immunity 61, 2763-2773. McNabb, A., D. Eisler, K. Adie, M. Amos, M. Rodrigues, G. Stephens, W. A. Black and J. Isaac-Renton (2004). "Assessment of partial sequencing of the 65-kilodalton heat shock protein gene (hsp65) for routine identification of Mycobacterium species isolated from clinical sources." Journal of Clinical Microbiology 42, 3000-3011. Midtlyng, P. J. and A. Lillehaug (1998). "Growth of Atlantic salmon Salmo salar after intraperitoneal administration of vaccines containing adjuvants." Diseases of Aquatic Organisms 32, 91-97. Midtlyng, P. J., A. Storset, C. Michel, W. J. Slierendrecht and N. Okamoto (2002). "Breeding for disease resistance in fish." Bulletin of the European Association of Fish Pathologists 22, 166-172. Mijs, W., P. de Haas, R. Rossau, T. Van der Laan, L. Rigouts, F. Portaels and D. van Soolingen (2002). "Molecular evidence to support a proposal to reserve the designation Mycobacterium avium subsp avium for bird-type isolates and M. avium subsp hominissuis for the human/porcine type of M. avium." International Journal of Systematic and Evolutionary Microbiology 52, 1505-1518. Mikalsen, J., A. B. Olsen, T. Tengs and D. J. Colquohoun (2007). "Francisella philomiragia subsp. noatunensis subsp. nov., isolated from farmed Atlantic cod (Gadus morhua L.)." International Journal of Systematic and Evolutionary Microbiology 57, 1960-1965. Moen, T., M. Baranski, A. Sonesson and S. Kjoglum (2009). "Confirmation and finemapping of a major QTL for resistance to infectious pancreatic necrosis in Atlantic salmon (Salmo salar): population-level associations between markers and trait." BMC Genomics 10, 368. Morgan, B. P., K. J. Marchbank, M. P. Longhi, C. L. Harris and A. M. Gallimore (2005). "Complement: central to innate immunity and bridging to adaptive responses." Immunology Letters 97, 171-179. Morgan, M. A., C. D. Horstmeier, D. R. DeYoung and G. D. Roberts (1983). "Comparison of a radiometric method (BACTEC) and conventional culture media for recovery of mycobacteria from smear-negative specimens." Journal of Clinical Microbiology 18, 384-388. 68
166. Moulder, J. W. (1985). "Comparative biology of intracellular parasitism." Microbiological Reviews 49, 298-337. 167. Nakamura, T., Y. Yamamura, T. Tsuruta, K. Tomoda, M. Sakaguchi and M. Tsukano (2001). "Mycobacterium kansasii arthritis of the foot in a patient with systemic lupus erythematosus." Internal Medicine 40, 1045-1049. 168. Nigrelli, R. F. and H. Vogel (1963). "Spontaneous tuberculosis in fishes and in other cold-blooded vertebrates with special reference to Mycobacterium fortuitum Cruz from fish and human lesions." Zoologica (New York) 48, 131-143. 169. Nikoskelainen, S., O. Kjellsen, E. M. Lilius and M. B. Schroder (2006). "Respiratory burst activity of Atlantic cod (Gadus morhua L.) blood phagocytes differs markedly from that of rainbow trout." Fish and Shellfish Immunology 21, 199-208. 170. Noga, E. J. (2000). Fish disease: diagnosis and treatment. Iowa State University Press. Ames, Iowa, USA. 171. Noga, E. J., J. F. Wright and L. Pasarell (1990). "Some unusual features of mycobacteriosis in the cichlid fish Oreochromis mossambicus." Journal of Comparative Pathology 102, 335-344. 172. Novotny, L., L. Dvorska, A. Lorencova, V. Beran and I. Pavlik (2004a). "Fish: a potential source of bacterial pathogens for human beings." Veterinarni medicina - Czech 49, 343-358. 173. Nunn, P. P., A. M. Elliott and K. P. McAdam (1994). "Tropical respiratory medicine. 2. Impact of human immunodeficiency virus on tuberculosis in developing countries." Thorax 49, 511-518. 174. Nylund, A., K. F. Ottem, K. Watanabe, E. Karlsbakk and B. Krossøy (2006). "Francisella sp. (Family Francisellaceae) causing mortality in Norwegian cod (Gadus morhua) farming." Archives of Microbiology 185, 383-392. 175. Olsen, A. B. and H. Hellberg (2012). "Fiskehelserapporten 2011." Norwegian Veterinary Institute. http://www.vetinst.no/content/download/9018/106440/file/2011_Fiskehelserapporten_w ebversjon_ny.pdf. 176. Olsen, A. B., J. Mikalsen, M. Rode, A. Alfjorden, E. Hoel, K. Straum-Lie, R. Haldorsen and D. J. Colquhoun (2006). "A novel systemic granulomatous inflammatory disease in farmed Atlantic cod, Gadus morhua L., associated with a bacterium belonging to the genus Francisella." Journal of Fish Diseases 29, 307-311. 177. Ottem, K. F., A. Nylund, T. E. Isaksen, E. Karlsbakk and O. Bergh (2008). "Occurrence of Francisella piscicida in farmed and wild Atlantic cod, Gadus morhua L., in Norway." Journal of Fish Diseases 31, 525-534. 178. Pahlevan, A. A., D. J. Wright, C. Andrews, K. M. George, P. L. Small and B. M. Foxwell (1999). "The inhibitory action of Mycobacterium ulcerans soluble factor on monocyte/T cell cytokine production and NF-kappa B function." Journal of Immunology 163, 3928-3935. 179. Pakarinen, J., T. Nieminen, T. Tirkkonen, I. Tsitko, T. Ali-Vehmas, P. Neubauer and M. S. Salkinoja-Salonen (2007). "Proliferation of mycobacteria in a piggery environment revealed by Mycobacterium-specific real-time quantitative PCR and 16S rRNA sandwich hybridization." Veterinary Microbiology 120, 105-112. 180. Palacios, G., M. Lovoll, T. Tengs, M. Hornig, S. Hutchison, J. Hui, R. T. Kongtorp, N. Savji, A. V. Bussetti, A. Solovyov, A. B. Kristoffersen, C. Celone, C. Street, V. Trifonov, D. L. Hirschberg, R. Rabadan, M. Egholm, E. Rimstad and W. I. Lipkin (2010). "Heart and skeletal muscle inflammation of farmed salmon is associated with infection with a novel reovirus." PLoS One 5, e11487.
69
181. Paperna, I., J. G. Harrison and G. W. Kissil (1980). "Pathology and histopathology of a systemic granuloma in Sparus aurata (L.) cultured in the Gulf of Aqaba." Journal of Fish Diseases 3, 213-221. 182. Parashar, D., D. S. Chauhan, V. D. Sharma and V. M. Katoch (2006). "Applications of real-time PCR technology to mycobacterial research." The Indian Journal of Medical Research 124, 385-398. 183. Parisot, T. J. and E. M. Wood (1960). "A comparative study of the causative agent of a mycobacterial disease of salmonoid fishes. 2. A description of the histopathology of the disease in Chinook salmon (Oncorhynchus tshawytscha) and a comparison of the staining characteristics of the fish disease with leprosy and human tuberculosis." The American Review of Respiratory Disease 82, 212-222. 184. Pate, M., V. Jencic, M. Zolnir-Dovc and M. Ocepek (2005). "Detection of mycobacteria in aquarium fish in Slovenia by culture and molecular methods." Diseases of Aquatic Organisms 64, 29-35. 185. Patel, J. B., D. G. Leonard, X. Pan, J. M. Musser, R. E. Berman and I. Nachamkin (2000). "Sequence-based identification of Mycobacterium species using the MicroSeq 500 16S rDNA bacterial identification system." Journal of Clinical Microbiology 38, 246-251. 186. Perez, A. T., D. A. Conroy and L. Quinones (2001). "Presence of acid-fast bacteria in wild and cultured silver mullets (Mugil curema VAL., 1836) from Margarita Island Venezuela." Interciencia 26, 252-256. 187. Pike, A. W. and S. L. Wadsworth (1999). "Sea lice on salmonids: their biology and control." Advances in Parasitology 44, 233-337. 188. Pitulle, C., M. Dorsch, J. Kazda, J. Wolters and E. Stackebrandt (1992). "Phylogeny of rapidly growing members of the genus Mycobacterium." International Journal of Systematic Bacteriology 42, 337-343. 189. Plumb, J. A. (1994). Health maintenance of cultured fishes: principal microbial diseases. CRC Press, Boca Raton, USA. 190. Poort, M. J., C. M. Whipps, V. G. Watral, W. F. Font and M. L. Kent (2006). "Molecular characterization of a Mycobacterium species in non-native poeciliids in Hawaii using DNA sequences." Journal of Fish Diseases 29, 181-185. 191. Poppe, T. T., G. Bæverfjord and T. Hansen (2007). Effects of intensive production with emphasis on on-growing production: fast growth, deformities and production-related diseases. In Aquaculture research: from cage to consumption (M. S. Thomassen, R. Gudding, B. Norberg and L Jørgensen, eds), pp. 120-135. Research Council of Norway, Oslo, Norway. 192. Press, C. M. and Ø. Evensen (1999). "The morphology of the immune system in teleost fishes." Fish and Shellfish Immunology 9, 309-318. 193. Primm, T. P., C. A. Lucero and J. O. Falkinham, 3rd (2004). "Health impacts of environmental mycobacteria." Clinical Microbiology Reviews 17, 98-106. 194. Prouty, M. G., N. E. Correa, L. P. Barker, P. Jagadeeswaran and K. E. Klose (2003). "Zebrafish-Mycobacterium marinum model for mycobacterial pathogenesis." FEMS Microbiology Letters 225, 177-182. 195. Ranger, B. S., E. A. Mahrous, L. Mosi, S. Adusumilli, R. E. Lee, A. Colorni, M. Rhodes and P. L. Small (2006). "Globally distributed mycobacterial fish pathogens produce a novel plasmid-encoded toxic macrolide, mycolactone F." Infection and Immunity 74, 6037-6045. 196. Rhodes, M. W., H. Kator, I. Kaattari, D. Gauthier, W. Vogelbein and C. A. Ottinger (2004). "Isolation and characterization of mycobacteria from striped bass Morone saxatilis from the Chesapeake Bay." Diseases of Aquatic Organisms 61, 41-51. 70
197. Rhodes, M. W., H. Kator, S. Kotob, P. van Berkum, I. Kaattari, W. Vogelbein, M. M. Floyd, W. R. Butler, F. D. Quinn, C. Ottinger and E. Shotts (2001). "A unique Mycobacterium species isolated from an epizootic of striped bass (Morone saxatilis)." Emerging Infectious Diseases 7, 896-899. 198. Rhodes, M. W., H. Kator, S. Kotob, P. van Berkum, I. Kaattari, W. Vogelbein, F. Quinn, M. M. Floyd, W. R. Butler and C. A. Ottinger (2003). "Mycobacterium shottsii sp. nov., a slowly growing species isolated from Chesapeake Bay striped bass (Morone saxatilis)." International Journal of Systematic and Evolutionary Microbiology 53, 421424. 199. Rhodes, M. W., H. Kator, A. McNabb, C. Deshayes, J. M. Reyrat, B. A. Brown-Elliott, R. Wallace, Jr., K. A. Trott, J. M. Parker, B. Lifland, G. Osterhout, I. Kaattari, K. Reece, W. Vogelbein and C. A. Ottinger (2005). "Mycobacterium pseudoshottsii sp. nov., a slowly growing chromogenic species isolated from Chesapeake Bay striped bass (Morone saxatilis)." International Journal of Systematic and Evolutionary Microbiology 55, 1139-1147. 200. Rissanen, A., E. Kurhela, T. Aho, T. Oittinen and M. Tiirola (2010). "Storage of environmental samples for guaranteeing nucleic acid yields for molecular microbiological studies." Applied Microbiology and Biotechnology 88, 977-984. 201. Roberts, R. J. (2001). The bacteriology of teleosts. In Fish Pathology (R. J. Roberts, ed), pp. 297-331. W.B. Saunders, Edinburgh, UK. 202. Ross, A. J. (1960). "Mycobacterium salmoniphilium sp. nov. from salmonoid fishes." American Review of Respiratory Disease 81, 241-250. 203. Ross, A. J. and F. P. Brancato (1959). "Mycobacterium fortuitum Cruz from the tropical fish Hyphessobrycon innesi." Journal of Bacteriology 78, 392-395. 204. Roth, A., U. Reischl, A. Streubel, L. Naumann, R. M. Kroppenstedt, M. Habicht, M. Fischer and H. Mauch (2000). "Novel diagnostic algorithm for identification of mycobacteria using genus-specific amplification of the 16S-23S rRNA gene spacer and restriction endonucleases." Journal of Clinical Microbiology 38, 1094-1104. 205. Ruddy, M., T. D. McHugh, J. W. Dale, D. Banerjee, H. Maguire, P. Wilson, F. Drobniewski, P. Butcher and S. H. Gillespie (2002). "Estimation of the rate of unrecognized cross-contamination with Mycobacterium tuberculosis in London microbiology laboratories." Journal of Clinical Microbiology 40, 4100-4104. 206. Runyon, E. H. (1959). "Anonymous mycobacteria in pulmonary disease." The Medical Clinics of North America 43, 273-290. 207. Rønneseth, A., H. I. Wergeland and E. F. Pettersen (2007). "Neutrophils and B-cells in Atlantic cod (Gadus morhua L.)." Fish and Shellfish Immunology 23, 493-503. 208. Sakai, M., T. Kono, A. C. M. A. R. Tassakka, A. Ponpornpisit, N. Areechon, T. Katagiri, T. Yoshida and M. Endo (2005). "Characterization of a Mycobacterium sp isolated from guppy Poecilia reticulate, using 16S ribosomal RNA and its internal transcribed spacer sequences." Bulletin of the European Association of Fish Pathologists 25, 64-69. 209. Sakanari, J. A., C. A. Reilly and M. Moser (1983). "Tubercular Lesions in Pacific Coast Populations of Striped Bass." Transactions of the American Fisheries Society 112, 565566. 210. Salinas, I., Y. A. Zhang and J. O. Sunyer (2011). "Mucosal immunoglobulins and B cells of teleost fish." Developmental and Comparative Immunology 35, 1346-1365. 211. Sarli, G., F. Morandi, R. Zanoni, B. Brunetti, L. Mandrioli, D. Florio and M. Prearo (2005). "Comparison of immunohistochemistry and Ziehl-Neelsen for the detection of Mycobacterium infection in sea bass (Dicentrarchus labrax)." Bulletin of the European Association of Fish Pathologists 25, 182-185. 71
212. Saurabh, S. and P. K. Sahoo (2008). "Lysozyme: an important defence molecule of fish innate immune system." Aquaculture Research 39, 223-239. 213. Sechi, L. A., A. Colorni, I. Dupre, P. Molicotti, G. Fadda and S. Zanetti (2002). "Strain variation in Mediterranean and Red Sea Mycobacterium marinum isolates." The New Microbiologica 25, 351-356. 214. Secombes, C. J. (1996). The Nonspecific Immune System: Cellular Defenses. In The Fish Immune System (G. Iwama, ed), p. 63-95. Academic Press, London, UK. 215. Secombes, C. J., E. A. Needham, L. M. Laird, A. E. Lewis and I. G. Priede (1985). "The long-term effects of auto-immunologically induced granulomas on the testes of rainbowtrout, Salmo gairdneri Richardson." Journal of Fish Biology 26, 483-489. 216. Seiler, P., T. Ulrichs, S. Bandermann, L. Pradl, S. Jorg, V. Krenn, L. Morawietz, S. H. Kaufmann and P. Aichele (2003). "Cell-wall alterations as an attribute of Mycobacterium tuberculosis in latent infection." Journal of Infectious Diseases 188, 1326-1331. 217. Selvakumar, N., F. Rahman, S. Rajasekaran, P. R. Narayanan and T. R. Frieden (2002). "Inefficiency of 0.3% carbol fuchsin in Ziehl-Neelsen staining for detecting acid-fast bacilli." Journal of Clinical Microbiology 40, 3041-3043. 218. Singh, B., J. Ghosh, N. M. Islam, S. Dasgupta and L. A. Kirsebom (2010). "Growth, cell division and sporulation in mycobacteria." Antonie Van Leeuwenhoek 98, 165-177. 219. Singh, C. R., R. A. Moulton, L. Y. Armitige, A. Bidani, M. Snuggs, S. Dhandayuthapani, R. L. Hunter and C. Jagannath (2006). "Processing and presentation of a mycobacterial antigen 85B epitope by murine macrophages is dependent on the phagosomal acquisition of vacuolar proton ATPase and in situ activation of cathepsin D." Journal of Immunology 177, 3250-3259. 220. Skrypnyk, A. V. (2010). "[Molecular phylogeny of representatives of Mycobacterium species based on structural analysis of hypervariable locus A of 16S ribosomal RNA gene]." Tsitologiia i Genetika 44, 9-15. 221. Smith, H. (1988). "The development of studies on the determinants of bacterial pathogenicity." Journal of Comparative Pathology 98, 253-273. 222. Smith, M. B., V. J. Schnadig, M. C. Boyars and G. L. Woods (2001). "Clinical and pathologic features of Mycobacterium fortuitum infections. An emerging pathogen in patients with AIDS." American Journal of Clinical Pathology 116, 225-232. 223. Speare, D. J., N. MacNair and K. L. Hammell (1995). "Demonstration of tank effect on growth indices of juvenile rainbow trout (Oncorhynchus mykiss) during an ad libitum feeding trial." American Journal of Veterinary Research 56, 1372-1379. 224. Springer, B., L. Stockman, K. Teschner, G. D. Roberts and E. C. Bottger (1996). "Twolaboratory collaborative study on identification of mycobacteria: molecular versus phenotypic methods." Journal of Clinical Microbiology 34, 296-303. 225. Stabel, J. R., E. M. Steadham and C. A. Bolin (1997). "Heat inactivation of Mycobacterium paratuberculosis in raw milk: are current pasteurization conditions effective?" Applied and Environmental Microbiology 63, 4975-4977. 226. Stackebrandt, E., W. Frederiksen, G. M. Garrity, P. A. Grimont, P. Kampfer, M. C. Maiden, X. Nesme, R. Rossello-Mora, J. Swings, H. G. Truper, L. Vauterin, A. C. Ward and W. B. Whitman (2002). "Report of the ad hoc committee for the re-evaluation of the species definition in bacteriology." International Journal of Systematic and Evolutionary Microbiology 52, 1043-1047. 227. Stahl, D. A. and J. W. Urbance (1990). "The division between fast- and slow-growing species corresponds to natural relationships among the mycobacteria." Journal of Bacteriology 172, 116-124.
72
228. Stamm, L. M., J. H. Morisaki, L. Y. Gao, R. L. Jeng, K. L. McDonald, R. Roth, S. Takeshita, J. Heuser, M. D. Welch and E. J. Brown (2003). "Mycobacterium marinum escapes from phagosomes and is propelled by actin-based motility." Journal of Experimental Medicine 198, 1361-1368. 229. Standal, D. and I. B. Utne (2007). "Can cod farming affect cod fishing? A system evaluation of sustainability." Marine Policy 31, 527-534. 230. Star, B., A. J. Nederbragt, S. Jentoft, U. Grimholt, M. Malmstrom, T. F. Gregers, T. B. Rounge, J. Paulsen, M. H. Solbakken, A. Sharma, O. F. Wetten, A. Lanzen, R. Winer, J. Knight, J. H. Vogel, B. Aken, O. Andersen, K. Lagesen, A. Tooming-Klunderud, R. B. Edvardsen, K. G. Tina, M. Espelund, C. Nepal, C. Previti, B. O. Karlsen, T. Moum, M. Skage, P. R. Berg, T. Gjoen, H. Kuhl, J. Thorsen, K. Malde, R. Reinhardt, L. Du, S. D. Johansen, S. Searle, S. Lien, F. Nilsen, I. Jonassen, S. W. Omholt, N. C. Stenseth and K. S. Jakobsen (2011). "The genome sequence of Atlantic cod reveals a unique immune system." Nature 477, 207-210. 231. Steenken, W., Jr. and L. U. Gardner (1946). "History of H37 strain of tubercle bacillus." American Review of Tuberculosis 54, 62-66. 232. Stinear, T., B. C. Ross, J. K. Davies, L. Marino, R. M. Robins-Browne, F. Oppedisano, A. Sievers and P. D. Johnson (1999). "Identification and characterization of IS2404 and IS2606: two distinct repeated sequences for detection of Mycobacterium ulcerans by PCR." Journal of Clinical Microbiology 37, 1018-1023. 233. Strahl, E. D., G. E. Gillaspy and J. O. Falkinham, 3rd (2001). "Fluorescent acid-fast microscopy for measuring phagocytosis of Mycobacterium avium, Mycobacterium intracellulare, and Mycobacterium scrofulaceum by Tetrahymena pyriformis and their intracellular growth." Applied and Environmental Microbiology 67, 4432-4439. 234. Sturgill-Koszycki, S., P. H. Schlesinger, P. Chakraborty, P. L. Haddix, H. L. Collins, A. K. Fok, R. D. Allen, S. L. Gluck, J. Heuser and D. G. Russell (1994). "Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase." Science 263, 678-681. 235. Supply, P., S. Lesjean, E. Savine, K. Kremer, D. van Soolingen and C. Locht (2001). "Automated high-throughput genotyping for study of global epidemiology of Mycobacterium tuberculosis based on mycobacterial interspersed repetitive units." Journal of Clinical Microbiology 39, 3563-3571. 236. Talaat, A. M., R. Reimschuessel, S. S. Wasserman and M. Trucksis (1998). "Goldfish, Carassius auratus, a novel animal model for the study of Mycobacterium marinum pathogenesis." Infection and Immunity 66, 2938-2942. 237. Talaat, A. M., M. Trucksis, A. S. Kane and R. Reimschuessel (1999). "Pathogenicity of Mycobacterium fortuitum and Mycobacterium smegmatis to goldfish, Carassius auratus." Veterinary Microbiology 66, 151-164. 238. Teska, J. D., L. E. Twerdok, J. Beaman, M. Curry and R. A. Finch (1997). "Isolation of Mycobacterium abscessus from Japanese medaka." Journal of Aquatic Animal Health 9, 234-238. 239. Tigges, F., A. Bauer, K. Hochauf and M. Meurer (2009). "Sporotrichoid atypical cutaneous infection caused by Mycobacterium marinum." Acta Dermatovenerologica Alpina, Pannonica et Adriatica 18, 31-34. 240. Torres, M. J., A. Criado, J. C. Palomares and J. Aznar (2000). "Use of real-time PCR and fluorimetry for rapid detection of rifampin and isoniazid resistance-associated mutations in Mycobacterium tuberculosis." Journal of Clinical Microbiology 38, 31943199. 241. Tortoli, E. (2003). "Impact of genotypic studies on mycobacterial taxonomy: the new mycobacteria of the 1990s." Clinical Microbiology Reviews 16, 319-354. 73
242. Tortoli, E. (2010). "Standard operating procedure for optimal identification of mycobacteria using 16S rRNA gene sequences." Standards in Genomic Sciences 3, 145152. 243. Tortoli, E., A. Bartoloni, E. C. Bottger, S. Emler, C. Garzelli, E. Magliano, A. Mantella, N. Rastogi, L. Rindi, C. Scarparo and P. Urbano (2001). "Burden of unidentifiable mycobacteria in a reference laboratory." Journal of Clinical Microbiology 39, 40584065. 244. Truman, R. W., P. K. Andrews, N. Y. Robbins, L. B. Adams, J. L. Krahenbuhl and T. P. Gillis (2008). "Enumeration of Mycobacterium leprae using real-time PCR." PLoS Neglected Tropical Diseases 2, e328. 245. Tsukamura, M., S. Tsukamura and S. Mizuno (1967). "Numerical taxonomy of Mycobacterium fortuitum." Japanese Journal of Microbiology 11, 243-252. 246. Turenne, C. Y., L. Tschetter, J. Wolfe and A. Kabani (2001). "Necessity of qualitycontrolled 16S rRNA gene sequence databases: identifying nontuberculous Mycobacterium species." Journal of Clinical Microbiology 39, 3637-3648. 247. Ucko, M. and A. Colorni (2005). "Mycobacterium marinum infections in fish and humans in Israel." Journal of Clinical Microbiology 43, 892-895. 248. Ucko, M., A. Colorni, H. Kvitt, A. Diamant, A. Zlotkin and W. R. Knibb (2002). "Strain variation in Mycobacterium marinum fish isolates." Applied and Environmental Microbiology 68, 5281-5287. 249. Ulrichs, T. and S. H. Kaufmann (2006). "New insights into the function of granulomas in human tuberculosis." The Journal of Pathology 208, 261-269. 250. Ulrichs, T., M. Lefmann, M. Reich, L. Morawietz, A. Roth, V. Brinkmann, G. A. Kosmiadi, P. Seiler, P. Aichele, H. Hahn, V. Krenn, U. B. Gobel and S. H. Kaufmann (2005). "Modified immunohistological staining allows detection of Ziehl-Neelsennegative Mycobacterium tuberculosis organisms and their precise localization in human tissue." The Journal of Pathology 205, 633-640. 251. van Banning, P. (1987). "Long-term recording of some fish diseases using general fishery research surveys in the south-east part of the North Sea." Diseases of Aquatic Organisms 3, 1-11. 252. van Coppenraet, L. S., V. T. Smit, K. E. Templeton, E. C. Claas and E. J. Kuijper (2007). "Application of real-time PCR to recognize atypical mycobacteria in archival skin biopsies: high prevalence of Mycobacterium haemophilum." Diagnostic Molecular Pathology 16, 81-86. 253. van der Wel, N., D. Hava, D. Houben, D. Fluitsma, M. van Zon, J. Pierson, M. Brenner and P. J. Peters (2007). "M. tuberculosis and M. leprae translocate from the phagolysosome to the cytosol in myeloid cells." Cell 129, 1287-1298. 254. van Duijn, J., C. (1981). "Tuberculosis in fishes." Journal of Small Animal Practice 22, 391-411. 255. van Ingen, J., H. Blaak, J. de Beer, A. M. de Roda Husman and D. van Soolingen (2010). "Rapidly growing nontuberculous mycobacteria cultured from home tap and shower water." Applied and Environmental Microbiology 76, 6017-6019. 256. Verspoor, E. (1997). "Genetic diversity among Atlantic salmon (Salmo salar L.) populations." ICES Journal of Marine Science 54, 965-973. 257. Villella, A., C. Picard, E. Jouanguy, S. Dupuis, S. Popko, N. Abughali, H. Meyerson, J. L. Casanova and R. W. Hostoffer (2001). "Recurrent Mycobacterium avium osteomyelitis associated with a novel dominant interferon gamma receptor mutation." Pediatrics 107, E47.
74
258. Volkman, H. E., H. Clay, D. Beery, J. C. Chang, D. R. Sherman and L. Ramakrishnan (2004). "Tuberculous granuloma formation is enhanced by a Mycobacterium virulence determinant." PLoS Biology 2, e367. 259. Wallace, R. J., Jr., B. A. Brown-Elliott, J. Brown, A. G. Steigerwalt, L. Hall, G. Woods, J. Cloud, L. Mann, R. Wilson, C. Crist, K. C. Jost, Jr., D. E. Byrer, J. Tang, J. Cooper, E. Stamenova, B. Campbell, J. Wolfe and C. Turenne (2005). "Polyphasic characterization reveals that the human pathogen Mycobacterium peregrinum type II belongs to the bovine pathogen species Mycobacterium senegalense." Journal of Clinical Microbiology 43, 5925-5935. 260. Watral, V. and M. L. Kent (2007). "Pathogenesis of Mycobacterium spp. in zebrafish (Danio rerio) from research facilities." Comparative Biochemistry and Physiology: Toxicology and Pharmacology 145, 55-60. 261. Wayne, L. G. (1981). "Numerical taxonomy and cooperative studies: roles and limits." Reviews of Infectious Diseases 3, 822-828. 262. Wayne, L. G., R. C. Good, M. I. Krichevsky, Z. Blacklock, H. L. David, D. Dawson, W. Gross, J. Hawkins, V. V. Levy-Frebault, C. McManus and et al. (1991). "Fourth report of the cooperative, open-ended study of slowly growing mycobacteria by the International Working Group on Mycobacterial Taxonomy." International Journal of Systematic Bacteriology 41, 463-472. 263. Wheeler, A. P. and B. S. Graham (1989). "Atypical mycobacterial infections." Southern Medical Journal 82, 1250-1258. 264. Whipps, C. M., W. R. Butler, F. Pourahmad, V. G. Watral and M. L. Kent (2007a). "Molecular systematics support the revival of Mycobacterium salmoniphilum (ex Ross 1960) sp. nov., nom. rev., a species closely related to Mycobacterium chelonae." International Journal of Systematic and Evolutionary Microbiology 57, 2525-2531. 265. Whipps, C. M., S. T. Dougan and M. L. Kent (2007b). "Mycobacterium haemophilum infections of zebrafish (Danio rerio) in research facilities." FEMS Microbiology Letters 270, 21-26. 266. Whipps, C. M., V. G. Watral and M. L. Kent (2003). "Characterization of a Mycobacterium sp. in rockfish, Sebastes alutus (Gilbert) and Sebastes reedi (Westrheim & Tsuyuki), using rDNA sequences." Journal of Fish Diseases 26, 241-245. 267. WHO (2011). "Global tuberculosis control 2011". World Health Organization (WHO). http://www.who.int/tb/publications/global_report/2011/gtbr11_main.pdf. 268. Wolf, J. C. and S. A. Smith (1999). "Comparative severity of experimentally induced mycobacteriosis in striped bass Morone saxatilis and hybrid tilapia Oreochromis spp." Diseases of Aquatic Organisms 38, 191-200. 269. Wood, J. W. and E. J. Ordal (1958). Tuberculosis in Pacific Salmon and Steelhead Trout. Fish Commission of Oregon, Contribution No. 25, Portland, Oregon, USA. 270. Zapata, A. and C. T. Amemiya (2000). "Phylogeny of lower vertebrates and their immunological structures." Current Topics in Microbiology and Immunology 248, 67107. 271. Zelikoff, J. T. (1998). "Biomarkers of immunotoxicity in fish and other non-mammalian sentinel species: predictive value for mammals?" Toxicology 129, 63-71. 272. Zerihun, M. A., S. W. Feist, D. Bucke, A. B. Olsen, N. M. Tandstad and D. J. Colquhoun (2011). "Francisella noatunensis subsp. noatunensis is the aetiological agent of visceral granulomatosis in wild Atlantic cod Gadus morhua." Diseases of Aquatic Organisms 95, 65-71. 273. Zwilling, B. S., D. E. Kuhn, L. Wikoff, D. Brown and W. Lafuse (1999). "Role of iron in Nramp1-mediated inhibition of mycobacterial growth." Infection and Immunity 67, 1386-1392. 75
274. Øverland, H. S., E. F. Pettersen, A. Rønneseth and H. I. Wergeland (2010). "Phagocytosis by B-cells and neutrophils in Atlantic salmon (Salmo salar L.) and Atlantic cod (Gadus morhua L.)." Fish and Shellfish Immunology 28, 193-204.
76
I
doi:10.1111/j.1365-2761.2010.01231.x
Journal of Fish Diseases 2011, 34, 235–246
Immunohistochemical and Taqman real-time PCR detection of mycobacterial infections in fish M A Zerihun, M J Hjortaas, K Falk and D J Colquhoun National Veterinary Institute, Oslo, Norway
Abstract
Real-time PCR and immunohistochemistry (IHC) assays were developed to detect fish mycobacterial infections at the genus level, based on the RNA polymerase b subunit (rpoB) gene and polyclonal anti-Mycobacterium rabbit serum, respectively. The PCR assay positively identified a number of pathogenic mycobacteria including Mycobacterium abscessus, M. avium ssp. avium, M. bohemicum, M. chelonae ssp. chelonae, M. farcinogenes, M. flavescens, M. fortuitum ssp. fortuitum, M. gastri, M. gordonae, M. immunogenicum, M. malmoense, M. marinum, M. montefiorense, M. phlei, M. phocaicum, M. pseudoshottsii, M. salmoniphilum, M. senegalense, M. shottsii, M. smegmatis, M. szulgi and M. wolinskyi. A detection limit equivalent to 102 cfu g)1 was registered for M. salmoniphiluminfected fish tissue. The IHC precisely localized both free and intracellular mycobacteria in tissues and detected mycobacterial infections down to 102 cfu g)1 tissue. Both assays were found to be more sensitive than Ziehl–Neelsen (ZN) staining, where the detection limit was below 8 · 103 cfu g)1 tissue. Although specificity testing of the real-time PCR against a panel of nonMycobacterium spp. revealed a degree of crossreaction against pure DNA extracted from Nocardia seriolae and Rhodococcus erythropolis, no cross-reactions were identified (by either real-time PCR or IHC) on testing of formalin-fixed paraffin-embedded (FFPE) tissues confirmed to be infected with these bacteria. The broad applicability of both assays was confirmed by analysis of FFPE tissues from a range of fish species infected with diverse MycoCorrespondence M A Zerihun, National Veterinary Institute, Post Box 750 Sentrum, 0106 Oslo, Norway (e-mail:
[email protected])
2011 Blackwell Publishing Ltd
235
bacterium spp. The results indicate that both assays, alone or in combination, constitute sensitive tools for initial, rapid diagnosis of mycobacteriosis in fish. This should in turn allow rapid application of more specific studies, i.e. culture based, to identify the specific Mycobacterium sp. involved. Keywords: fish, formalin-fixed paraffin-embedded tissue, immunohistochemistry, mycobacteria, realtime PCR.
Introduction
Fish mycobacteriosis is widely distributed in wild and captive marine and freshwater fish species (Chinabut 1999). Chronic granulomatous inflammation, frequently with extensive tissue damage, is characteristic of the disease. In most cases, the disease is systemic, with spleen and kidney as primary target organs (Bruno, Griffiths, Mitchell, Wood, Fletcher, Drobniewski & Hastings 1998). External clinical signs are non-specific and include scale loss, skin ulceration, emaciation, pigment changes and spinal defects (Noga, Wright & Pasarell 1990; Roberts 2001; Gauthier, Vogelbein, Rhodes & Reece 2008). In many investigations of fish mycobacteriosis, isolation of the pathogen is not attempted. Indeed, traditional identification of mycobacteria based on cultural and biochemical tests may take several weeks, and even then a precise identification may not be arrived at (Austin & Austin 1999; Gauthier et al. 2008; Pourahmad, Thompson, Adams & Richards 2009). With the development of nucleic acid-based amplification assays, the identification of microorganisms that are difficult to culture in clinical samples, including mycobacteria, has become routine, and advances in such sensitive detection
Journal of Fish Diseases 2011, 34, 235–246
M A Zerihun et al. Real-time PCR and IHC detection of mycobacteria
methods have permitted documentation of an increasing number of mycobacterial species infecting fish (Kaattari, Rhodes, Kaattari & Shotts 2006). Recent real-time-based PCR advances have provided major contributions for the rapid and accurate identification and in some cases quantification of Mycobacterium species DNA (Kraus, Cleary, Miller, Seivright, Young, Spruill & Hnatyszyn 2001; Lim, Kim, Lee & Kim 2008). However, most of these assays have been applied to detection of mycobacterial pathogens of mammalian hosts (Lewin, Freytag, Meister, Sharbati, Schafer & Appel 2003; Bruijnesteijn van Coppenraet, Lindeboom, Prins, Peeters, Claas & Kuijper 2004; Parashar, Chauhan, Sharma & Katoch 2006; van Coppenraet, Smit, Templeton, Claas & Kuijper 2007; Lim et al. 2008; Truman, Andrews, Robbins, Adams, Krahenbuh & Gillis 2008). Mycobacterial fish pathogens represent a very diverse group of bacteria including both fastand slow-growing types. Although Mycobacteriumspecific PCR assays have been previously published (Khan & Yadav 2004; Pakarinen, Nieminen, Tirkonnen, Tsitko, Ali-Vehmas, Neubauer & SalkinojaSalonen 2007), these assays were tested against a very limited range of Mycobacterium spp. Further, the applicability of published genus-specific assays for the detection of Mycobacterium spp. in naturally or experimentally infected fish tissues has not been adequately tested, particularly in regard to the most common type of material submitted to fish disease laboratories, i.e. formalin-fixed paraffin-embedded tissues. There remains, therefore, a requirement for a truly genus-wide PCR assay for broad-range diagnostic detection of these bacteria in fish. Although PCR is an increasingly important component in fish disease diagnostics, the technique cannot directly associate the presence of any particular agent with pathological tissue changes, and PCR-positive results frequently do not correlate with disease prevalence (Ulrichs, Lefman, Reich, Morawietz, Roth, Brinkmann, Kosmiadi, Seiler, Aichele, Hahn, Krenn, Gobel & Kaufmann 2005). For this reason, histological techniques continue to play a central role in fish disease investigation and allow using appropriate staining methods, precise localization of mycobacterial cells within tissues, estimation of tissue damage and classification of pathological lesions. Hence, a combination of histological- and PCR-based tools should be invaluable for reliable diagnosis of mycobacteriosis in fish. Despite lack of specificity and sensitivity (Muller & Taylor 1972; Marks, Lewis & Trevino 1974; 2011 Blackwell Publishing Ltd
236
Henriksen & Pohlenz 1981; Allen 1992; Fukunaga, Murakami, Gondo, Sugi & Ishihara 2002; Schulz, Cabras, Kremer, Weirich, Miethke, Bosmuller, Hofler, Werner & Fend 2005; Ulrichs et al. 2005) Ziehl–Neelsen (ZN) staining (Bishop & Neuman 1970) remains widespread and often constitutes the major tool for screening formalinfixed tissue samples for mycobacteriosis in many laboratories. Heavy reliance on conventional ZN staining in routine pathology specimens may, therefore, result in underdiagnosis of many infections (Fukunaga et al. 2002; Schulz et al. 2005). Immunohistochemical (IHC) techniques have proven to be very useful tools in fish disease diagnosis (Evensen & Rimstad 1990; Go´mez, Navarro, Go´mez, Sa´nchez & Bernabe´ 1996; Evensen & Olesen 1997; Das, Nayak, Fourrier, Collet, Snow & Ellis 2007; Vojtech, Sanders, Conway, Ostland & Hansen 2009). The ability to detect antigen in fixed tissues may be especially beneficial in the investigation into diseased populations geographically remote from the diagnostic laboratory and from which fresh samples are not available. Immunostaining is advantageous in relating the in situ detection of mycobacteria to pathological changes. Moreover, IHC staining may also be an efficient means of detecting microbes that are difficult to grow or require extended incubation. As there is currently no approved chemotherapy or other treatment for fish mycobacteriosis and as the disease is caused by many different species of Mycobacterium (Decostere, Hermans & Haesebrouck 2004; Gauthier & Rhodes 2009; Jacobs, Stine, Baya & Kent 2009), rapid identification of the mycobacteria at the genus level will enable rapid deployment of loss minimization measures, as well as initiation of more specific studies aimed at identification and characterization of the infecting Mycobacterium sp. The aim of the present study was, therefore, the development of IHC and concurrent real-time PCR assays for the detection of mycobacterial infections in fish tissues, including formalin-fixed paraffinembedded (FFPE) tissues.
Materials and methods
Bacterial strains Details of strains used in the current study are shown in Table 1. Mycobacterium farcinogenes, M. flavescense, M. fortuitum, M. gastri and M. phlei
M A Zerihun et al. Real-time PCR and IHC detection of mycobacteria
Journal of Fish Diseases 2011, 34, 235–246
Table 1 Comparison of Ct values generated from a real-time PCR conducted on DNA from mycobacterial and non-mycobacterial colonies (isolate references are provided in parentheses) Isolate Rapidly growing mycobacteria Mycobacterium abscessus (44196T) M. chelonae ssp. chelonae (43804T) M. chelonae (C15b) M. fortuitum ssp. fortuitum (46621T) M. immunogenicum (44764T) M. phlei (43239T) M. phocaicum (45104T) M. salmoniphilum (43276T) M. salmoniphilum (6598) M. salmoniphilum (6600) M. salmoniphilum (6603) M. wolinskyi (44493T) Slow-growing mycobacteria M. avium ssp. avium (44156T) M. bohemicum (44277T) M. farcinogenes (43637T) M. flavescens (43991T) M. gastri (43505T) M. gordonae (44160T) M. gordonae (M27) M. malmoense (44136T) M. marinum (44344T) M. marinum (R102a) M. marinum (6519) M. marinum (6520) M. montefiorense (L41) M. pseudoshottsii (L15) M. senegalense (43656T) M. shottsii (M175) M. smegmatis (43756T) M. szulgi (44166T) Non-mycobacteria Nocardia asteroides (6532) Rhodococcus erythropolis (4526) Negative control (water)
Source
Ct (dRn)
DSMZ DSMZ VIMS DSMZ DSMZ DSMZ DSMZ DSMZ NVI NVI NVI DSMZ
11.26 8.79 11.10 10.64 9.83 13.72 10.74 9.05 9.67 8.65 8.85 12.31
DSMZ DSMZ DSMZ DSMZ DSMZ DSMZ VIMS DSMZ DSMZ VIMS NVI NVI VIMS VIMS DSMZ VIMS DSMZ DSMZ
15.46 10.69 12.84 12.74 10.64 13.85 14.01 11.48 11.75 12.63 12.03 12.23 13.57 9.19 13.18 14.48 13.31 11.14
NVI NVI
21.95 26.75 0
Formalin-fixed paraffin-embedded tissues
were raised on Lowenstein Jensen (LJ) medium while other listed mycobacterial isolates in Table 1 were cultivated on Middlebrook 7H10 agar (MDA) and Middlebrook 7H9 broth (MDB) supplemented with Bacto Middlebrook oleic acid-albumin-dextrose-catalase (OADC) enrichment. Trypticase soy agar (TSA) was used for the culture of Nocardia asteroides and Rhodococcus erythropolis. Isolates were cultivated for 10–14 days at 30 C prior to isolation of DNA.
Tissues were taken in parallel with fresh tissue samples and fixed in 10% neutral buffered formalin, embedded in paraffin and processed for immunohistological investigation (details described below). Additional FFPE tissues prepared from goldfish, swordtail, Xiphophorus hellerii Heckel, and European sea bass, Dicentrarchus labrax (L.), infected with M. fortuitum, M. gordonae and M. marinum, respectively, were kindly donated by Dr Maria Letizia Fioravanti (Faculty of Veterinary Medicine, Alma Mater University, Bologna, Italy). Rhodococcus erythropolis-positive FFPE samples were obtained from the National Veterinary Institute, Bergen, Norway (Olsen, Birkbeck, Nilsen, MacPherson, Wangel, Myklebust, Laidler, Aarflot, Thoen, Nyga˚rd, Thayumanavan & Colquhoun 2006). Nocardia seriolae- and N. asteroides-positive tissue blocks were kindly donated by Dr T. Yoshida (Faculty of Agriculture, University of Miyazaki, Japan) (Shimahara, Nakamura, Nomoto, Itami, Chen & Yoshida 2008) and the Norwegian School of Veterinary Science, respectively.
Fresh tissues
DNA isolation
Fresh tissue samples were taken from Atlantic cod, Gadus morhua L., experimentally infected with
Genomic DNA from fresh tissues and bacterial colonies was extracted using the QuickExtract
T , Type strain; DSMZ, Deutsche Sammlung von Mikroorganismen und Zellkulturen; VIMS, Virginia Institute of Marine Science; NVI, National Veterinary Institute. DNA was extracted from pure bacterial colonies, cultured as described earlier, and constant 50-ng DNA templates were used per reaction.
2011 Blackwell Publishing Ltd
M. salmoniphilum and from Atlantic salmon, Salmo salar L., turbot, Psetta maxima (L.) zebra fish, Danio rerio Hamilton, goldfish, Carassius auratus (L.), burbot, Lota lota (L.) and diverse aquarium cichlids, naturally infected with M. salmoniphilum, M. marinum, M. gordonae M. chelonae and Mycobacterium spp. Portions of kidney and spleen, each weighing 0.2 g, were excised and placed in sterile tubes containing metal beads (Bertin Technologies), 0.8 mL ButterfieldsÕ phosphate buffer (BP) was added and the tissue homogenized using MagNA Lyser (Roche Ltd.). Three tenfold dilutions in BP were prepared and 0.2-mL volumes of 10)1, 10)2 and 10)3 dilutions of the homogenate spread evenly over the surface of duplicate MDA. The plates were incubated at 22 C for 2–8 weeks of incubation. Mycobacterial density was determined as colony-forming units (cfu) per gram (g)1) tissue in experimentally infected Atlantic cod. DNA was extracted from 0.2 mL undiluted tissue homogenate, as described below, and the remainder archived at )80 C.
237
Journal of Fish Diseases 2011, 34, 235–246
M A Zerihun et al. Real-time PCR and IHC detection of mycobacteria
DNA Extraction Kit (Epicenter Biotechnologies) according to the manufacturerÕs instructions, preceded by the disruption of tissue and bacterial homogenates in FastProtein Blue (MP Biomedicals) using MagNA Lyser (Roche Ltd). Extraction of DNA from paraffin-embedded tissues was carried out using the Nucleon HT for Hard Tissue Kit (Amersham Biosciences) following the manufacturerÕs instructions. The concentration of isolated DNA was measured using a NanoDrop ND-100 Spectrophotometer (NanoDrop Technologies). Design of primers and TaqMan probe The primers and probe for the real-time PCR amplification and detection of the mycobacterial rpoB gene were designed using Primer Express software v2.0 (PE Applied Biosystems). An alignment of rpoB gene sequences from clinical isolates (NVI6598, NVI6599, NVI6600, NVI6602 and NVI6603) and sequences retrieved from the GenBank database (http://www.ncbi.nlm.nih.gov) AY147163 (M. chelonae CIP104535), DQ866802 (M. fortuitum ATCC13756), AY262738 (M. senegalense CIP104941), AY147167 (M. septicum ATCC 700731), AY262743 (M. wolinskyi ATCC700010), U24494 (M. smegmatis MSU24494), EU597587 (M. gordonae 07-2957), CP000854 (M. marinum), BX842574 (M. tuberculosis_H37RV), DQ866797 (M. salmoniphilum_AUS), DQ866790 (M. salmoniphilum_ATCC13758), EF536970 (M. salmoniphilum NCIMB13533) was constructed using Clustal W (Thompson, Higgins & Gibson 1994) (Fig. 4). The alignment was employed to identify gene sequences common to a broad spectrum of Mycobacterium spp. relevant to fish mycobacteriosis while avoiding amplification of other bacterial species. From such an area, the partially degenerate primers Myco-rtf (5¢-GGTGGACRTCATCYTGAACA-3¢) and Myco-rtr (5¢-TCCARRATCTGGCCGATGT-3¢) defining a 63-bp amplicon, containing the TaqMan probe: Myco-rtpr (5¢-CACGGTGTGTGCCGCGTCGTATG-3¢), were selected. The primers and probe were checked for cross-reactivity by Blast analysis (Altschul, Madden, Schaffer, Zhang, Zhang, Miller & Lipman 1997, http:// www.ncbi.nlm.nih.gov/BLAST/). The probe was labelled at the 5¢ end with the fluorescent reporter dye 6-carboxy-fluorescein (FAM) and with nonfluorescent quencher dye Black Hole Quencher (BHQ) at the 3¢ end. Primers and probe were supplied by TAG Copenhagen. 2011 Blackwell Publishing Ltd
238
Real-time PCR The real-time PCR amplification reactions were performed on an Mx3005 real-time thermal cycler (Stratagene) in 20-lL final volumes. Each reaction mixture comprised 10.0 lL of 2· TaqMan Universal PCR master-mix, 500 nm of each respective primer and fluorogenic probe. Two microlitres of template DNA extracted from bacterial cultures (equivalent to 50 ng) was used in each PCR. The TaqMan Universal PCR master-mix contains AmpliTaq Gold DNA Polymerase, dNTPs with dUTP, AmpErase uracil-N-glycosylase (UNG), which degrades any carry-over PCR products containing uracil and optimized buffer components. All reagents used were purchased from Applied Biosystems. The PCR cycling conditions were as follows: 50 C for 2 min for UNG enzyme activity, 95 C for 10 min to simultaneously denature the UNG enzyme and activate the polymerase, 45 cycles of 30 s at 95 C and 1 min at 55 C. Each PCR run included positive and negative controls. All samples were analysed in triplicate. Data relating to positive sample detection were obtained in the form of threshold cycle (Ct) values. Immunohistochemistry Mycobacterium salmoniphilum (NVI6598) colonies from MDA were suspended in sterile BP and used to inoculate MDB. Inoculated broth was incubated at 22 C on a shaker for 10 days. Bacteria were inactivated with 0.7% formaldehyde and after 2 weeks storage at 4 C, an aliquot was streaked onto MDA to confirm inactivation. The bacterial cell suspension was washed twice with BP and the cell suspension adjusted to an OD540 of 1.5. The bacterial suspension was emulsified with an equal volume of FreundÕs incomplete adjuvant (FIA). A female grey chinchilla rabbit was inoculated subcutaneously at multiple sites with a bacteria/FIA emulsion, for a total of five times at 2-week intervals, with the exception of a 3-week interval between the fourth and fifth injection. Sixteen days after the last immunization, the rabbit was exsanguinated and the blood allowed to clot for 6 h at room temperature. Serum was then harvested and stored at )20 C until use. Serum was crossadsorbed against N. asteroides NVI6532 and R. erythropolis NVI4526 before use. The IHC procedure used was essentially as described by Thoresen, Falk & Evensen (1994)
Journal of Fish Diseases 2011, 34, 235–246
M A Zerihun et al. Real-time PCR and IHC detection of mycobacteria
with slight modifications. Briefly, 3-lm tissue sections were cut with a microtome (Leica; Jung RM 2055) and mounted on poly-l-lysine (PLL)coated slides. The slides were incubated at 65 C for 25 min. Deparaffinization and rehydration of tissue sections were performed in a series of xylene, graded ethanol and water baths. Antigens were unmasked on rehydrated sections in citrate buffer (0.1 m citric acid, pH 6.0) by boiling for 2 · 6 min in a microwave oven (800 W) and after each heating left for 5 and 15 min, respectively, in the warm solution. Slides were washed with Trisbuffered saline (TBS; Tris–HCI 50 mm, NaCl 150 mm, pH 7.6) with 0.05% (v/v) Tween 20 and incubated for 20 min with blocking solution (5% [w/v] bovine serum albumin [BSA] in phosphate-buffered saline [PBS]). Sections were incubated for 1 h with a 1:1500 dilution of the primary antibody (polyvalent anti-Mycobacterium rabbit serum [PaMRS]), washed in TBS containing Tween 20, incubated for 30 min with secondary antibody (biotinylated goat anti-rabbit IgG; GE Health) diluted 1:500 in 2.5% BSA, washed in TBS with Tween 20, incubated for 30 min with a 1:500 dilution of streptavidin-biotin alkaline phosphatase (GE Health). Following a final wash, fast red (1 mg mL)1) and naphtol AS-MX phosphate (0.2 mg mL)1) with 1 mm levamisole in 0.1 m TBS (pH 8.2) were added and allowed to develop for 20 min. Finally, sections were counterstained with haematoxylin and mounted with Aquatex (VWR International). All incubations were conducted in a humid chamber at room temperature. Positive and negative control tissues were taken from Atlantic cod, experimentally infected with M. salmoniphilum and non-infected control groups. Controls were tested by excluding primary, secondary and both antibodies. Specificity and sensitivity testing of the real-time PCR assay The PCR assay was tested for specificity using DNA extracted from cultures of a taxonomically broad array of bacterial species, isolated from clinical cases submitted to the National Veterinary Institute (NVI), using standard protocols: Aeromonas salmonicida subsp. salmonicida NVI2949, atypical A. salmonicida NVI3890, Bacillus cereus NVI3588, Brochothrix thermosphacta NVI2574, Carnobacterium piscicola NVI2305, Escherichia coli VI2304, 2011 Blackwell Publishing Ltd
239
Moritella viscosa NVI363, Pasteurella skyensis NVI4464, Photobacterium phosphoreum NVI2290, Francisella noatunensis NVI5330, Piscrickettsia salmonis NVI5692, Pseudomonas fluorescens NVI2480, R. erythropolis NVI4526, Staphylococcus aureus NVI2536, Streptococcus agalactiae NVI4159, Tenacibaculum maritimum NVI3846, Vibrio anguillarum serotype O1 NVI4087, Vibrio salmonicida NVI1199, Vibrio splendidus NVI4286, Yersinia ruckeri NVI353 and N. asteroides NVI6532. Linearity and sensitivity of the PCR assay was tested using DNA extracted from pure cultures of M. salmoniphilum NVI6598 (6.5 · 107 cfu mL)1) at a series of tenfold dilutions. Fresh and FFPE kidney tissues from experimentally infected Atlantic cod with a bacterial load of 4 · 106 cfu g)1 tissue at a series of twofold dilutions were also used to check linearity and sensitivity of the assay. Nocardia asteroides-, N. seriolae- and R. erythropolis-positive FFPE tissues were also used to assess specificity of the PCR in paraffin-embedded tissues. DNA extracted from these blocks was confirmed to contain DNA from each of the respective agents by amplification and sequencing of the 16S rRNA gene using the primers A18 and S20 described by Suau, Bonnet, Sutren, Godon, Gibson, Collins & Dore´ (1999). Fish DNA extracted from kidney and spleen of Atlantic salmon and Atlantic cod was tested at varying dilutions. Specificity and sensitivity testing of the IHC assay The IHC assay was tested for specificity against the following taxonomically broad array of diseasecausing agents in FFPE tissues, isolated from clinical cases submitted to the National Veterinary Institute (NVI): A. salmonicida subsp. salmonicida, atypical A. salmonicida, Y. ruckeri, M. viscosa, V. anguillarum, V. salmonicida, P. salmonis, Renibacterium salmoninarum, F. noatunensis, R. erythropolis, viral haemorrhagic septicaemia (VHS), infectious pancreatic necrosis (IPN), viral encephalo- and retinopathy/viral nerval necrosis (VER/ VNN) and infectious salmon anaemia (ISA). Tissue sections from clinical cases diagnosed as Ôparasitic granulomatosisÕ, Ômicrosporidial infectionÕ, Ôcoccidial infectionÕ and Ôfungal infectionÕ were also included. The test panel further comprised FFPE tissues infected with Rhodococcus equi and N. seriolae. A series of dilutions encompassing 1:10, 1:100, 1:500, 1:1000, 1:1500, 1:2000, 1:2500 were used
Journal of Fish Diseases 2011, 34, 235–246
M A Zerihun et al. Real-time PCR and IHC detection of mycobacteria
in testing specificity and sensitivity. Sensitivity of the assay in FFPE tissues was further estimated using FFPE tissues with known densities of mycobacteria (Table 3). SDS–PAGE and Western blot The Western blot analysis was conducted basically as described earlier (Towbin, Staehlin & Gordon 1979; Olsen & Wiker 1998). Lysates were prepared from colonies of bacterial strains (M. salmoniphilum NVI6598, M. chelonae DSMZ43804, M. salmoniphilum DSMZ43276, M. fortuitum DSMZ46621, M. marinum DSMZ44344, M. montefiorense L41, M. shottsii M175, M. immunogenicum DSMZ447, M. gordonae DSMZ44160, N. asteroides NVI6532, R. erythropolis NVI4526 and F. noatunensis NVI5330) grown on agar plates (described previously) using FastProtein Blue (MP Biomedicals) and MagNA Lyser (Roche Ltd.). Bacterial proteins (7.5 lg each) were treated with dissociation buffer (50 mm Tris–HCl; pH 6.8, 1% SDS, 50 mm DTT, 8 mm EDTA, 0.01% bromophenol blue) and heated for 5 min at 95 C. The proteins were then separated by SDS–PAGE using the discontinuous system with 0.5-mm-thin precast 12.5% polyacrylamide gels (GE Healthcare Bio-Sciences AB). For Western blotting, separated proteins were transferred to a nitrocellulose membrane (Amersham Pharmacia Biotech) in a Multiphore II electrophoresis system (Pharmacia Biotech AB). The protein blot was then treated with blocking solution (PBS containing 1% Tween-20 and 5% non-fat dry milk) with the PaMRS diluted (1:3000) in blocking solution for 1 h. The membrane was washed three times in blocking solution and allowed to react with goat anti-rabbit horseradish peroxidase (HRP) conjugate (GE Healthcare) for 1 h. Diaminobenzidine (Sigma-Aldrich Chemie GMBH) was used for the detection of bound HRP conjugate. All incubations were conducted at room temperature.
Results
Real-time PCR On bacterial cultures. Real-time PCR conducted using a constant 50-ng DNA template extracted from bacterial cultures demonstrated Ct values ranging between 8.65 and 15.46 for Mycobacterium 2011 Blackwell Publishing Ltd
240
spp. All Mycobacterium spp. tested were detected. Of the taxonomically broad panel of nonmycobacterial species tested, a degree of crossreaction was identified only for N. asteroides NVI6532 and R. erythropolis NVI4526 that resulted in Ct values of 21.95 and 26.75, respectively. Negative control (water) was included and showed Ct value = 0 (Table 1). On FFPE tissues. The real-time PCR identified (Ct values of 12.26–32.10) mycobacterial infections in FFPE tissues from fish previously confirmed to be infected with diverse Mycobacterium spp., while DNA from tissues with confirmed Nocardia and Rhodococcus spp. infections tested negative. DNA isolated from negative control FFPE tissues and differential diagnosis tissues was all negative (Ct value = 0) (Table 2). Sensitivity. The assay was able to identify down to approximately 6.5 cfu of M. salmoniphilum (NVI6598) per reaction. Threshold cycle values displayed a linear relationship when tested with triplicate tenfold dilutions (108–102) of genomic NVI6598 DNA (Fig. 1). The potential of the realtime PCR for detection of mycobacterial infections in fish tissues was tested using parallel fresh and FFPE tissue samples from an experimental infection of Atlantic cod with M. salmoniphilum NVI6598. The real-time PCR generated consistent positive results (Ct value 100, ++: 50–100, +: 4–49, (+): 1–3, 0: not detected).
Figure 1 Real-time PCR standard curve for quantification, plotted from triplicate samples using average threshold cycle (Ct) values related to tenfold dilutions of template extracted from 6.5 · 107 cfu (log 7. 81 cfu) M. salmoniphilum NVI6598. R2 value indicates highly significant correlation.
infected with diverse Mycobacterium spp. but did not identify non-mycobacterial species, including R. erythropolis and N. seriolae in either fish or mammalian FFPE tissues. Furthermore, controls 2011 Blackwell Publishing Ltd
241
run without primary and/or secondary antibodies tested negative. With the exception of slight nonspecific background staining of contents of renal tubuli in some of the tested Atlantic salmon (data not shown), no false-positive signals were identified. Western blot analysis of several fish pathogenic mycobacterial isolates, stained with PaMRS, showed very similar staining patterns with the main antigens recognized to be of approximately 30 and 80 kDa in size. No significant binding was observed to N. asteroides, R. erythropolis and F. noatunensis (Fig. 2). ZN staining repeatedly failed to detect bacteria present at concentrations below 8 · 103 cfu g)1 (Table 3). Discussion
The present study describes genus-specific real-time PCR and IHC assays, which can be applied to infections caused by both slow-and fast-growing Mycobacterium spp. in both fresh and FFPE fish tissues. While fresh tissues remain the sample material of choice for PCR, because of ease of
M A Zerihun et al. Real-time PCR and IHC detection of mycobacteria
Journal of Fish Diseases 2011, 34, 235–246
Table 3 Comparison of the real-time PCR-, IHC- and ZN staining efficiency on mycobacteria-infected fresh and corresponding FFPE tissues. Samples 1–28 are taken from Atlantic cod experimentally infected with Mycobacterium salmoniphilum. Samples 29 and 30 are taken from non-infected control fish (negative control)
Serial No.
Case ID
Culture cfu g)1 tissue
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30
53K12 53S2 53K2 53S12 53K3 53K6 53S6 53S6 53S7 53K7 53K13 34S8 53K4 53K8 34K8 53S8 34K5 34S1 53S3 34K2 34K3 34S5 53S4 34S3 34S2 34K1 34K6 34S6 23K1 23S1
4.0 4.0 4.0 1.5 2.4 2.0 2.0 2.0 2.0 2.0 1.2 8.0 8.0 6.0 5.0 4.0 2.8 1.9 1.6 9.2 8.8 7.6 6.0 1.2 1.2 1.2 0 0 0 0
· · · · · · · · · · · · · · · · · · · · · · · · · ·
106 106 106 106 104 104 104 104 104 104 104 103 103 103 103 103 103 103 103 102 102 102 102 102 102 102
Real-time PCR Ct (dRn)
FFPE tissue
Fresh tissue
FFPE tissue
IHC
ZN stain
18.77 18.18 16.13 20.34 23.41 26.31 26.72 25.72 27.74 24.40 26.34 29.21 30.03 30.93 31.62 30.69 30.87 29.92 29.98 30.38 31.00 30.53 31.00 32.01 31.87 33.27 34.13 34.39 0 0
20.79 21.50 19.19 23.15 26.36 29.72 28.93 28.62 31.73 24.15 27.15 32.79 32.00 31.41 31.45 31.07 30.85 31.44 31.53 35.33 32.82 33.30 32.50 33.23 32.34 33.00 36.00 37.13 0 0
+++ +++ +++ +++ ++ ++ ++ ++ ++ ++ ++ + + + + + + + + + + + + + + + 0 (+) 0 0
++ ++ ++ + + (+) + (+) 0 (+) 0 0 (+) 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0
cfu, colony-forming units, Ct, threshold cycle value; FFPE, formalin-fixed paraffin-embedded tissue; K, kidney tissue; S, spleen tissue; IHC, immunohistochemistry; ZN, Ziehl–Neelsen. Distribution of positively stained (IHC and ZN) bacteria and/or host cells, average per field, looking at five fields (+++ : >100, ++: 50–100, +: 4–49, (+): 1–3, 0: not detected).
DNA extraction, both PCR and IHC assays were found to provide reliable, sensitive indication of mycobacterial infection both for routine diagnosis and for research purposes in FFPE tissues that are widely used in fish disease investigation laboratories and often the only type of material available for study. This study has clearly demonstrated the applicability of the described real-time PCR for the detection of a wide range of fast- and slow-growing Mycobacterium spp. in different fish species. While Ct values obtained on testing DNA extracted from pure bacterial cultures revealed differences in 2011 Blackwell Publishing Ltd
242
Figure 2 Western blot analysis. Proteins were separated in a 12.5% SDS–PAGE and blotted onto nitrocellulose membrane. Total bacterial cell extract (5 lg each) was applied in each lane and blotted membranes were incubated with polyclonal antiMycobacterium rabbit serum K229 (PaMRS). The molecular mass is indicated in kilodaltons (kDa). Lane M: Protein marker; Lane 1: M. salmoniphilum NVI6598 (immunizing antigen), 2: M. chelonae DSMZ 43804T, 3: M. salmoniphilum DSMZ 43276T, 4: M. fortuitum DSMZ 46621T, 5: M. marinum DSMZ 44344T, 6: M. montefiorense L41, 7: M. shottsii M175, 8: M. immunogenicum DSMZ 44764T, 9: M. gordonae DSMZ 44160T, 10: Nocardia asteroides NVI6532, 11: Rhodococcus erythropolis NVI4526 and 12: Francisella noatunensis NVI5330. Mycobacterial isolates on lanes 1–9 showed similar staining patterns with the main antigens, 30 and 80 kDa in size, while bacteria on lanes 10–12 failed to show significant binding.
sensitivity for the detection of the various Mycobacterium spp., the assay was capable of identifying all species of Mycobacterium tested. Despite the sensitivity bias towards fast- rather than slow-growing species, the described assay constitutes an improvement over both standard gel-based PCR and current Ôgenus-wideÕ Mycobacterium real-time PCR assays (Khan & Yadav 2004; Pakarinen et al. 2007). Absolute sensitivity of the assay was extensively examined using tissues from Atlantic cod experimentally infected with M. salmoniphilum, and in these tissues the assay was capable of detecting 1051 1120 during the present field outbreak may suggest that Kubica 1985; Lutz 1992) were consistent with ATCC13758* CAGCGGGTAATGCCGGGGACTCGTAGGAGACTGCCGGGGTCAACTCGGAGGAAGGTGGGGATGACGTCAA the affected population was in some isolates cultured previously from Atlantic salmon in NCIMB13533 ......................................................................way predisNVI6598-6607 posed to mycobacterial infection, a1190 scenario supthe Shetland Isles, initially......A............................................................... considered as M. chelo1121 ATCC13758 GTCATCATGCCCCTTAT-GTCCAGGGCTTCACACATGCTACAATGGCCAGTACAGAGGGCTGCGAAGCCG ported by the fact that more than one genotype of nae (Bruno et al. 1998), but subsequently identified NCIMB13533 ...................................................................... M. salmoniphilum was involved. as M. salmoniphilum 1960; Whipps et al. NVI6598-6607 (Ross .................T.................................................... =—>1331 =—>(1417) observed The diffuse granulomatous processes 2007). ATCC13758 TCACGTCATGAAAGTCGGTAACACCCGAAGCCAGTGGCCTAACCTTTTGGAGGGAGCTGTC-GAAGGTGG relatively often in the mesenteries of experimental Although the obtained 16S rRNA sequences were NCIMB13533 ...................................................................... .............................................................A........ fish, both challenged and control groups, were most consistentNVI6598-6607 with culture and biochemical characterHsp65 =—>71 140 ATCC13758 likely associated with the intraperitoneal oil-adjuization, this gene is oftenGCGCCAACCCGCTCGGCCTGAAGCGCGGCATCGAGAAGGCTGTGGAGGCCGTTACCAGCGCCCTGCTGGC highly similar between NCIMB13533 .............................................................G........ vant PD vaccine administered to all fish prior to the different NVI6598-6606 species of Mycobacterium and offers, ........................................C............................. experiment (Koppang, Haugarvoll, Hordvik, Aune therefore,NVI6607 a poor grade of........................................T............................. phylogenetic resolution. 141 =—>(371) & Poppe 2005; Midtlyng & Lillehaug 1998). Sequence ATCC13758 analysis of rpoBTTCTGCCAAGGAGATCGACACCAAGGAGCAGATCGCGGCCACCGCGGGCATCTCTGCCGGTGACCAGTCC ITS1 and Hsp65 was ...............T...................................................... Histopathological findings during the natural therefore NCIMB13533 performed and confirmed the identity of NVI6598-6607 ...................................................................... ITS1 bacterium as 1 M. salmoniphilum. 70 and experimental infections were dominated by the the associated ATCC13758 AAGGAGCACCATTTCCCAGTCGAATGAATTGGGAACATAAAGCGAGTATCTGTAGTGGATGCATGCTTGG presence of multisystemic, intraand extracellular Total losses of 21.1% between May and DecemNCIMB13533 ............................................................A......... ............................................................A......... acid-fast rods either in the form of microcolonies, ber (withNVI6598-6607 a peak in October), including market71 140 TGAATATGTTTTATAAATCCTGTCCACCCCGTGGATAGGTAGTCGGCAAAACGTCGAACTGTCATAAGAA displacing tissue structures, or dispersed as single sized fishATCC13758 of high commercial value in the field NCIMB13533 ...................................................................... bacterial cells (Figs 2 & 3). Some of the granulomoutbreak described in the present study, represented NVI6598-6599 .....................A................................................ NVI6600 ...................................................................... atous processes observed in various organs (mesena significant loss and considerably greater than the NVI6601-6607 .....................A................................................ teries, spleen, head kidney 4.1% loss over 6 months 141 reported by Bruno et al. 199 and liver capsule) TTGAAACGCTGGCACACTGTTGGGTCCTGAGGCAACACATTGTGTTGTCACCCTGCTTG comprised macrophages, epitheloid cells and rarely (1998) inATCC13758 the same fish species. Losses were, NCIMB13533 ........................................................... ......................................G.................... polymorph nucleated and giant cells. however, NVI6598-6599 lower than those reported in cultured NVI6600 ........................................................... Melanomacrophages were present in higher constriped bass infected with......................................G.................... M. marinum (Hedrick, NVI6601-6607 centrations (subjective assessment) in70 kidney of McDowellrpoB & Groff 1987)1and in Chinook salmon ATCC13758 CTGCGTGCCATCTTCGGCGAGAAGGCCCGCGAGGTCCGCGACACCTCTCTGAAGGTGCCGCACGGTGAGT COH and control fish groups compared with HD infected with M. chelonae ..........................T........................................... (Ashburner 1997). NCIMB13533 NVI6598-6604 ...................................................................... and LD groups. The reasons for this are not clear Following experimental infection, despite very NVI6605 .................A........C..............T.....C...................... NVI6606-6607 but the experimental design allows exclusion of low overall mortalities, ...................................................................... M. salmoniphilum was 71 140 starvation (Agius & Roberts 1981) and vaccination cultured ATCC13758 from all injected fish throughout the CCGGCAAGGTCATCGGCATCCGCGTCTTCTCGCGCGATGACGACGACGATCTGCCCGCCGGTGTCAACGA NCIMB13533 ...................................................................... status (Koppang et al. 2005) as possible contribulaboratoryNVI6598-6604 study period, and despite reisolation of ...................................................................... tors. Gross pathological changes observed on the M. salmoniphilum from only 4 (15%) of cohabiNVI6605 ..................................T....................T.....C..G..T.. ...................................................................... ventrolateral abdomen in LD and HD tant fish,NVI6606-6607 pathological changes consistent with 141 210 fish during ATCC13758 GCTGGTCCGGGTCTACGTCGCGCAGAAGCGCAAGATCTCCGACGGTGACAAGCTGGCCGGACGCCACGGC experimental infection were mainly confined to the mycobacterial infection were observed and KochÕs NCIMB13533 ...............T...................................................... injection site and surrounding area (Fig. 1c) and are postulatesNVI6598-6607 thus fulfilled. All deaths during exper...............T...................................................... 211 therefore most probably associated 280 with a local imental infections, except one from the HD fish ATCC13758 AACAAGGGCGTCATCGGCAAGATCCTGCCTGCGGAGGACATGCCGTTCCTGCCCGATGGCACCCCGGTGG NCIMB13533 ........................T....C........................................ infection inflicted during administration of the group, occurred shortly after sampling and were ........................T....C........................................ bacterial inoculate. Such lesions were not observed therefore NVI6598-6604 considered to be associated with stress NVI6605 ........................T....C........................................ NVI6606-6607 ........................T....C........................................ in fish from the field outbreak and may provide an and possible injuries inflicted during the sampling 281 350 indication that the route of natural infection in this activities. ATCC13758 ACGTCATCTTGAACACGCACGGTGTGCCGCGTCGTATGAACATCGGCCAGATCCTGGAGACCCACCTTGG NCIMB13533 ...................................................................... case is not via skin wounds. Similar dermal lesions Mycobacteriosis is a chronic disease requiring a NVI6598-6604 ...................................................................... NVI6605 ........C................A...........................T.............C.. were, however, observed in a natural M. chelonae long period between infection and clinical maniNVI6606-6607 ...................................................................... infection of Atlantic salmon smolts festation, with overt =—>421 pathological changes and 490 farmed in ATCC13758 British Columbia (Brocklebank, Raverty & Robineventual death as a final CAGTCGGCCCCGGCCGACACCCGCACGGCCACCCCGGTGTTCGACGGTGCCCGCGAGGAGGAGCTGACCG consequence (Ashburner NCIMB13533 ...................................................................... son 2003) and in an experimental and natural 1977; Noga, Wright & Pasarell 1990; Bruno et al. NVI6598-6604 ..................................................T.................T. ...................................................................... infection in moray eels (Herbst, Costa, Weiss, 1998). InNVI6605 contrast to reports from non-salmonid NVI6606-6607 ..................................................T.................T. =—>561 Vogelbein, Kator & 630(2001). Johnson, Bartell, Davis, Walsh & Levi species (Gauthier, Rhodes, ATCC13758 GTTCGACGGCCGTAGCGGCGAGCCGTTCCCGTACCCGGTGACCGTCGGATACATGTACATCCTGAAGCTG The main clinical observation during the field Ottinger NCIMB13533 2003), well-demarcated granuloma with ................................................C..................... ................................................C..................... outbreak was reduced growth rate combined with temporal NVI6598-6607 development was very rare, even in Figure 5 Alignment of partial 16S rRNA,during Hsp65,ITS1 rpoB gene increased sequences from ten mycobacterial isolates (NVI6598-NVI6607) observation of moribund fish near the terminal and dead fish examined thisand study, from an outbreak in farmed Atlantic salmon in Norway and Mycobacterium salmoniphilum strain ATCC 13758T* and M. salmoniphilum surface of the affected cage. Some of the stocks on and this observation was consistent with the strain NCIMB13533 sequences from GenBank. M. salmoniphilum type strain ATCC 13758 was used as reference; nucleotides (nt) farm had beenwith previously diagnosed with (=–>) IPN, previous study M.13758 chelonae (M. salmondiffering from thoseinvolving of the ATCC are indicated; dots indicatethe nucleotide similarity the reference strain; symbol and gillin hyperplasia, and these iphilum) infection in Atlantic salmon (Bruno et al. indicates identical sequence stretches up to the number shown in front myocarditis of the symbol. Numbers brackets represent the while last nucleotide where identical stretches * Reference conditions may well predispose affected fish to 1998). The sequence relatively highend.death rate strain. recorded
2011 Blackwell Publishing Ltd
777
M A Zerihun et al. Mycobacteriosis in farmed Atlantic salmon
Journal of Fish Diseases 2011, 34, 769–781
T 100 M. senegalalense CIP104941 (AY457081) 56 M. farcinogenes NCTC10955T (AY457084)
(a) 16S rRNA
M. fortuitum CIP 104534T (AY457066) M. wolinskyi ATCC700010T AY457083
100
M. mageritense CIP104973T (AY457076)
60
M. smegmatis ATCC19420T (AY457078)
M. septicum ATCC700731T (AY457070) M. peregrinum CIP105382T (AY457069)
87
M. porcinum CIP105392T (AY457077) M. neworleansense ATCC49404T (AY012575) M. mucogenicum ATCC49650T (AY457074) M. phocaicum CIP108542 (AY859682)
75
M. aubagnense CIP108543T (AY859683) M. salmoniphilum MON (DQ866767) 50 M. salmoniphilum SIL (DQ866769) M. salmoniphilum BAN (DQ866765) M. salmoniphilum ATCC 13758T (DQ866768)
77
M. salmoniphilum MT1900 (EF535602) M. salmoniphilum NCIMB13533 (EF535601) NVI 6606 NVI 6607
100
NVI 6605
62
NVI 6604
98
NVI 6603 NVI 6602 NVI 6601 NVI 6600 NVI 6599
99
NVI 6598 M. salmoniphilum ELK2 (DQ866766) M. salmoniphilum AUS (DQ866764)
99
M. salmoniphilum TRA (DQ866770) M. chelonae CIP104535T (AY457072)
100
M. abscessus CIP104536T (AY457071) M. bolletii CIP108541T (AY859681) M. immunogenum CIP106684T (AY457080)
M. leprae TN (AL583920) M. tuberculosis H37Rv (BX842576) 0.001 substitutions/site
T 87 M. peregrinum CIP105382 (AY458069) 89 M. septicum ATCC700731T (AY458066)
T 99 M. senegalense CIP104941 (AY262738)
M. farcinogenes NCTC10955T (AY262742)
73
M. fortuitum CIP104534T (AY147165)
89
(b) rpoB 69
(c) Hsp65
56
56
M. septicum ATCC700731T (AY147167)
71
M. phocaicum CIP108542T (AY859693)
100
M. wolinskyi ATCC700010T (AY458064) M. smegmatis ATCC19420T (AY458065)
M. mucogenicum ATCC49650T (AY147170)
95
M. bolletii CIP108541T (AY859692)
95
M. fortuitum CIP104534T (AY458072) M. senegalense CIP104941T (AY458067)
90
M. wolinskyi ATCC700010T (AY262743)
100
M. porcinum CIP105392T (AY458068) M. neworleansense ATCC49404T (AY458076)
M. peregrinum CIP105382T (AY147166)
97
M. mucogenicum ATCC49650T (AY458079) M. phocaicum CIP108542T (AY859676)
M. abscessus CIP104536T
78
M. salmoniphilum AUS (DQ866778)
51
M. immunogenum CIP06684T (EU109285) M. chelonae CIP104535T (AY147163)
M. salmoniphilum TRA (DQ866783) M. salmoniphilum SIL (DQ866782)
81
M. salmoniphilum MON (DQ866781)
NVI 6605
53 60 M. salmoniphilum ATCC13757 (DQ866791)
100
M. salmoniphilum BAN (DQ866779)
100
NVI 6599
M. salmoniphilum AUS (DQ866797) M. salmoniphilum TRA (DQ866795)
69 87
63
NVI 6603
75
NVI 6598
M. salmoniphilum SIL (DQ866793)
NVI 6600
M. salmoniphilum MON (DQ866794)
99
NVI 6601
M. salmoniphilum BAN (DQ866792)
NVI 6606
M. salmoniphilum ELK (DQ866796)
NVI 6605
NVI 6604
90 NVI 6602
NVI 6601
100
NVI 6604
NVI 6599 NVI 6598
M. salmoniphilum ATCC13758T
66 NVI 6600
98
NVI 6607
100 57
88 M. salmoniphilum NCIMB13533
NVI 6606
M. salmoniphilum ELK (DQ866780) M. chelonae CIP104535T (AY458074)
NVI 6602
77
M. immunogenum CIP106684T (AY458081)
NVI 6603 M. salmoniphilum NCIMB13533 (EF536970) M. salmoniphilum ATCC13758T (DQ866790)
M. leprae TN (AL583923) M. tuberculosis H37Rv (BX842574) 0.01 substitutions/site
M. salmoniphilum MT1900 (EF535604)
NVI 6607
98
M. abscessus CIP104536T (AY458075) M. bolletii CIP108541T (FJ607778) M. leprae TN (AL583923)
M. tuberculosis H37Rv (BX84257) 0.01 substitutions/site
Figure 6 Phylogenetic relationships of Mycobacterium salmoniphilum, isolated from farmed Atlantic salmon during field outbreak (bold) with other Mycobacterium spp. based on (a) 16S rRNA, (b) rpoB and (c) Hsp65 loci. GeneBank accession numbers for sequences used to construct the trees are shown in parentheses. The bars indicate substitutions per nucleotide position. 2011 Blackwell Publishing Ltd
778
Journal of Fish Diseases 2011, 34, 769–781
mycobacterial infection, there did not appear to be any direct association between these diseases and mycobacterial infection in the present case. The relatively low infection rate in experimental cohabitant fish and the absence of a profound granuloma formation in most injected and cohabitant fish during this study could be attributed to, e.g., the relatively low water temperature at which the study was carried out, stress levels in the fish, host strain susceptibility, as suggested by other studies (Gauthier et al. 2003). Favourable controlled environments with constant feeding regimes, temperature and water circulation may affect progression of infection in favour of the host (Jacobs, Rhodes, Baya, Reimschuessel, Townsend & Harrell 2009). A 4-month laboratory infection trial as in the present case is short, compared with longer periods used for similar studies carried out on other fish species (mostly in warmer waters), e.g., striped bass, Morone saxatilis (Gauthier et al. 2003). It is therefore considered highly likely that given more time, the infection rate and possibly mortality levels amongst injected and cohabitant fish may have been considerably greater than recorded. In current fish health investigations, mycobacterial infections are normally only considered as a differential diagnosis following recording of granuloma and subsequent observation of ZN-positive bacteria. The present study has demonstrated the presence of heavy mycobacterial infection in the apparent absence of such indications. Reliance on granuloma detection and ZN staining of mycobacteria in affected fish tissues may therefore lead to under diagnosis. Mycobacteriosis may therefore be more common in salmon farming practices than previously thought. In summary, the clinical, pathological, bacteriological and molecular analyses conducted in this study have confirmed the involvement of M. salmoniphilum with significant losses on a Norwegian Atlantic salmon farm. Acknowledgements
The authors are grateful to H.I. Welde, A.K. Joranlid and E. Soltvedt for their contribution during sampling of the experimental infection. We thank Prof. H. Sørum for his valuable advice during planning of the experimental infection and for critical reading of the manuscript. This study was supported by the Norwegian Research Council, project nr. 1588823. 2011 Blackwell Publishing Ltd
779
M A Zerihun et al. Mycobacteriosis in farmed Atlantic salmon
References Ade´kembi T., Colson P. & Drancourt M. (2003) rpoB-based identification of non-pigmented and late-pigmenting rapidly growing mycobacteria. Journal of Clinical Microbiology 41, 5699–5708. Agius C. & Roberts R.J. (1981) Effects of starvation on the melano-macrophage centres of fish. Journal of Fish Biology 19, 161–169. Alfredsen S.A. (1993) Tuberculosis and mycobacteriosis in Norwegian slaughter animals and farmed salmonids. Thesis for the Degree of Doctor Scientiarum. Norwegian School of Veterinary Sciences. Altschul S.F., Madden T.L., Schaffer A.A., Zhang J., Zhang Z., Miller W. & Lipman D.J. (1997) Gapped BLAST and PSIBLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 3389–3402. Arakawa C.K. & Fryer J.L. (1984) Isolation and characterization of a new subspecies of Mycobacterium chelonei infections for salmonid fish. Helgola¨nder Meeresuntersuhungen 37, 329–342. Ashburner L.D. (1977) Mycobacteria in hatchery-confined Chinook salmon (Oncorhynchus tshawytscha) in Australia. Journal of Fish Biology 10, 523–528. Beckwith D.G. & Malsberger R.G. (1980) Kidney tumour virustumour or mycobacterial tubercle? Journal of Fish Diseases 3, 339–348. Brocklebank J., Raverty S. & Robinson J. (2003) Mycobacteriosis in Atlantic salmon farmed in British Colombia. Canadian Veterinary Journal 44, 486–489. Bruno D.W., Griffiths J., Mitchell C.G., Wood B.P., Fletcher Z.J., Drobniewski F.A. & Hastings T.S. (1998) Pathology attributed to Mycobacterium chelonae infection among farmed salmon and laboratory infected Atlantic salmon Salmo salar. Diseases of Aquatic Organisms 33, 101–109. Chinabut S. (1999) Mycobacteriosis and nocardiosis. In: Fish Diseases and Disorders, Vol. 3: Viral, Bacterial and Fungal Infections (ed. by T.K. Woo & D.W. Bruno), pp. 319–340. CAB International, New York, NY. Colorni A. (1992) A systematic mycobacteriosis in the European sea bass Dicentrarchus labrax cultured in Eilat (Red Sea). Israelish Journal of Aquaculture 44, 75–81. Dalsgaard I., Mellergaard S. & Larsen J.L. (1992) Mycobacteriosis in cod (Gadus morhua L.) in Danish coastal waters. Aquaculture 107, 211–219. Decostere A., Hermans K. & Haesebrouck F. (2004) Piscine mycobacteriosis: a literature review covering the agent and the disease it causes in fish and humans. Veterinary Microbiology 99, 159–166. Devulder G., Perouse de Montclos M. & Flandrois J.P. (2005) A multigene approach to phylogenetic analysis using the genus Mycobacterium as a model. International Journal of Systematic and Evolutionary Microbiology 55, 293–302. van Duijn C. (1981) Tuberculosis in fishes. Journal of Small Animal Practice 22, 391–411. Earp B.J., Ellis C.H. & Ordal E.J. (1953) Kidney disease in young salmon, special report no. 1. Washington State Department of Fisheries.
Journal of Fish Diseases 2011, 34, 769–781
M A Zerihun et al. Mycobacteriosis in farmed Atlantic salmon
Eddyani M., Ofori-Adfei D., Teugels G., De Weirdt D., Boakye D., Meyers W.M. & Portaels F. (2004) Potential role for fish in transmission of Mycobacterium ulcerans disease (Buruli ulcer): an environmental study. Applied and Environmental Microbiology 70, 5679–5681.
nov., a novel pathogenic Mycobacterium from moray eels that is related to Mycobacterium triplex. Journal of Clinical Microbiology 41, 2147–2152.
Frerichs (1993) Mycobacteriosis: nocardiosis. In: Bacterial Diseases of Fish (ed. by V. Inglis, R.J. Roberts & N.R. Bromage), pp. 219–233. Blackwell, Oxford. Gauthier D.T., Rhodes M.W., Vogelbein W.K., Kator H. & Ottinger C.A. (2003) Experimental mycobacteriosis in striped bass Morone saxatilis. Diseases of Aquatic Organisms 54, 105– 117. Go´mez S., Bernabe´ A., Go´mez M.A., Navarro J.A. & Sa´nchez J. (1993) Fish mycobacteriosis: morphological and immunological aspects. Journal of Fish Diseases 16, 137–141. Gomila M., Ramirez A. & Lalucat J. (2007) Diversity of environmental Mycobacterium isolates from hemodialysis water as shown by multigene sequencing approach. Applied and Environmental Microbiology 73, 3787–3797. Heckert R.A., Elankumaran S., Milani A. & Baya A. (2001) Detection of new Mycobacterium species in wild striped bass in the Chesapeake Bay. Journal of Clinical Microbiology 39, 710– 715. Hedrick R.P., McDowell T. & Groff J. (1987) Mycobacteriosis in cultured striped bass from California. Journal of Wildlife Disease 23, 391–395. Herbst L.H., Costa S.F., Weiss L.M., Johnson L.K., Bartell J., Davis R., Walsh M. & Levi M. (2001) Granulomatous skin lesions in moray eels caused by a novel Mycobacterium species related to Mycobacterium triplex. Infection and Immunity 69, 4639–4646. Jacobs J.M., Rhodes M.R., Baya A., Reimschuessel R., Townsend H. & Harrell R.M. (2009) Influence of nutritional state on the progress and severity of mycobacteriosis in striped bass Morone saxatilis. Diseases of Aquatic Organisms 87, 183– 197. Jansen M.D., Taksdal T., Wasmuth M.A., Gjerset B., Brun E., Olsen A.B., Breck O. & Sandberg M. (2010) Salmonid alphavirus (SAV) and pancreas disease (PD) in Atlantic salmon, Salmo salar L., in freshwater and saltwater sites in Norway from 2006–2008. Journal of Fish Diseases 33, 391– 402. Kent P.T. & Kubica G.P. (eds) (1985) Public Health Mycobacteriology: A Guide for the Level III Laboratory. US Department of Public Health & Human Services, Center for Disease Control, Atlanta, GA. Koppang E.O., Haugarvoll E., Hordvik I., Aune L. & Poppe T.T. (2005) Vaccine-associated granulomatous inflammation and melanin accumulation in Atlantic salmon, Salmo salar L., white muscle. Journal of Fish Diseases 28, 13–22. Kotlowski R., Martin A., Ablordey A., Chemlal K., Fonteyne P.A. & Portaels F. (2004) One tube cell lysis and DNA extraction procedure for PCR-based detection of Mycobacterium ulcerans in aquatic insects, molluscs and fish. Journal of Medical Microbiology 53, 927–933. Levi M.H., Bartell J., Gandolfo L., Smole S.C., Costa S.F., Weiss L.M., Johnson L.K., Osterhout G. & Herbst L.H. (2003) Characterization of Mycobacterium montefiorense sp. 2011 Blackwell Publishing Ltd
780
Luna L.G. (1968) Manual of Histologic Staining Methods of the Armed Forces Institute of Pathology. McGraw-Hill, New York. Lutz B. (1992) Section 3. Mycobacteriology. 3.12. Identification tests for mycobacteria. In: Clinical Microbiology Procedures Handbook, Vol. 1 (ed. by H.D. Isenburg), pp. 3.12.1–29. American Society for Microbiology, Washington. MacKenzie K. (1988) Presumptive mycobacteriosis in North-east Atlantic mackerel, Scomber scombrus L. Journal of Fish Biology 32, 263–275. Midtlyng P.J. & Lillehaug A. (1998) Growth of Atlantic salmon Salmo salar after intraperitoneal administration of vaccines containing adjuvants. Diseases of Aquatic Organisms 32, 91–97. Neefs J.M., Van de Peer Y., De Rijk P., Chapelle S. & De Wachter R. (1993) Compilation of small ribosomal subunit RNA structures. Nucleic Acids Research 21, 3025–3049. Nigrelli R.F. & Vogel H. (1963) Spontaneous tuberculosis in fishes and other cold-blooded vertebrates with special reference to Mycobacterium fortuitum Cruz from fish and human lesions. Zoologica 48, 131–143. Noga E.J., Wright J.F. & Pasarell L. (1990) Some unusual features of mycobacteriosis in the cichlid fish Oreochromis mossambicus. Journal of Comparative Pathology 102, 335–344. Rhodes M.W., Kator H., Kotob S., van Berkum P., Kaattari I., Vogelbein W., Floyd M.M., Butler W.R., Quinn F.D., Ottinger C. & Shotts E. (2001) A unique Mycobacterium species isolated from an epizootic of striped bass (Morone saxatilis). Emerging Infectious Diseases 7, 896–899. Roberts R.J. (2001) The bacteriology of teleosts. In: Fish Pathology (ed. by R.J. Roberts), pp. 297–331. W.B. Sounders, New York, NY. Ross A.J. (1960) Mycobacterium salmoniphilum sp. nov. from salmonid fishes. American Review of Respiratory Diseases 81, 241–250. Roth A., Reischl U., Streubel A., Nauman L., Kroppenstedt R.M., Habicht M., Fischer M. & Mauch H. (2000) Novel diagnostic algorithm for identification of mycobacteria using genus-specific amplification of the 16S-23S rRNA gene spacer and restriction endonucleases. Journal of Clinical Microbiology 38, 1094–1104. Steingrube V.A., Gibson J.L., Brown B.A., Zhang Y., Wilson R.W., Rajagopalan M. & Wallace R.G. Jr (1995) PCR amplification and restriction endonuclease analysis of a 65kDa heat shock protein gene sequence for taxonomic separation of rapidly growing mycobacteria. Journal of Clinical Microbiology 33, 149–153. Swofford D.L. (1998) PAUP*. Phylogenetic Analysis Using Parsimony (and Other Methods), Version 4. Sinauer, Sunderland, MA. Thompson J.D., Gibson T.J., Plewniak F., Jeanmougin F. & Higgins D.G. (1997) CLUSTAL_X: windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 25, 4876–4882.
Journal of Fish Diseases 2011, 34, 769–781
M A Zerihun et al. Mycobacteriosis in farmed Atlantic salmon
Tortoli E., Bartoloni A., Bozzetta E., Burrini C., Lacchini C., Mantella A., Penati B., Simonetti M.T. & Ghittino C. (1996) Identification of the newly described Mycobacterium poriferae from tuberculous lesions of the snakehead fish (Channa striatus). Comparative Immunology Microbiology and Infectious Diseases 19, 22–29.
International Journal of Systematic and Evolutionary Microbiology 11, 2525–2531.
Weisburg W.G., Barns S.M., Pelletier D.A. & Lane D.J. (1991) 16S ribosomal DNA amplification for phylogenetic study. Journal of Microbiology 173, 697–703. Whipps C.M., Butler W.R., Pourahmad F., Watral V.G. & Kent M.L. (2007) Molecular systematics support the revival of Mycobacterium salmoniphilum (ex Ross 1960) sp. nov., nom. rev., a species closely related to Mycobacterium chelonae.
2011 Blackwell Publishing Ltd
781
Zanoni R.G., Florio D., Fioravanti M.L., Rossi M. & Prearo M. (2008) Occurrence of Mycobacterium spp. in ornamental fish in Italy. Journal of Fish Diseases 31, 433–441. Zerihun M.A., Hjortaas M.J., Falk K. & Colquhoun D.J. (2011) Immunohistochemical and Taqman real-time PCR detection of mycobacterial infections in fish. Journal of Fish Diseases 34, 235–246. Received: 23 December 2010 Accepted: 11 February 2011
Journal of Fish Diseases 2011, 34, 959–960
doi:10.1111/j.1365-2761.2011.01320.x
Erratum Mycobacterium salmoniphilum infection in farmed Atlantic salmon, Salmo salar L. M A Zerihun, H Nilsen, S Hodneland and D J Colquhoun Article published online: 15 September 2011; DOI: 10.1111/j.1365-2761.2011.01293.x
The ÔDiscussionÕ section in the above article was published despite containing missing data. In page 776, the second paragraph of the ÔDiscussionÕ should read: During the current investigation, bacterial isolates belonging to the genus Mycobacterium were cultivated from 11 of 30 (36.6%) sampled moribund and newly dead Atlantic salmon held in one of the nine cages in a farm in western Norway. Cultural and biochemical results using standard culture and biochemical methodology (Kent et al. 1985; Lutz 1992) were consistent with isolates cultured previously from Atlantic salmon in the Shetland Isles, initially considered M. chelonae (Bruno et al. 1998), but subsequently identified as M. salmoniphilum (Ross 1960; Whipps et al. 2007). Although the obtained 16S rRNA sequences were consistent with culture and biochemical characterization, this gene is often highly similar between different species of Mycobacterium and offers therefore a poor grade of phylogenetic resolution. Sequence analysis of rpoB, ITS1 and Hsp65 was therefore performed and confirmed the identity of the associated bacterium as M. salmoniphilum. Total losses of 21.1% between May and December (with a peak in October), including market-sized fish of high commercial value in the field outbreak described in the present study, represented a significant loss and considerably greater than the 4.1% loss over 6 months reported by Bruno et al. (1998) in the same fish species. Losses were, however, lower than those reported in cultured striped bass infected with Mycobacterium marinum (Hedrick, MacDowell & Groff 1987), and in Chinook salmon Oncorynchus tshawytscha infected with M. chelonae (Ashburner 1977). Following experimental infection, despite very low overall mortalities, M. salmoniphilum was cultured from all injected fish throughout the laboratory study period, and despite re-isolation of M. salmoniphilum from only 4 (15%) of cohabitant fish, pathological changes consistent with mycobacterial infection were observed and KochÕs postulates thus fulfilled. All deaths during experimental infections, except one from the HD fish group, occurred shortly after sampling and were therefore considered to be associated with stress and possible injuries inflicted during the sampling activities. Mycobacteriosis is a chronic disease requiring a long period between infection and clinical manifestation, with overt pathological changes and eventual death as a final consequence (Ashburner 1977; Noga, Wright & Pasarell 1990; Bruno et al. 1998). In contrast to reports from non-salmonid species (Gauthier, Rhodes, Vogelbein, Kator & Ottinger 2003), well-demarcated granuloma with temporal development was very rare, even in terminal and dead fish examined during this study, and this observation was consistent with the previous study involving M. chelonae (M. salmoniphilum) infection in Atlantic salmon (Bruno et al. 1998). The relatively high death rate recorded during the present field outbreak may suggest that the affected population was in some way predisposed to mycobacterial infection, a scenario supported by the fact that more than one genotype of M. salmoniphilum was involved. The diffuse granulomatous processes (Fig. 6) observed relatively often in the mesenteries of experimental fish, both challenged and control groups, were most likely associated with the intra-peritoneal oil-adjuvant PD vaccine administered to all fish prior to the experiment (Koppang, Haugarvoll, Hordvik, Aune & Poppe 2005; Midtlyng & Lillehaug 1998). Histopathological findings during the natural and experimental infections were dominated by the presence of multi-systemic, intra- and extracellular acid-fast rods either in the form of microcolonies, displacing tissue structures, or dispersed as single bacterial cells (Figs 2 & 3). Some of the granulomatous processes observed
Ó 2011 Blackwell Publishing Ltd
959
Journal of Fish Diseases 2011, 34, 959–960
Erratum
in various organs (mesenteries, spleen, head kidney and liver capsule) comprised macrophages, epitheloid cells and rarely polymorph nucleated and giant cells. Melanomacrophages were present in higher concentrations (subjective assessment) in kidney of COH and control fish groups compared to HD and LD groups. The reason(s) for this is not clear, but the experimental design allows exclusion of starvation (Agius & Roberts 1981) and vaccination status (Koppang et al. 2005) as possible contributors. Gross pathological changes observed on the ventrolateral abdomen in LD and HD fish during experimental infection were mainly confined to the injection site and surrounding area (Fig. 1c) and are therefore most probably associated with a local infection inflicted during administration of the bacterial inoculate. Such lesions were not observed in fish from the field outbreak and may provide an indication that the route of natural infection in this case is not via skin wounds. Similar dermal lesions were, however, observed in a natural M. chelonae infection of Atlantic salmon smolts farmed in British Columbia (Brocklebank, Raverty & Robinson 2003) and in an experimental and natural infection in moray eels (Herbst, Costa, Weiss, Johnson, Bartell, Davis, Walsh & Levi 2001). In page 779, the first paragraph should read: ÔThe main clinical observation during the field outbreak was reduced growth rate combined with increased observation of moribund fish near the surface of the affected cage. Some of the stocks on the farm had been previously diagnosed with IPN, myocarditis and gill hyperplasia, and while these conditions may well predispose affected fish to mycobacterial infection, there did not appear to be any direct association between these diseases and mycobacterial infection in the present case.Õ The publisher sincerely apologizes for this error. Reference Zerihun M.A., Nilsen H., Hodneland S. & Colquhoun D.J. (2011) Mycobacterium salmoniphilum infection in farmed Atlantic salmon, Salmo salar L. Journal of Fish Diseases 34, 769–781.
Ó 2011 Blackwell Publishing Ltd
960
III
DISEASES OF AQUATIC ORGANISMS Dis Aquat Org
Vol. 95: 57–64, 2011 doi: 10.3354/dao02347
Published May 24
Mycobacterium salmoniphilum infection in burbot Lota lota Mulualem Adam Zerihun1,*, Vidar Berg2, Jan L. Lyche2, Duncan J. Colquhoun1, Trygve T. Poppe2 1
The Norwegian Veterinary Institute, Ullevaalsveien 68, 0106 Oslo, Norway The Norwegian School of Veterinary Science, Ullevaalsveien 72, 0037 Oslo, Norway
2
ABSTRACT: Burbot Lota lota sampled from lakes Mjøsa and Losna in southeastern Norway between 2005 and 2008 were found to be infected with Mycobacterium salmoniphilum at a culture-positive prevalence of 18.6 and 3.3%, respectively. The condition factor (CF) of mycobacteria-affected fish sampled from Mjøsa in 2008 was lower than the average CF of total sampled fish the same year. Externally visible pathological changes included skin ulceration, petechiae, exopthalmia and cataract. Internally, the infections were associated with capsulated, centrally necrotic granulomas, containing large numbers of acid-fast bacilli, found mainly in the mesenteries, spleen, heart and swim bladder. Mycobacterial isolates recovered on Middlebrook 7H10 agar were confirmed as M. salmoniphilum by phenotypical investigation and by partial sequencing of the 16S rRNA, rpoB and Hsp65 genes as well as the internal transcribed spacer (ITS1) locus. This study adds burbot to the list of fish species susceptible to piscine mycobacteriosis and describes M. salmoniphilum infection in a non-salmonid fish for the first time. KEY WORDS: Mycobacteriosis · Mycobacterium salmoniphilum · Multi-gene sequencing · Phylogeny · Pathology · Burbot · Lota lota Resale or republication not permitted without written consent of the publisher
Burbot Lota lota, the sole member of its genus, is the only truly freshwater gadiform (cod-like) fish, having a circumpolar distribution above latitude 40°N (Cohen et al. 1990). In recent years, burbot populations have been declining in both North America and Europe, with industrial pollution speculated as a possible cause (Pulliainen et al. 1992, Stapanian et al. 2010). Little is known of the natural pathogens of burbot and of the susceptibility of this fish species to pathogenic agents. To the best of our knowledge, the only relevant published work is that of Polinski et al. (2010) in which they investigated the virulence of infectious haematopoetic necrosis virus (IHNV), infectious pancreatic necrosis virus (IPNV), Aeromonas salmonicida, Flavobacterium psychrophilum and Renibacterium salmoninarum in burbot. No overt disease was demonstrated.
The present study was performed as part of a larger investigation into the effects of environmental pollution on fish health in Lake Mjøsa. As preliminary sampling revealed mycobacteriosis in several burbot containing extremely high levels of polybrominated diphenyl ethers (PBDEs) from this lake, sampling was extended to compare the mycobacterial infection status of Lake Mjøsa burbot with burbot from nearby Lake Losna which display background levels of PBDE (Mariussen et al. 2008). While piscine mycobacteriosis is common in warmer waters (Nigrelli & Vogel 1963, Hedrick et al. 1987), this disease appears to be relatively uncommon in Europe, particularly in freshwater. Incidences of marine mycobacteriosis in Europe include reports from mackerel Scomber scombrus (presumptive) in the northeast Atlantic (MacKenzie 1988), wild cod in Danish coastal waters (Dalsgaard et al. 1992) and sea-farmed Atlantic salmon Salmo salar (Bruno et al. 1998, Zerihun et al.
*Email:
[email protected]
© Inter-Research 2011 · www.int-res.com
INTRODUCTION
58
Dis Aquat Org 95: 57–64, 2011
2011b). As far as we are aware, the present report represents the first documentation of mycobacteriosis in a wild, native, northern European fish species and the first report of Mycobacterium salmoniphilum infection in a non-salmonid freshwater fish species.
MATERIALS AND METHODS Fish samples. From 2005 to 2008, 58 burbot were sampled from Lake Mjøsa and 30 from Lake Losna. Sampling of the fish was conducted as part of a study of the effects of persistent organic pollutants (POPs) on burbot in both lakes. Lake Losna is located upstream and in the same water catchment as Lake Mjøsa, which is the largest lake in terms of surface area and the fourth deepest in Norway (Fig. 1). The studied fish from Lake Mjøsa were caught in the vicinity of Vingrom; those from Lake Losna were caught close to the head of the river
Fig. 1. Sampling sites Lake Mjøsa and Lake Losna, located in eastern Norway. Mjøsa is the largest lake in Norway and Lake Losna is part of the Gudbrandalslågen river catchment, which is the major inflow to Lake Mjøsa
Gudbrandsdalslågen. The fish populations are physically separated by a dam. In both lakes the fish were captured live in fyke nets set at a depth of approximately 10 to 20 m in Lake Losna and 20 to 40 m in Lake Mjøsa. The nets were emptied after 10 d and the fish transported live in iced water to the Norwegian Veterinary Institute (NVI), Oslo, for examination. In addition to burbot, 10 pike Esox lucius were sampled from Lake Mjøsa. Gross examination. All sampled fish were weighed, measured, and condition factor (CF) was calculated as CF = W × 100 × L– 3, where W is body weight (g) and L is length (cm) (Begenal & Tesch 1978). External and internal macroscopic lesions observed during aseptic necropsies were recorded. Histopathology. Samples for histopathological examination were taken mainly from fish with macroscopically visible pathological changes in one or more organs. A total of 55 fish, comprising 11 fish from Losna and 44 from Mjøsa, were examined. Tissue samples (head kidney, liver, spleen, heart, mesenteries and intestine, gills, muscle and skin and other organs with visible pathological lesions) were fixed in 10% buffered formalin for routine paraffin embedding and sectioning. Tissue sections were then examined using light microscopy after staining with haematoxylin and eosin (H&E) (Luna 1968). Parallel sections were stained with Ziehl-Neelsen (ZN) stain. Immunohistochemistry. Tissue sections taken from 15 fish with macroscopically visible granulomas were immunostained using genus-specific Mycobacterium polyvalent antisera as described by Zerihun et al. (2011a). Bacteriology. Blocks of tissue (approximately 0.2 g) from kidney, spleen, mesenteries and other organs were taken from all necropsied fish. These tissues were placed into sterile tubes with metal beads (Bertin Technologies) and 1 ml of Butterfield’s phosphate buffer (PB) was then added and homogenised using a MagNA Lyser® (Roche). Blood agar with 2% NaCl (BAS), without salt (BA), and Middlebrook 7H10 Agar supplemented with Bacto Middlebrook oleic acidalbumin-dextrose-catalase enrichment (MDA) were spread-plated with 0.1 ml homogenate. A series of dilutions (101 to 103) were prepared from selected tissue homogenates to avoid overgrowth by other bacteria. BA and MDA plates were incubated at 22°C and BAS plates at 15°C. MDA plates were incubated for 8 wk and examined twice weekly. BA and BAS plates were incubated for 10 d. Bacterial isolates were characterised using accepted methods (Kent & Kubica 1985, Lutz 1992), including Gram and ZN staining. Isolates were inoculated from MDA onto MacConkey agar plates with crystal violet, urea agar and Löwenstein Jensen (LJ) medium, incubated at 28°C for up to
59
Zerihun et al.: Mycobacteriosis in burbot Lota lota
1 mo and checked at least weekly. Recommended positive and negative controls were included in each test. Urease, nitrate reduction, citrate utilisation and iron uptake were also measured and results were validated using positive and negative controls as previously described (Lutz 1992). DNA extraction. Approximately half of the 101 tissue homogenate (500 µl) prepared for bacterial culture was placed into FastProtein™ Blue (Epicentre Biotechnologies) and, following the addition of 500 µl PB, homogenized twice for 45 s each at 3779 × g using a MagNA Lyser® (Roche). Two full inoculating loops (10 µl each) of bacterial cells were emulsified in 1 ml PB, transferred into FastProtein™ Blue and homogenized as described above. DNA was extracted from tissue and bacterial homogenates using QuickExract™ DNA Extraction kit (Epicenter® Biotechnologies) and procedures recommended by the manufacturer. Real-time PCR. Mycobacterium-specific real-time PCR was carried out on spleen tissue from all sampled fish as described by Zerihun et al. (2011a). DNA extracted from uninfected fish tissues were used as negative controls and were consistently negative. All samples were analysed in duplicate. Sequence analysis. The 16S rRNA gene of the obtained isolates from plated cultures was amplified using PCR and primers as described by Weisburg et al. (1991). Sequencing of the PCR products was performed using the same primer sets and additional sequencing primers V1, V2, V3, V4, V5 and V6 (Neefs et al. 1993). Partial sequences of the ITS1, rpoB and Hsp65 genes were amplified and sequenced using primers and procedures described previously (Steingrube et al. 1995, Roth et al. 2000, Adékambi et al. 2003, Gomila et al. 2007). Negative and positive controls were included for each set of amplification. PCR products were purified using the QIAquick PCR Purification Kit (Qiagen), and sequencing was performed using the ABI BigDye Terminator v3.1 Ready Reaction Cycle Sequencing Kit and the ABI PRISM® 3100 Genetic Analyser (Applied Biosystems). Sequence fragments obtained in this study were compared with other database entries using BLAST search analysis (Altschul et al. 1997) and deposited in the National Center for Biotechnology Information (NCBI) database with the following accession numbers: for Hsp65, HM638432 to HM638438; ITS1, HM638439 to HM638445; 16S rRNA, HM638446 to HM638452 and rpoB, HM63638453 to HM638459. Phylogenetic analysis. Contiguous sequences (NVI6590 to NVI6594, NVI6608 and NVI6609) were assembled using the Sequencher program (Gene Codes Corporation). DNA sequences of 16S rDNA, rpoB and Hsp65 were aligned in CLUSTAL_X (Thompson et al. 1997) with related sequences, mainly type strains retrieved from GenBank as included by Whipps
et al. (2007). A neighbour-joining phylogenetic tree was generated using the Kimura 3-parameter model in PAUP* version 4.0b10 (Swofford 1998). The strains Mycobacterium tuberculosis H37Rv and M. leprae TN were used as outgroups. Ambiguous and/or missing characters were excluded from the analysis.
RESULTS Gross pathology Of 58 fish examined from Lake Mjøsa, 20 showed visceral granulomas while 38 showed both visceral granulomas and external lesions. The CF of mycobacteria-affected fish sampled from Mjøsa in 2008 (0.75) was lower than the average CF (0.84) of all fish sampled in Mjøsa the same year. Externally visible pathological changes included skin ulceration, keratitis, petechiae, exophthalmia, vertebral deformity and cataract. Internally, greyish-white nodules (1 to 4 mm) were prominent on mesenteries and occasionally in the spleen, liver and heart. One fish showed a large (> 20 mm) grey-brown nodule on the swim bladder (Fig. 2A). A swollen spleen (splenomegaly) was observed in 13 fish from Mjøsa, with some of these fish displaying inflammatory processes of the spleen capsule and adhesion to the mesentery (Fig. 2B). Plerocercoid cysts of the pike tapeworm Triaenophorus nodulosus were observed in the viscera, mainly on mesenteries and serosa of the gastro-intestinal tract (GIT) of the majority of fish sampled from Mjøsa. Fish sampled from Losna (n = 30) did not show macroscopically visible pathological changes.
Histopathology Granulomas were identified in the visceral organs of 33 out of 44 (75%) fish from Mjøsa and 2 out of 11 (18.2%) fish from Losna. Granulomas were mainly observed in the mesenteries and occasionally in the heart, spleen, liver and wall of the GIT (Fig. 3A–D). ZN positive bacilli were visible within granulomas (Fig. 3D) only in culture and real-time PCR positive fish, although not all granulomas from such fish displayed ZN positive bacilli. Several ZN negative tissue sections from culture and PCR positive fish stained positively by immunohistochemistry (IHC). None of the tissue sections from fish taken from Losna stained positively with either ZN or immunostaining. The observed granulomas appeared to be of the reticuloendothelial (RE) type. Granulomas displayed RE cells and necrotic debris in the centre circumscribed by layers of spindle and epithelioid cells. The
60
Dis Aquat Org 95: 57–64, 2011
22°C on MDA (Table 1). The same bacteria were also cultivated from homogenates of spleen, mesenteries, liver and heart. Bacterial isolates were Gram and ZN positive and showed biochemical characteristics consistent with a Mycobacterium sp. previously isolated from salmonids by Arakawa & Fryer (1984), Bruno et al. (1998) and Zerihun et al. (2011b) and now recognised as M. salmoniphilum.
Molecular characterisation
Fig. 2. Lota lota. Burbot sampled from Lake Mjøsa with gross pathology attributed to mycobacterial infection: (A) greyishbrown granulomatous process (> 20 mm) on the outer surface (serosa) of the swim bladder and (B) swollen spleen (splenomegaly) with inflammatory process and adhesion to the surrounding mesenteries
outermost zone was encapsulated by thick layers of fibrous tissues (Fig. 3C). Granulomas were either diffusely scattered in the mesenteries, liver, spleen and heart or were multiple and coalescent (Fig. 3A). Most granulomas were well defined with a clear demarcation towards normal tissue and were typically layered with a caseonecrotic centre (Fig. 3A– C). ZN staining revealed aggregates of acid-fast bacilli in the central parts of the granulomas (Fig. 3D).
The Mycobacterium-specific real-time PCR conducted on spleen tissue samples revealed positive results in 14 out of 40 (35%) fish from Lake Mjøsa and 2 out of 30 (6.6%) from Lake Losna (Table 1). Using conventional PCR, fragments of the 16S rRNA (~1464 bp), Hsp65 (422 bp) and rpoB (709 bp) genes as well as ITS1 (194 bp) were amplified and sequenced from pure cultures of isolated Mycobacterium sp. The 16S rRNA sequences of all isolates were identical and displayed 100% identity with M. salmoniphilum type strain ATCC 13758T (DQ866768) and reference strain NCIMB 13533 (EF535601). Partial Hsp65 and rpoB gene sequences were also identical, with rpoB showing 99% and 97% identity with M. salmoniphilum NCIMB13533 and ATCC 13758T, respectively, while Hsp65 displayed 99% identity with ATCC 13758T and 98% with NCIMB13533. With the exception of isolates NVI6608 and NVI6609, which displayed 4 bp differences, partial ITS1 sequences were also identical and displayed 98% and 97% identity with M. salmoniphilum strains NCIMB13533 and ATCC 13758T, respectively. Individual phylogenetic trees were constructed for 16S rRNA, Hsp65 and rpoB genes. All trees supported the phylogenetic topology presented by Whipps et al. (2007) (Fig. 4).
Examination of pike Esox lucius No evidence of mycobacterial infection was found following macroscopic, histological bacteriological, or molecular (real-time PCR) studies of the sampled pike.
DISCUSSION Bacteriology and phenotypical characterisation Smooth, opaque and creamy colonies with an entire margin were cultivated from the head kidney of 11 out of 59 (18.6%) and 1 out of 30 (3.3%) fish from Mjøsa and Losna, respectively, within 10 d of incubation at
Mycobacteriosis generally manifests as a sub-acute to chronic disease in both wild and captive fish (Chinabut 1999). The findings in the present study are consistent with the existence of such an infection in burbot from both lakes studied, with a considerably higher prevalence of mycobacteriosis detected in bur-
Zerihun et al.: Mycobacteriosis in burbot Lota lota
61
Fig. 3. Lota lota. Histological tissue sections of mycobacteria infected burbot sampled from Lake Mjøsa, showing lesions in (A) heart, (B) liver and (C) spleen tissues. The granulomas on these tissues are well encapsulated with thick (multi-layered) tissue and a necrotic centre. (D) shows granulomas in ZN-stained spleen tissue with a large number of acid-fast bacilli
bot from Lake Mjøsa compared to Lake Losna. Infected fish displayed external and internal, macroscopically and histologically detectable lesions consistent with a long standing infection. Although further variation in environmental conditions must exist between the 2 lakes, the obvious anthropogenic difference relates to the high levels of environmental pollution in Lake Mjøsa compared to Lake Losna. Previous toxicological analysis of burbot from Mjøsa showed that the levels of PBDEs in this species of fish are extremely high, while the levels of PBDEs in burbot from Lake Losna are in the back-
ground range (Mariussen et al. 2008). Levels of polychlorinated biphenyls (PCBs) and dichloro-diphenyltrichloroethane (DDTs) were also 10 and 15 times higher, respectively, in burbot from Lake Mjøsa compared to Lake Losna, while PBDE levels were 200 times higher in Mjøsa (Gregoraszczuk et al. 2008). Lake Mjøsa is surrounded by 3 cities, industrial areas and farmland. Sources of contamination include sewage, industrial effluents and flood waters from the surrounding area (Løvik et al. 2009). Although it might be tempting to speculate that the difference in mycobacteriosis prevalence (and incidence of granulomas in general) between the 2 separate burbot populaTable 1. Lota lota. Summary of experimental results in burbot sampled from Lakes Mjøsa and Losna. Gross and histopathological examinations relate to the tions may be caused by immunoprevalence of visceral granulomatosis. Real-time PCR relates to positive (threshsuppression related to environmental old cycle number < 35) Mycobacterium-specific real-time PCR on fish spleen tispollution, especially in view of the sues. Culture results relate to positive culture of M. salmoniphilum on Middlestrong association between prevalence brook 7H10 from kidney homogenates, and ZN staining relates to observation of acid fast rods in tissue sections. In each case, the number of positive fish out of and pollution levels, it is not possible to total fish examined is shown conclude this from the present study. More extensive studies are therefore Sampling Gross HistoReal-time Culture ZN required to confirm or disprove the area pathology pathology PCR staining association between pollution and mycobacterial infection. Mortality attribLake Mjøsa 20/58 33/44 14/40 11/58 6/33 uted to mycobacteriosis in wild finfish Lake Losna 0/30 2/11 2/30 1/30 0/2 populations is difficult and expensive
62
Dis Aquat Org 95: 57–64, 2011
a) 16S rRNA
100 M. senegalense CIP104941T (AY457081) 57 M. farcinogenes NCTC10955T (AY457084)T M. fortuitum CIP104534T (AY457066)
b) rpoB
M. senegalense CIP104941T (AY262738) M. farcinogenes NCTC10955T (AY262742) M. fortuitum CIP104534T (AY147165) 87 M. peregrinum CIP105382T (AY147166) 98 66 M. septicum ATCC700731T (AY147167) M. wolinskyi ATCC700010T (AY262743) M. phocaicum CIP108542T (AY859693) 100 M. mucogenicum ATCC49650T (AY147170) M. bolletii CIP108541T(AY859692) 96 100 79 M. abscessus CIP104536T (AY147164) M. immunogenum CIP06684T (EU109285) M. chelonae CIP104535T (AY147163) M. salmoniphilum TRA (DQ866795) 100 86 M. salmoniphilum SIL (DQ866793) M. salmoniphilum MON (DQ866794) 99 M. salmoniphilum BAN (DQ866792) 62 78 M. salmoniphilum ELK (DQ866796) M. salmoniphilum ATCC13757 (DQ866791) 84 M. salmoniphilum AUS (DQ866797) NVI6601 NVI6590 99 80 NVI6591 NVI6592 NVI6593 87 99 NVI6594 NVI6608
M. wolinskyi ATCC700010T (AY457083)
100
56
M. mageritense CIP104973T (AY457076)
M. smegmatis ATCC19420T (AY457078) 59 M. septicum ATCC700731T (AY457070) M. peregrinum CIP105382T (AY457069) 66 M. porcinum CIP105392T (AY457077) 94 M. neworleansense ATCC49404T (AY012575) 100 M. mucogenicum ATCC49650T (AY457074) M. phocaicum CIP108542 (AY859682) 74 M. aubagnense CIP108543T (AY859683) M. salmoniphilum MON (DQ866767) M. salmoniphilum SIL (DQ866769) M. salmoniphilum BAN (DQ866765) M. salmoniphilum ATCC13758T (DQ866768) M. salmoniphilum MT1900 (EF535602) M. salmoniphilum NCIMB13533 (EF535601)
79
NVI6590
100
NVI6601 NVI6608 53
NVI6594 NVI6593 NVI6592
98 65
NVI6591 M. salmoniphilum ELK2 (DQ866766)
99 100
M. salmoniphilum AUS (DQ866764) M. salmoniphilum TRA (DQ866770)
NVI6609 M. salmoniphilum NCIMB13533 (EF536970) M. salmoniphilum ATCC13758T (DQ866790) M. leprae TN (AL583923) M. tuberculosis H37Rv (BX842574) 83
NVI6609 99
0.01 substitutions site–1
M. chelonae CIP104535T (AY457072) M. abscessus CIP104536T (AY457071) 78 M. bolletii CIP108541T (AY859681) M. immunogenicum CIP106684T (AY457080)
M. leprae TN (AL583920) M. tuberculosis H37Rv (BX842576) 0.001 substitutions site–1
c) Hsp65
79 M. peregrinum CIP105382T (AY458069) M. septicum ATCC700731T (AY458066) 85 M. porcinum CIP105392T (AY458068) M. neworleansense ATCC49404T (AY458076) M. smegmatis ATCC19420T (AY458065) 98 79 M. fortuitum CIP104534T (AY458072) M. senegalense CIP104941T (AY458067) 62 M. wolinskyi ATCC700010T (AY458064) M. mucogenicum ATCC49650T (AY458079) 99 M. phocaicum CIP108542T (AY859676) M. salmoniphilumAUS (DQ866778) 61 M. salmoniphilum TRA (DQ866783) 81 M. salmoniphilum SIL (DQ866782) M. salmoniphilum MON (DQ866781) 98 M. salmoniphilum BAN (DQ866779) M. salmoniphilum ELK (DQ866780) 96 M. salmoniphilum MT1900 (EF535604) 61 M. salmoniphilum NCIMB13533 (EF535603) NVI6608 NVI6609 85 NVI6594 NVI6593 81 66 NVI6592 71 53 NVI6591 NVI6590 100 58 NVI6601 M. salmoniphilum ATCC13758T (DQ866777) M. immunogenicum CIP106684T (AY458081) M. chelonae CIP104535T (AY458074) M. abscessus CIP104536T (AY458075) 98 M. bolletii CIP108541T (FJ607778) M. tuberculosis H37Rv (BX84257) M. leprae TN (AL583923) 0.005 substitutions site–1
Fig. 4. Phylogenetic relationships of Mycobacterium salmoniphilum isolated from burbot Lota lota (bold) to other Mycobacterium spp. based on (a) 16S rRNA, (b) rpoB and (c) Hsp65 genes. The neighbour-joining trees were constructed using the Kimura 3-parameter model used on aligned sequences. Numbers at nodes represent bootstrap values (1000 repetitions). M. tuberculosis and M. leprae were used as outgroups for all trees. GenBank accession numbers for sequences used to construct the trees are shown in parentheses. The bars indicate substitutions per nucleotide position
Zerihun et al.: Mycobacteriosis in burbot Lota lota
to prove conclusively but has been reported (Dalsgaard et al. 1992, Gauthier et al. 2008). While the overall effect on the burbot population of infection with M. salmoniphilum is not known, the relatively high prevalence identified in Lake Mjøsa may well have a detrimental effect on the population as a whole. Despite the small sample size, the negative test results of mycobacterial infection for the 10 pike analysed in the present study, as well as the results of previous pollutant studies (Gregoraszczuk et al. 2008, Mariussen et al. 2008), provide some support for the presumption that burbot, as a predatory and scavenging bottom-dwelling fish (Paakkonen & Marjomaki 2000), is more exposed to persistent environmental pollutants than other types of fish. The granulomas attributed to mycobacterial infection in the present study were composed of a thick capsule of epithelioid cells surrounding a necrotic centre, some of them with large numbers of acid-fast bacilli present, which is consistent with mycobacteriosis in many other fish species (Colorni et al. 1998, Talaat et al. 1998, 1999, Gauthier et al. 2003). The prevalence of histologically detectable granulomas was considerably higher than the prevalence of mycobacteriosis in fish studied here. Although mycobacteria were not cultured from all granulomatous lesions in this study, Mycobacterium salmoniphilum were cultured only from fish displaying granulomatous lesions, confirming the association of granulomatous lesions with mycobacteria. Granulomas caused by larval stages of the tapeworm Triaenophorus nodulosus were detected in a number of fish from Lake Mjøsa, mainly in the mesenteries and walls of the GIT. A number of histological sections displayed presence of the parasite within the granuloma, which could easily be differentiated from those granulomas associated with mycobacteria. The majority of granulomas with negative mycobacterial test results for culture, ZN staining, IHC and real-time PCR was formed in response to parasitic infections, e.g. tissue encapsulated larval stages of T. nodulosus. Granuloma encapsulation has only occasionally been noted in Mycobacterium salmoniphilum associated disease in salmonids (Bruno et al. 1998, Zerihun et al. 2011b), yet it appears to be a prominent feature of the disease in burbot. This may indicate that this type of response is more related to host species than mycobacterial species. Phylogenetic analysis of several genetic loci (16S rRNA, Hsp65 and rpoB) confirmed the identity of all isolates recovered during the study as Mycobacterium salmoniphilum (Whipps et al. 2007). However, the variation in ITS1 sequences suggests that more than one clone is involved. Furthermore, our phylogenetic analyses clearly distinguish M. salmoniphilum from
63
M. chelonae, thus corroborating support by Whipps et al. (2007) for the original proposal of M. salmoniphilum as a separate species by Ross (1960), which was not generally accepted at that time. The present study also provides further evidence for M. salmoniphilum as a disease-causing agent in teleost fish. To the best of our knowledge, all isolations of M. salmoniphilum have been made in association with disease in teleost fish and, until the present report, all isolations were related to salmonid fish species (Ross 1960, Bruno et al. 1998, Whipps et al. 2007, Zerihun et al. 2011b). Therefore, as far as we are aware, the present study is the first report of disease caused by M. salmoniphilum in a nonsalmonid species. The source of infection in this study is not established. In conclusion, the present study substantiates burbot, a cold-water fish, as a host species for mycobacteria, and Mycobacterium salmoniphilum as a mycobacterial species which can infect fish species other than salmonids. The high level of contamination detected in the fish from Lake Mjøsa may affect the immune system, leading to the increased prevalence of mycobacterial infection. Further investigation will be needed to determine prevalence of M. salmoniphilum in other fish species and environmental samples in the 2 lakes.
Acknowledgements. The authors are grateful to the pathology laboratory staff at the National Veterinary Institute for processing tissue sections. This study was supported by the Norwegian Research Council, project no. 1588823.
LITERATURE CITED
➤ Adékambi T, Colson P, Drancourt M (2003) rpoB-based iden➤
➤
➤
tification of non-pigmented and late-pigmenting rapidly growing mycobacteria. J Clin Microbiol 41:5699–5708 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSIBLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402 Arakawa CK, Fryer JL (1984) Isolation and characterization of a new subspecies of Mycobacterium chelonei infectious for salmonid fish. Helgol Meeresunters 37:329–342 Begenal TB, Tesch FW (1978) Methods for assessment of fish production in fresh waters. In: Begenal TB (ed) Age and growth. Blackwell Scientific Publications, Oxford, p 101–136 Bruno DW, Griffiths J, Mitchell CG, Wood BP, Fletcher ZJ, Drobniewski FA, Hastings TS (1998) Pathology attributed to Mycobacterium chelonae infection among farmed salmon and laboratory infected Atlantic salmon Salmo salar. Dis Aquat Org 33:101–109 Chinabut S (1999) Mycobacteriosis and nocardiosis. In: Woo TK, Bruno DW (eds) Fish diseases and disorders, Vol 3. Viral, bacterial and fungal infections. CAB International, New York, NY, p 319–340 Cohen DM, Inada T, Iwamoto T, Scialabba N (1990) FAO species catalogue, Vol 10. Gadiform fishes of the world (Order Gadiformes). An annotated and illustrated cata-
64
➤
➤ ➤ ➤
➤
➤
➤
➤ ➤
➤
Dis Aquat Org 95: 57–64, 2011
logue of cods, hakes, grenadiers and other gadiform fishes known to date. FAO Fish Synop 10 (125). FAO, Rome Colorni A, Avtalion R, Knibb W, Berger E, Colorni B, Timan B (1998) Histopathology of sea bass (Dicentrarchus labrax) experimentally infected with Mycobacterium marinum and treated with streptomycin and garlic (Allium sativum) extract. Aquaculture 160:1–17 Dalsgaard I, Mellergaard S, Larsen JL (1992) Mycobacteriosis in cod (Gadus morhua L.) in Danish coastal waters. Aquaculture 107:211–219 Gauthier DT, Rhodes MW, Vogelbein WK, Kator H, Ottinger CA (2003) Experimental mycobacteriosis in striped bass Morone saxatilis. Dis Aquat Org 54:105–117 Gauthier DT, Latour RJ, Heisey DM, Bonzek CF, Gartland J, Burge EJ, Vogelbein WK (2008) Mycobacteriosis-associated mortality in wild striped bass (Morone saxatilis) from Chesapeake Bay, USA. Ecol Appl 18:1718–1727 Gomila M, Ramirez A, Lalucat J (2007) Diversity of environmental Mycobacterium isolates from hemodialysis water as shown by a multigene sequencing approach. Appl Environ Microbiol 73:3787–3797 Gregoraszczuk EL, Milczarek K, Wójtowicz AK, Berg V, Skaare JU, Ropstad E (2008) Steroid secretion following exposure of ovarian follicular cells to three different natural mixtures of persistent organic pollutants (POPs). Reprod Toxicol 25:58–66 Hedrick RP, McDowell T, Groff J (1987) Mycobacteriosis in cultured striped bass from California. J Wildl Dis 23: 391–395 Kent PT, Kubica GP (eds) (1985) Public health mycobacteriology: a guide for the level III laboratory. US Department of Public Health & Human Services, Center for Disease Control, Atlanta, GA Løvik JE, Rognerud S, Fjeld E, Kjellberg G (2009) Mjøsa. Norsk Institutt for Vannforskning (NIVA). September report, available at hedmark.miljostatus.no/Mjosa_JSsnh. pdf.file Luna LG (1968) Manual of histologic staining methods of the Armed Forces Institute of Pathology. McGraw-Hill, New York, NY Lutz B (1992) Section 3. Mycobacteriology. In: Isenberg HD (ed) Clinical microbiology procedures handbook, Vol 1. American Society for Microbiology, Washington, DC, p 1–29 MacKenzie K (1988) Presumptive mycobacteriosis in Northeast Atlantic mackerel, Scomber scombrus L. J Fish Biol 32:263–275 Mariussen E, Fjeld E, Breivik K, Steinnes E, Borgen A, Kjellberg G, Schlabach M (2008) Elevated levels of polybrominated diphenyl ethers (PBDEs) in fish from Lake Mjøsa, Norway. Sci Total Environ 390:132–141 Neefs JM, Van de Peer Y, De Rijk P, Chapelle S, De Wachter R (1993) Compilation of small ribosomal subunit RNA structures. Nucleic Acids Res 21:3025–3049 Nigrelli RF, Vogel H (1963) Spontaneous tuberculosis in fishes and other cold-blooded vertebrates with special reference to Mycobacterium fortuitum Cruz from fish and human lesions. Zoologica 48:131–143 Editorial responsibility: David Bruno, Aberdeen, UK
➤ Paakkonen JPJ, Marjomaki TJ (2000) Feeding of burbot, Lota ➤
➤
➤
➤
➤
➤
➤
ä
lota, at different temperatures. Environ Biol Fishes 58: 109–112 Polinski MP, Fehringer TR, Johnson KA, Snekvik KR and others (2010) Characterization of susceptibility and carrier status of burbot, Lota lota (L.), to IHNV, IPNV, Flavobacterium psychrophilum, Aeromonas salmonicida and Renibacterium salmoninarum. J Fish Dis 33:559–570 Pulliainen E, Korhnonen K, Kankaanranta L, Maeki K (1992) Non-spawning burbot on the northern coast of the Bothnian Bay. Ambio 21:170–175 Ross AJ (1960) Mycobacterium salmoniphilum sp. nov. from salmonid fishes. Am Rev Respir Dis 81:241–250 Roth A, Reischl U, Streubel A, Nauman L and others (2000) Novel diagnostic algorithm for identification of mycobacteria using genus-specific amplification of the 16S–23S rRNA gene spacer and restriction endonucleases. J Clin Microbiol 38:1094–1104 Stapanian MA, Paragamian VL, Madenjian CP, Jackson JR, Lappalainen J, Evenson MJ, Neufeld MD (2010) Worldwide status of burbot and conservation measures. Fish Fish 11:34–56 Steingrube VA, Gibson JL, Brown BA, Zhang Y, Wilson RW, Rajagopalan M, Wallace RG Jr (1995) PCR amplification and restriction endonuclease analysis of a 65-kilodalton heat shock protein gene sequence for taxonomic separation of rapidly growing mycobacteria. J Clin Microbiol 33: 149–153 Swofford DL (1998) PAUP*. Phylogenetic analysis using parsimony (and other methods), version 4. Sinauer, Sunderland, MA Talaat AM, Reimschuessel R, Trucksis M (1998) Goldfish, Carassius auratus, a novel animal model for the study of Mycobacterium marinum pathogenesis. Infect Immun 66: 2938–2942 Talaat AM, Trucksis M, Kane AS, Reimschuessel R (1999) Pathogenicity of Mycobacterium fortuitum and Mycobacterium smegmatis to goldfish, Carassius auratus. Vet Microbiol 66: 151–164 Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 25:4876–4882 Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA amplification for phylogenetic study. J Microbiol 173:697–703 Whipps CM, Butler WR, Pourahmad F, Watral VG, Kent ML (2007) Molecular systematics support the revival of Mycobacterium salmoniphilum (ex Ross 1960) sp. nov., nom. rev., a species closely related to Mycobacterium chelonae. Int J Syst Evol Microbiol 57:2525–2531 Zerihun MA, Hjortaas MJ, Falk K, Colquhoun DJ (2011a) Immunohistochemical and Taqman real-time PCR detection of mycobacterial infections in fish. J Fish Dis 34: 235–246 Zerihun MA, Nilsen H, Hodneland S, Colquhoun DJ (2011b) Mycobacterium salmoniphilum infection in farmed Atlantic salmon Salmo salar. J Fish Dis (in press) Submitted: January 19, 2011; Accepted: February 16, 2011 Proofs received from author(s): May 13, 2011
IV IV
doi:10.1111/j.1365-2761.2012.01349.x
Journal of Fish Diseases 2012, 35, 365–377
Experimental mycobacteriosis in Atlantic cod, Gadus morhua L. M A Zerihun1, D J Colquhoun1 and T T Poppe2 1 Norwegian Veterinary Institute, Oslo, Norway 2 The Norwegian School of Veterinary Science, Oslo, Norway
Abstract
Piscine mycobacteriosis causes losses in a number of fish species both in the wild and in aquaculture worldwide. Mycobacterium salmoniphilum infections have on several occasions been reported in farmed Atlantic salmon, Salmo salar L. The present study tested and confirmed the susceptibility of Atlantic cod, Gadus morhua L., an important yet relatively novel aquaculture species, to infection with M. salmoniphilum. Atlantic cod injected intraperitoneally with a suspension of this bacterium were maintained together with cohabitant (COH) fish in a flow-through marine water system at 10–11 C. The fish were supervised daily and samples taken at 2, 7, 14, 23, 34 and 53 weeks post-infection and examined pathologically, bacteriologically and using molecular biology. Injected mycobacteria were re-isolated in high concentrations from both injected and COH fish groups. Death attributable to mycobacterial infection was observed in both injected (47%) and COH (28%) fish groups. Extensive development of granuloma in visceral organs, mainly the mesenteries, spleen, kidney and liver (lesser extent) and at later stages of the infection in heart tissues and gills, was observed in both injected and COH fish. Granulomas underwent a temporal progression of distinct morphological stages, culminating in well-circumscribed lesions surrounded by normal or healing tissue. Acid-fast bacilli were detected in both granulomas and nongranulomatous tissues. This study confirms that Atlantic cod is highly susceptible to M. salmoniphilum infection and that this bacterial species may be Correspondence M A Zerihun, Norwegian Veterinary Institute, pb 750 Sentrum, 0106 Oslo, Norway (e-mail: adam.zerihun@ vetinst.no)
2012 Blackwell Publishing Ltd
365
a threat to cod both in the wild and in the aquaculture. Keywords: Atlantic cod, granuloma, mycobacteriosis, Mycobacterium salmoniphilum.
Introduction
While Barents Sea populations of Atlantic cod, Gadus morhua L., are currently thriving (ICES 2008), the northern Atlantic population as a whole appears to be in a general decline (Brander 2007). Although currently struggling with financial losses and disease problems (Olsen, Mikalsen, Rode, Alfjorden, Hoel, Straum-Lie, Haldorsen & Colquhoun 2006; Standal & Utne 2007), Atlantic cod farming remains a prospectively important aquaculture industry to the countries in the northern Atlantic region. As with all novel domesticated species, production of cod has resulted in the identification of novel diseases, for example francisellosis (Alfjorden, Jansson & Johansson 2006; Olsen et al. 2006; Zerihun, Feist, Bucke, Olsen, Tandstad & Colquhoun 2011c). Undoubtedly, further development of intensive cod farming will lead to the emergence of more new diseases. While mycobacteriosis, caused by a range of different Mycobacterium species, is commonly reported in a number of commercially or recreationally important fish species (Ross 1960; Backman, Ferguson, Prescott & Wilcock 1990; Tortoli, Bartoloni, Bozzetta, Burrini, Lacchini, Mantella, Penati, Simonetti & Ghittino 1996; Mohney, Poulos, Brooker, Cage & Lightner 1998; Astrofsky, Scherenzel, Buliss, Smolowits & Fox 2000; Levi, Bartell, Gandolfo, Smole, Costa, Weiss, Johnson, Osterhout & Herbst 2003; Rhodes, Kator, Kotob,
M A Zerihun et al. Mycobacteriosis in Atlantic cod
Journal of Fish Diseases 2012, 35, 365–377
van Berkum et al. 2003; Rhodes, Kator, McNabb, Deshayes, Ottinger et al. 2005; Sakai, Kono, Tassakka, Ponpornpisit, Areechon, Katagiri, Yoshida & Endo 2005; Stine, Baya, Salierno, Kollner & Kane 2005; Chang, Hsieh, Chang, Shen, Huang, Tu, Chen, Wu & Tsai 2006; Whipps, Butler, Pourahmad, Watral & Kent 2007), to the best of our knowledge, only a single report relating to wild Atlantic cod, in polluted Danish coastal waters, exists (Dalsgaard, Mellergaard & Larsen 1992). In recent years, several outbreaks of systemic infection with Mycobacterium salmoniphilum (M. chelonae) have been reported in sea-farmed Atlantic salmon (Bruno, Griffiths, Mitchell, Wood, Fletcher, Drobniewski & Hastings 1998; Brocklebank, Raverty & Robinson 2003; Zerihun, Nilsen, Hodneland & Colquhoun 2011a), indicating the presence of this bacterium in the same marine environments in which cod are actively farmed. To assess the threat of infection with M. salmoniphilum to farmed cod, the present study was performed to elucidate the virulence and pathogenicity of the bacterium in this fish species. Materials and methods
(OADC) enrichment (MDA). All tank effluents were treated for a minimum contact time of 20 min with hypochlorite at a diluted final concentration of 100 mg L)1.
Preparation of mycobacterial suspension for injection Mycobacterium salmoniphilum isolate NVI6598 used in this study was isolated from an outbreak of disease in farmed Atlantic salmon in Norway and characterized using traditional culture, biochemical tests and phylogenetic analyses (Zerihun et al. 2011a). The mycobacterial isolate was grown on MDA at 22 C for 7 days and inoculated into 45 mL of Middlebrook 7H9 medium with OADC enrichment and 0.05% polyoxyethylenesorbitan monooleate (Tween 80) (MDB). The inoculated broth cultures were incubated at the same temperature on a shaker for 10 days. The bacterial cell suspension was then washed twice with Butterfields phosphate buffer (PB), adjusted to OD540 0.3 (107 mL)1) and 0.5 (109 mL)1) and used as low and high doses, respectively.
Experimental fish A total of 194 Atlantic cod with an initial average weight of 82 g were transferred from a hatchery (western Norway) to a seawater research facility at Solbergstrand (south–eastern Norway) and allowed to acclimatize for 3 weeks in a single tank. After the end of the acclimatization period, six fish were killed using a lethal dose of tricaine methane sulphonate (MS-222; Sigma-Aldrich) and necropsied, and samples were taken to assess the general health status of the stock using the histopathological, bacteriological and molecular methods described below. Following the initiation of the experiment, the fish were split into treatment and control groups and were held in two 1300-L capacity tanks, supplied with sea water at a rate of 300 L h)1. The water temperature in both tanks was between 10 and 11 C throughout the experiment. Fish were fed with a commercial diet using an automatic feeder. The tanks were illuminated with fluorescent light to represent a natural photoperiod. Repeated water samples from the tanks prior to fish introduction did not show mycobacterial growth on Middlebrook 7H10 agar supplemented with Bacto Middlebrook oleic acid-albumin-dextrose-catalase 2012 Blackwell Publishing Ltd
366
Infection Fish were anaesthetized with MS-222 (0.06 mg L)1) and injected intra-peritoneally (i.p.) with 0.3 mL bacterial suspension of either OD540 = 0.3 or OD540 = 0.5 for low dose (LD) and high dose (HD), respectively. Cohabitant (COH) and control fish were injected with the same volume of BP. LD, HD and COH fish were group-marked with alcian blue (Panjet) on the ventral aspect of the body and held in a single 1300-L tank. Marking was repeated 6 months post-infection to avoid possible fading. The control fish were held in a separate tank. The fish groups comprised 45 fish in each of the LD and HD groups, 64 fish in the COH group and 32 in the control group. Sampling interval Fish were sampled at 2, 7, 14, 23, 34 and 53 weeks post-infection (p.i.). One to seven fish were sampled from each group at each sampling point. Sampled fish were killed using a lethal dose of MS-222. After aseptic necropsy and gross examination, samples were taken for histopathological, bacteriological and molecular investiga-
M A Zerihun et al. Mycobacteriosis in Atlantic cod
Journal of Fish Diseases 2012, 35, 365–377
tions. Dead fish were collected and recorded during the daily supervision and processed as described for killed fish. Clinical observation and gross examination Experimental fish were supervised on a daily basis by the staff at the research station. Dead fish were kept at )18 C until necropsy. All killed and dead fish were necropsied and closely examined both externally and internally. Condition factor (CF) was calculated as CF = (W · 100) · L)3 with W = body weight (g) and L = length (cm) (Bagenal & Tesch 1978). Mortality was calculated monthly starting from week 6 p.i. (10 weeks after week 35). Numbers of dead fish are given as percentage of total fish present at calculation points in each group (Fig. 1). Histopathology
Death rate in percent
Fish tissues were fixed in 10% phosphate-buffered formalin for at least 24 h prior to processing. Samples of gills, heart, head kidney, liver, spleen, mesenteries, skin/muscle and, occasionally, other tissues with visible pathological lesions were processed routinely for histology (Prophet, Mills, Arrington & Sobin 1994). Sections were cut at 5 lm and stained with haematoxylin and eosin (H&E) (Luna 1968). Parallel sections were stained using Ziehl–Nelseen (ZN) staining. Selected tissue sections were also tested using the anti-genus Mycobacterium and anti-Francisella noatunensis immunohistochemical assays described by Zerihun, Hjortaas, Falk & Colquhoun (2011b) and Zerihun et al. (2011c). Mortality
120
COH
100
LD
80
HD
60 40 20 0
2
6
10
14
18
22
26
30
35
45
Post inoculation interval (weeks)
Figure 1 Development of mortality in Atlantic cod, intraperitoneally injected with a suspension of Mycobacterium salmoniphilum (LD and HD, 45 fish each), and sham-injected cohabitant fish (COH, 64 fish) held together in a single tank. Each curve shows percentage mortality at each indicated time point. Fish groups are abbreviated: COH, cohabitant fish group; LD, lowdose group; HD, high-dose group. 2012 Blackwell Publishing Ltd
367
Bacteriology Fish killed at selected exposure intervals and dead fish were aseptically necropsied. Approximately 0.2 g of tissues from head kidney, spleen and mesenteries together with pyloric caeca was removed and transferred into sterile tubes with metal beads (Bertin Technologies). Butterfields PB (1 mL) was added and the tissues homogenized using a MagNA Lyser (Roche Ltd). Parallelcultured blood agar with 2% sodium chloride (BAS) and without salt (BA) and MDA were spread-plated with 100 lL tissue homogenate. Blood agar and MDA plates were incubated at 22 C and BAS at 15 C. A serial dilution of 101–102 was prepared and cultured in parallel to assess (subjective) bacterial concentration in fish tissues, dilute possible contamination and minimize overgrowth by other bacterial flora. Representative ZN-positive colonies from each group of fish and sampling point were tested using standard methods (Kent & Kubica 1985; Le´vy-Fre´bault & Portaels 1992). DNA extraction, PCR amplification and sequencing Approximately half of the 101 spleen tissue homogenate (500 lL) prepared for bacterial culture, as mentioned previously, was taken into FastProtein Blue, 500 lL PB was added and homogenized twice for 45 s each at 3779 g using MagNA Lyser. For the confirmation of cultured colonies, two full inoculating loops (10 lL) of bacterial cells were emulsified in 1 mL PB into FastProtein Blue and homogenized as described above. DNA was extracted from tissues and bacterial homogenates using a QuickExract DNA Extraction Kit (Epicenter Biotechnologies) and procedures recommended by the manufacturer. Conventional PCR amplification of an approximately 650 base pairs (bp) fragment of the RNA polymerase beta subunit (rpoB) gene and subsequent sequencing was conducted on the representative mycobacterial colonies from each sampling point and fish group using primers described by Ade´kembi, Colson & Drancourt (2003). PCR products were purified using the QIA quick PCR Purification Kit (Qiagen GmbH), and sequencing performed using the ABI Big Dye Terminator Cycle Sequencing Ready Reaction Kit v3.1, using the ABI PRISM 3100 Genetic Analyser
M A Zerihun et al. Mycobacteriosis in Atlantic cod
Journal of Fish Diseases 2012, 35, 365–377
(Applied Biosystems). Obtained sequences were analysed using BLAST search analysis (Altschul, Madden, Schaffer, Zhang, Zhang, Miller & Lipman 1997). Real-time PCR was conducted on spleen tissue samples taken from all COH fish at each sampling point. The primers, probes and the procedures were as described earlier (Zerihun et al. 2011b).
Histological characterization and scoring of granulomatous lesions Parallel tissue sections stained using H&E and ZN stains were examined from each organ and staging of granuloma based on morphological characteristics and distribution in tissues was conducted basically as described by Talaat, Reimschuessel, Wasserman & Trucksis (1998), Reimschuessel, Bennett & Lipsky (1992) and Gauthier, Rhodes, Vogelbein, Kator & Ottinger (2003). Granulomas in the present study were categorized into five developmental stages, essentially similar to those of Gauthier et al. (2003): Stage I granuloma (I): loosely organized inflammatory cells containing few to no acid-fast bacilli. Lesions are observed to be few in number. Stage II granuloma (II): granuloma composed of inflammatory cells surrounding epithelioid cells. Necrotic debris may be observed in the core. Low numbers of acid-fast bacilli and multi-focal lesion distribution may be characteristic. Stage III granuloma (III): a thickened, flattened, spindle-shaped cell layer separates a necrotic core that is surrounded by epithelioid cells. Acid-fast bacilli are rarely observed. The lesions are multifocally distributed with half of the examined tissue affected. Stage IV granuloma (IV): this type of lesion is basically the same as stage III, but the spindle cell layers may be thicker. Acid-fast bacilli are abundantly seen in the core. Normal tissues may be barely recognizable. Stage V granuloma (V): diffusely distributed granulomatous lesion (majority of the lesions are separated by a thin layer of flattened, spindleshaped cells). The granulomatous lesions are dominated by eosinophilic cells (some with pyknotic nuclei) and foamy eosinophilic debris. Acid-fast bacilli are rarely seen. Almost all normal tissue may be replaced by the lesion. 2012 Blackwell Publishing Ltd
368
Results
Clinical features A number of i.p. injected (LD and HD fish groups) and sham-injected COH fish became anorexic, dark skinned and emaciated from week 10 and 30 p.i., respectively. These fish displayed a sluggish movement on the surface and side of the tank, and dead fish were found to have pale gills (anaemia). The average CF of dead fish was below the average of fish sampled at regular sampling points.
Gross pathology The most significant lesions recorded in infected fish were greyish-white granulomas (2–5 mm in diameter), mostly of a miliary type, in spleen, head kidney and to a lesser degree the liver. Nodular red foci were grossly visible in the mesenteries of both LD and HD fish groups at week 14 p.i. These foci appeared to reach peak intensity at week 23, at which point the entire mesentery was hardened and fused into a solid mass. Numerous adhesions between this mass and the body wall were observed from this time point onward. Marbling of the liver and roughing of the spleen surface were observed in almost all LD and HD fish sampled at 2 and 7 weeks p.i. Injected (LD and HD) fish sampled at 23 weeks p.i. and onward showed friable spleen and head kidney with buffcoloured or grey nodules. These organs were extremely enlarged. Internal gross lesions displayed by COH fish included marbling (multiple nodular red foci) of the liver in 67% of fish sampled at week 23 and miliary granulomas on spleen and head kidney in 23% of fish sampled at week 53 p.i. An extreme enlargement of spleen and kidney was also observed in this treatment group. Skin erosion and fin rot were observed in a considerable number of fish from HD, LD and COH groups during the first three sampling points. Furthermore, exophthalmia (five fish from LD and HD and six fish from COH), vertebral deformation (five fish from LD and HD and two fish from COH) and ascites (six fish from LD and HD and one fish from COH) were observed between weeks 22 and 53 p.i. Control fish appeared healthy and did not show significant internal or external lesions at any time during the study period.
Journal of Fish Diseases 2012, 35, 365–377
Mortality A total of 23 (51%), 19 (42%) and 18 (28%) mortalities were recorded in the HD, LD and COH fish groups, respectively, during the study period. The first deaths were recorded 6 weeks p.i. in both HD and LD fish groups and 22 weeks p.i. in the COH group (Fig. 1). The high mortality in the injected fish groups resulted in a shortage of fish from these groups during the last sampling point (53 weeks p.i.). Most of the fish dying before week 22 showed non-specific lesions including dermal and visceral petechia and ulcerative lesions on the abdominal surfaces. Those fish dying after 22 weeks p.i. from LD and HD groups and those at and after week 35 p.i. from the COH group displayed severe miliary granulomas on spleen, head kidney and to a lesser extent liver. In some of the dead fish, the viscera were fused together with the mesenteries into a solid mass. Histopathology Granulomas in M. salmoniphilum-infected fish underwent a series of morphologically distinct developmental stages in relation to time postinfection (Fig. 2 and Table 1). Prevalence and development of granulomas in both LD and HD fish groups were generally similar, and histological results are therefore presented as a single group. Tissue sections from skin/ muscle were examined from all sampled fish throughout the experiment, and no considerable pathological changes were observed in these tissues. The results are therefore not shown. Granulomas of all stages of development more or less obliterating the atrium, ventricle and bulbus arteriosus were observed in all infected fish from injected and COH groups starting week 34 postinfection (Fig. 3). The atrium and bulbus arteriosus of the heart were more affected than the ventricles. Anti-genus Mycobacterium immunohistochemistry conducted on selected tissue sections revealed both intra- and extracellular mycobacteria more efficiently than ZN staining. The anti-Francisella immunohistochemistry conducted on selected tissue sections from each sampling point did not reveal the presence of Francisella spp. Intraperitoneally infected fish (LD and HD) Two weeks after i.p. injection, aggregations of inflammatory cells (stage I) (Fig. 2a) and stage II 2012 Blackwell Publishing Ltd
369
M A Zerihun et al. Mycobacteriosis in Atlantic cod
granulomas were observed in the mesenteries and liver tissues of 6/12 fish. Stage III granulomas were also observed in the mesenteries of 3/12 fish. Acid-fast bacilli were detectable as single or small clumps in the centre of stage II granulomas in the mesenteries. With the exception of an increase in macrophage-like cells in spleen and head kidney, no other lesions were displayed in these organs 2 weeks p.i. Few extraand intracellular (within the macrophage-like cells) acid-fast bacilli were detected. Extensive development of granulomas ranging between stages I and IV (mostly stage III granulomas) was observed in head kidney, spleen, mesenteries and to lesser extent liver in 9/12 fish at week 7 p.i. Stage IV granulomas were seen in mesenteries (one fish) in spleen (two fish) and in head kidney (four fish) with abundant acid-fast bacilli in the centre of the granulomas (Fig. 2e). At week 14, stage IV granulomas were seen in the mesenteries, spleen, head kidney and liver of almost all sampled (11) fish and stage V granulomas in liver tissues of two fish. Almost all sampled fish (6–8/8) displayed granuloma stages IV and V in the mesenteries, spleen, head kidney and liver (Fig. 4) at week 23 p.i. At week 34, all sampled fish (5) displayed the same types of lesions in the same organs as at week 23. Granulomas (stages II–IV) were seen in the heart tissue of three fish and in the gills of four fish at week 34 p.i. for the first time in this study. Cohabitant group With the exception of stage I granulomas in the liver, spleen and mesenteries of a few fish, no other lesions were observed prior to week 34 p.i. At week 34 stage II granulomas were observed in the mesenteries of 1/7 fish and spleen and head kidney of 6/7 fish. At week 53 p.i., granulomatous lesion stages ranging between III and V were displayed by 23–31% of the sampled fish in all of the examined organs, including mesenteries, liver, head kidney, heart and gills (Table 1). Bacteriology Mycobacterium salmoniphilum was cultured from all i.p. challenged (LD and HD) fish at all sampling points. Mycobacterium salmoniphilum was also cultured from COH fish from week 14 p.i. (5/7). A total of 4/6, 7/7 and 13/13 fish were culture
M A Zerihun et al. Mycobacteriosis in Atlantic cod
Journal of Fish Diseases 2012, 35, 365–377
(a)
(b)
(c)
(d)
(e)
(f)
Figure 2 Progression of granulomas in visceral organs of Atlantic cod infected with Mycobacterium salmoniphilum. (a) Stage I granuloma in liver tissue. (b) An early stage II granuloma, heart tissue. (c) Stage III granuloma with demarcated epithelioid and spindle cell layers, head kidney. (d) Stage IV granuloma with debris in core and spindle cell layers at periphery, spleen tissue. (e) Stage IV granuloma with abundant acid-fast bacilli and cell debris in core, spleen tissue. (f) An early stage V granuloma, replacing liver tissue, foamy debris or cells with pyknotic nuclei, is composed of the core. All panels stained with H&E, except panel c (Ziehl–Nelseen stain).
positive at sampling points 23, 34 and 53 weeks p.i., respectively, from this fish group. Primary cultures from spleen, head kidney and mesentery tissue homogenates diluted at 102 displayed confluent and nearly pure mycobacterial growth in almost all LD and HD fish groups on MDA. The same growth pattern was observed in more than 60% of culture-positive COH fish sampled at 53 week p.i., whereas growth in culture-positive COH fish sampled at 14, 23 and 34 weeks p.i. was characterized by non 2012 Blackwell Publishing Ltd
370
confluent countable colonies, using undiluted (101) tissue homogenates. Blood agar plates, cultured parallel to mycobacteria-positive MDA plates displayed mycobacterial colonies with highly depressed growth rate compared with growth on MDA. No other recognized pathogens were observed, and the few non-mycobacteria cells were considered common aquatic representatives of bacterial flora (not classified further). Occasional fungal growth was observed.
M A Zerihun et al. Mycobacteriosis in Atlantic cod
Journal of Fish Diseases 2012, 35, 365–377
Table 1 Distribution and progression of histological granuloma in Atlantic cod experimentally infected with Mycobacterium salmoniphilum. Organs were assigned to granuloma stages (I–V) based on the most advanced lesion observed in sections. Number of fish (organs) displaying a particular granuloma stage at each sampling point is presented. Stage descriptions are as given in the Materials and methods section MES Tissue
Week p.i. 2
7
14
23
34
53c
L
SPL
HK
H
G
LD and HD
COH
LD and HD
COH
LD and HD
COH
LD and HD
COH
– – – – – – – 10 2 – – – – 11 – – – – 4 4 – – – 2 3 ns ns ns ns ns
2 – – – – – – – – – – – – – – – – – – – – 6 – – – 3 – 3 3 3
– – – – – a – – 7 4 – – – – 11 – – – – 4 4 – – – 3 2 ns ns ns ns ns
– – – – – – – – – – – – – – – – – – – – – 6 – – – – – – 3 4
– – – – – – – – – – – – – – – – – – – – – – – 3 – ns ns ns ns ns
– – – – – – – – – – – – – – – – – – – – – – – – – – – 3 3 –
– – – – – – – – – – – – – – – – – – – – – – – 4 – ns ns ns ns ns
– – – – – – – – – – – – – – – – – – – – – – – – – – – 1 3 –
Fish group
Lesion stage
LD and HD
I II III IV V I II III IV V I II III IV V I II III IV V I II III IV V I II III IV V
1 6 3 – – – – 9 1 – b – – – 7 – – – – 4 2 – – – 1 4 ns ns ns ns ns
COH
COH
LD and HD
2 – – – – 1 – – – – – – – – – – – – – – – 1 – – – – – 1 3 3
4 3 – – – – 3 5 – – – – – 9 2 – – – 2 6 – – – 3 2 ns ns ns ns ns
5 – – – – 6 – – – – 2 – – – – 6 – – – – – – – – – – – 3 3 4
Tissue types and fish groups are abbreviated: G, gills; H, heart; HK, head kidney; SPL, spleen; MES, mesentery; COH, cohabitant group; HD, highdose group; LD, low-dose group; week p.i., weeks post-infection; ns, not sampled. a HK was lost from one fish before histology could be performed. b MES from four fish were not available for histology. c No fish were available from LD and HD fish groups at this sampling point.
(a)
Figure 3 Advanced lesions in Atlantic cod infected with Mycobacterium salmoniphilum. (a) Extensive development of stage IV & V granulomas in spleen 34 weeks postintraperitoneal injection. Entire parenchyma is replaced with granulomatous tissue (H&E). (b) Head kidney (from cohabitant fish 53 weeks post-infection) showing cellular debris and acid-fast bacilli in the cores of stage IV granulomas (Ziehl-Nelseen stain) (scale bars = 200 lm). (Correction added after online publication 9 March 2012: The legend of Figure 3 has been corrected.) 2012 Blackwell Publishing Ltd
371
(b)
Journal of Fish Diseases 2012, 35, 365–377
(a)
(b)
v
b
All mycobacteria recovered from injected and COH fish were confirmed, using molecular and phenotypical examinations, to be M. salmoniphilum. No other mycobacteria were detected from experimental fish, including control fish, throughout the study. On the basis of our subjective assessment, the bacterial (growth) density on MDA was highest in mesenteries, lowest in spleen and intermediate in head kidney at 2 and 7 weeks p.i. The density in these organs became equally confluent after week 7 p.i. The density in the COH group was highest in head kidney and lowest in the mesenteries at all sampling points, that is, 14–53 weeks p.i. Polymerase chain reaction The real-time PCR conducted on spleen tissues of the cohabiting fish showed a positive amplification (Ct values between 11 and 36) in 0/6, 1/6, 3/7, 4/6, 7/7 and 13/13 at sampling points 2, 7, 14, 23, 34 and 53 weeks p.i., respectively. Fish with gross or histological granulomatous lesions displayed low Ct values (
