Mycosis fungoides: disease evolution and prognosis ...

Chapter 2

Mycosis fungoides: disease evolution and prognosis of 309 Dutch patients

Arch Dermatol. 2000 Apr; 136(4): 504-10

STUDY

Mycosis Fungoides Disease Evolution and Prognosis of 309 Dutch Patients Remco van Doorn, MD; Christian W. Van Haselen, MD; Pieter C. van Voorst Vader, MD; Marie-Louise Geerts, MD; Freerk Heule, MD; Menno de Rie, MD; Peter M. Steijlen, MD; Sybren K. Dekker, MD; Willem A. van Vloten, MD; Rein Willemze, MD Objectives: To determine the disease course of Dutch patients with mycosis fungoides and to define factors related to disease progression and survival. Design: A multicenter, 13-year, retrospective cohort

analysis. Setting: Eight dermatology departments collaborating in the Dutch Cutaneous Lymphoma Group. Patients: Three hundred nine patients with mycosis fun-

goides registered between October 1985 and May 1997, including 89 patients with limited patches or plaques (stage Ia), 135 with generalized patches or plaques (stage Ib), 46 with skin tumors (stage Ic), 18 with enlarged but uninvolved lymph nodes (stage II), 18 with lymph node involvement (stage III), and 3 with visceral involvement (stage IV). Main Outcome Measures: Response to initial treat-

ment, sustained complete remission, actuarial disease progression, and overall and disease-specific survival per clinical stage. Results: The median follow-up was 62 months (range, 1-113 months). For the entire group, the actuarial over-

From the Departments of Dermatology, Free University Hospital (Drs van Doorn and Willemze) and Academic Medical Center (Dr de Rie), Amsterdam, University Medical Center, Utrecht (Drs Van Haselen and van Vloten), University Hospital Groningen, Groningen (Dr van Voorst Vader), University Hospital Rotterdam, Rotterdam (Dr Heule), University of Nijmegen, Nijmegen (Dr Steijlen), and Leiden University Medical Center, Leiden (Drs Dekker and Willemze), the Netherlands; and University Hospital Gent, Gent, Belgium (Dr Geerts). Dr Willemze is now with the Department of Dermatology, Leiden University Medical Center, Leiden, the Netherlands.

M

all and disease-specific survival was 80% and 89% at 5 years, and 57% and 75% at 10 years, respectively. The actuarial 5-year disease-specific survival of patients with stage Ia, Ib, and Ic disease was 100%, 96%, and 80%, respectively, and only 40% for patients with stage III disease. Using multivariate analysis, the presence of extracutaneous disease, the type and extent of skin involvement, the response to initial treatment, and the presence of follicular mucinosis were independently associated with higher disease progression and mortality rates. The calculated risks of disease progression at 5 and 10 years gradually increased from 4% to 10% for those with stage Ia disease, from 21% to 39% for those with stage Ib disease, and from 32% to 60% for those with stage Ic disease; for those with stage III disease, the risk remained at 70% at 5 and 10 years. The overall risk of disease progression at 5 and 10 years was 24% and 38%, respectively, for the total study group. Conclusion: At least within the first 10 years after di-

agnosis, disease progression and mycosis fungoides– related mortality occur in only a subset of patients generally presenting with advanced disease. Arch Dermatol. 2000;136:504-510

YCOSIS fungoides (MF) is the most common type of cutaneous Tcell lymphoma (CTCL), with an estimated incidence of 0.5 per 100 000 per year in the 1 western world. According to the major textbooks, MF is an indolent type of CTCL that slowly evolves through patch, plaque, and tumor stages before lymph nodes and visceral organs become involved, and ultimately a rapidly progressive and fatal disease develops. Long-term follow-up studies2-14 on large groups of patients with MF are rare, and most come from a few USbased centers. Comparison of published series is often difficult, because of different inclusion criteria (eg, inclusion or exclusion of patients with large-plaque parapsoriasis) and an inconsistent use of the terms MF and CTCL. Several studies, including one of the largest European stud-

ARCH DERMATOL / VOL 136, APR 2000 504

ies of 92 Dutch patients published by Hamminga et al4 in 1982, included not only patients with classic MF but also patients with Se´zary syndrome and other types of CTCL defined more recently. For instance, patients with CTCL presenting with tumors with the histological appearance of a diffuse, large, T-cell lymphoma and without prior or concurrent patches or plaques were designated previously as having “MF d’emble´ e,” whereas such patients are now classified as having either CD30+ or CD30− large-cell CTCL, which are considered distinct disease entities separate from MF.15,16 It is well recognized that the evolution from skin-limited to widespread disseminated disease in patients with MF may take years or even decades. However, clinical experience also suggests that only a proportion of patients with MF presenting with only skin lesions will develop extracuta-

WWW.ARCHDERMATOL.COM

©2000 American Medical Association. All rights reserved. 33

PATIENTS AND METHODS

scribed previously.20 When indicated clinically, additional staging studies to determine visceral involvement were performed. The following variables were recorded: age; sex; clinical stage at the time of diagnosis; duration of skin lesions before diagnosis; type of initial therapy; whether there was complete remission after initial therapy; disease course after initial therapy; the date of disease progression, if applicable; and the date of last contact and cause of death, if applicable. In addition, the presence of follicular mucinosis in the first diagnostic biopsy specimen and the presence of lymphomatoid papulosis or B-cell neoplasms prior to, concurrent with, or following the development of MF were recorded. Complete remission on initial treatment was defined as complete disappearance of all skin lesions. In most cases, histological confirmation of complete remission was not obtained. No distinction was made between partial or no responses on initial therapy. For clinical course, distinction was made between sustained complete remission, defined as the total disappearance of all (extra) cutaneous lesions after initial therapy without subsequent relapse (without maintenance treatment); continued disease, disease without progression to a higher clinical stage; and disease progression, the development of skin tumors in patients with a previous patch or plaque (stage Ia-Ib), the development of histologically documented nodal involvement (stage III) in patients with previous skin-limited disease, the development of visceral involvement in patients with prior skin and/or lymph node involvement, and death due to MF. As indicators of survival, disease-specific survival, including only death related to MF as the event, and overall survival, including death due to any cause as the event, were investigated. Actuarial survival and disease progression curves were calculated from the date of diagnosis to the date of death or last contact and the date of disease progression, respectively, using the Kaplan-Meier technique.21 Patients lost to follow-up were considered to be censored at the time of last contact. Differences between survival and disease progression rates were analyzed using the log-rank test. Comparative analysis of groups of numerical variables was performed using 2-tailed t tests. P.05 was considered significant. Relative risks and 95% confidence intervals were determined using standard methods. Univariate analysis of possible prognostic factors was performed using the logrank test and Cox proportional hazards regression analysis. Multivariate analysis was performed by entering significant univariate variables for survival and disease progression in Cox proportional hazards regression analysis22 to establish their independence as prognostic factors. All analyses were performed using Statistical Product and Services Solutions software (SPSS Inc, Chicago, Ill).

Between October 1985 and May 1997, 345 patients with MF were included in the registry of the Dutch Cutaneous Lymphoma Group, and follow-up data had been collected yearly. For the present study, only patients with clinical and histological features consistent with MF, and who underwent a follow-up period of at least 12 months after histological confirmation of the diagnosis, unless death due to MF occurred earlier, were selected. Thirty-six patients were excluded because of insufficient clinical information or followup. The final study group comprised 309 patients. In each patient, the diagnosis had been made by an expert panel of dermatologists and pathologists at 1 of the quarterly meetings of the Dutch Cutaneous Lymphoma Group. The histological criteria for the diagnosis of early MF are essentially the same as those described by Nickoloff,17 and require the presence of hyperchromatic, slightly to markedly atypical lymphoid cells in the epidermis, either as single, often haloed, cells, or in a linear configuration at the dermalepidermal junction. Patients with patches or plaques clinically suspected, but histologically not diagnostic of MF, are included as a separate category in the Dutch registry and were not included in the present study, unless at a later point a definite diagnosis of MF was made. The time of the first diagnostic biopsy was taken as the time of diagnosis. The study group did not include patients with Se´zary syndrome, pagetoid reticulosis, or other CTCL, recognized as distinct entities in the European Organization for Research and Treatment of Cancer classification for primary cutaneous lymphomas.16 However, to allow comparison with other published series, patients with MF-associated follicular mucinosis, included as a distinct variant of MF in the European Organization for Research and Treatment of Cancer classification, were included. Association with follicular mucinosis was included as one of the variables in univariate and multivariate analyses of survival and disease progression. The stage of the disease was determined based on the type and extent of skin involvement and the presence of lymph node, visceral, or blood involvement according to a modification of the Fuks classification scheme,4,18 which can easily be translated into the TNM system19 (Table 1). Staging evaluation consisted of obtaining a complete medical history and a complete blood cell count and performing a physical examination, serum chemistry studies, and a skin biopsy. In the presence of lymphadenopathy, a lymph node biopsyand thoracic and abdominal computed tomographic scans were performed, and a chest x-ray film was obtained. Lymph node involvement was assessed throughout the study (1985-1997) with the same criteria, de-

neous and ultimately fatal disease. Whereas previous studies mainly focused on prognostic variables and survival data in the different stages of MF, data regarding the frequency of disease progression have been published only recently.10-13 Obviously, clinical information to patients with MF should not only include the message that disease progression may occur but also how often and after which period such a development can be expected. In the present study, clinical and follow-up data of all patients with MF included between October 1985 and May 1997 in the registry of the Dutch Cutaneous Lymphoma

Group were evaluated. This study determines diseasespecific and overall survival and the risk of disease progression for patients with different stages of MF and defines variables predictive of survival and disease progression. RESULTS

CLINICAL CHARACTERISTICS AT PRESENTATION Of the 309 patients included in this study, 72.5% had either stage Ia or Ib MF at the time of diagnosis, whereas



©2000 American Medical Association. All rights reserved.

34

Table 1. Clinical Stage of 309 Patients With MF at the Time of Diagnosis* Patches and Plaques Covering the Skin Surface Stage

10% (a)

10% (b)

Skin Tumor (c)

Erythroderma (d)

Total

89 0 1 0 90

135 9 7 0 151

46 7 8 3 64

0 2 2 0 4

270 18 18 3 309

MF confined to the skin (I) MF with dermatopathic lymphadenopathy (II) MF with lymph node involvement (III) MF with visceral involvement (IV) Total

*The clinical stage is given according to the modified Fuks classification.4 Translation into the TNM classification18 is as follows; Ia, T1 N0 M0; Ib, T2 N0 M0; Ic, T3 N0 M0; Id, T4 N0 M0; IIa through IId, T1 through T4 N1 M0; IIIa through IIId, T1 through T4 N3 M0; and IVa through IVd, T1 through T4 N0 through N3 M1. MF indicates mycosis fungoides.

Table 2. Patient Characteristics and Disease Outcome per Clinical Stage* Stage Variable No. of patients† Age at diagnosis, median (range), y Male-female ratio Duration of skin lesions before diagnosis, median (range), mo Complete remission on initial therapy Duration of follow-up, median (range), mo Disease course Sustained CR Continued disease Progression Risk of disease progression, % At 5 y At 10 y Current status Alive without disease Alive with disease Died of other cause Died of MF Disease-specific survival, % At 5 y At 10 y Overall survival, % At 5 y At 10 y

Ia

Ib

Ic

II

III

IV

All

89 (28.8) 58.0 (19-90)

135 (43.7) 61.0 (14-92)

46 (14.9) 67.5 (35-88)

18 (5.8) 62.5 (37-82)

18 (5.8) 57.5 (29-84)

3 (1.0) 67.0 (53-69)

309 (100) 61.0 (14-92)

59:30 60 (1-372)

83:52 48 (1-600)

29:17 48 (2-600)

13:5 24 (5-300)

2:1 24 (10-72)

196:113 48 (1-648)

42 (47)

41 (30)

12 (26)

71 (12-203)

70 (12-313)

48 (6-249)

16 (18) 69 (78) 4 (4)

10 (7) 92 (68) 33 (24)

5 (11) 23 (50) 18 (39)

4 10

21 39

32 60

65 65

70 70

39 (44) 41 (46) 7 (8) 2 (2)

29 (21) 71 (53) 22 (16) 13 (10)

5 (11) 14 (30) 12 (26) 15 (33)

1 (6) 10 (56) 4 (22) 3 (17)

1 (6) 5 (28) 1 (6) 11 (61)

0 (0) 0 (0) 1 (33) 2 (67)

100 97

96 83

80 42

68 68

40 20

0 0

89 75

99 84

86 61

65 27

49 49

40 20

0 0

80 57

10:8 48 (10-648) 2 (11) 45 (14-184) 1 (6) 8 (44) 9 (50)

0 (0)

98 (32)

49 (8-239)

2 (1-9)

62 (1-313)

1 (6) 6 (33) 11 (61)

0 (0) 1 (33) 2 (67)

1 (6)

100 ...

33 (11) 199 (64) 77 (25) 24 38 75 (24) 141 (46) 45 (15) 47 (15)

*Data are given as number (percentage) of patients within each column unless otherwise indicated. Percentages may not total 100 because of rounding. The clinical stages are explained in Table 1. CR indicates complete remission; MF, mycosis fungoides; and ellipses, data not applicable. †The row total was used to obtain the percentages.

Ia MF (67.5 vs 58.0 years; P.001). There was a male predominance, with a male-female ratio of 196:113, which is consistent with that of other large series.2,3,13 The duration of skin lesions before a definite diagnosis could be made varied between 1 month and more than 50 years (median, 48 months) and was significantly shorter in the 21 patients presenting with extracutaneous disease (median, 24 months) compared with patients with only skin lesions at presentation (median, 48 months) (P = .006). Of the 309 patients with MF, 32 (10.4%) had associated follicular mucinosis at the time of diagnosis. This

14.9% presented with 1 or more skin tumors in addition to patches and plaques, but no evidence of extracutaneous disease. Of the 309 patients, 270 (87.4%) had only skin lesions at the time of diagnosis; 18 (5.8%), enlarged but histologically uninvolved lymph nodes; and 21 (6.8%), nodal and/or visceral involvement (Table 2). Considering the entire group of patients, the age at diagnosis varied between 14 and 92 years (median, 61 years). Only 2 patients (0.6%) were younger than 20 years at the time of diagnosis. Patients presenting with stage Ic MF were significantly older than patients with stage ARCH DERMATOL / VOL 136, APR 2000 506



35

Table 3. Initial Treatment per Clinical Stage* Stage Initial Treatment

Ia (n = 89)

Ib (n = 135)

Ic (n = 46)

II (n = 18)

III (n = 18)

IV (n = 3)

All (N = 309)

15 (17) 51 (57) 14 (16) 6 (7) 0 3 (3) 0 0 47

11 (8) 89 (66) 15 (11) 10 (7) 7 (5) 2 (2) 0 1 (1) 30

0 9 (20) 0 4 (9) 6 (13) 21 (46) 4 (9) 2 (4) 26

0 7 (39) 0 0 1 (6) 5 (28) 2 (11) 3 (17) 11

0 0 0 1 (6) 4 (22) 2 (11) 10 (56) 1 (6) 6

0 0 0 0 0 1 (33) 2 (67) 0 0

26 (8) 156 (51) 29 (9) 21 (7) 18 (6) 34 (11) 18 (6) 7 (2) 32

Topical corticosteroids PUVA therapy UV-B therapy Topical mechlorethamine hydrochloride Total skin electron beam irradiation Radiotherapy with or without skin-directed therapy† Polychemotherapy with or without skin-directed therapy Other‡ Complete remission on initial treatment, %

*Data are given as number (percentage) of patients unless otherwise indicated. Column percentages may not total 100 because of rounding. The clinical stages are explained in the footnote to Table 1. PUVA indicates psoralen–UV-A. †Skin-directed therapies include topical corticosteroids, PUVA therapy, UV-B therapy, topical mechlorethamine hydrochloride, radiotherapy, or total skin electron beam irradiation. ‡Other therapies include monochemotherapy, retinoids, interferons, or combinations of these with skin-directed therapy.

group included 28 patients with stage I, 3 with stage II, and 1 with stage IV MF. The combination of MF—stage Ia in 2 and Ib in 6 patients—and lymphomatoid papulosis was noticed in 8 (2.6%) of the 309 patients. Associated B-cell lymphoproliferations were documented in 5 patients with stage Ia or Ib MF, including 4 with B-cell chronic lymphocytic leukemia and 1 with nodal follicular lymphoma.

10 years for the whole group of 309 patients was 89% and 75%, respectively; the 5- and 10-year overall survival was 80% and 57%, respectively. The survival rates according to clinical stage are presented in Table 2, Figure 1, and Figure 2. Consistent with prior reports,23,24 patients with MF and lymphomatoid papulosis had an excellent prognosis. None of these patients showed disease progression after a median follow-up of 158 months (range, 23-244 months).

TREATMENT AND FOLLOW-UP

PROGNOSTIC VARIABLES The initial therapies at the different stages of MF are listed in Table 3, and reflect the approach used in the treatment of MF in the Netherlands. The treatment modality most commonly used for stage Ia or Ib disease was psoralen–UV-A therapy (140 [62.5%] of 224 cases); less frequently used modalities included topical corticosteroids, UV-B therapy, topical mechlorethamine hydrochloride, and, in case of extensive skin lesions, total skin electron beam irradiation. Patients with stage Ic disease were treated similarly, often with additional local radiotherapy for persistent tumors (Table 3). Systemic polychemotherapy consisting of cyclophosphamide, vincristine sulfate, doxorubicine, and prednisone was mainly given to patients presenting with nodal (stage III) or visceral (stage IV) involvement, often in combination with or followed by skin-directed therapies. Initial treatment resulted in clinical complete remissions in 98 (31.7%) of 309 patients. However, in most patients, these complete remissions were short-lived. Sustained complete remissions on initial treatment were observed in only 33 (10.7%) of the 309 patients, among whom 26 had stage Ia or Ib disease. The disease-free survival in these 33 patients varied between 10 and 163 months (median, 68 months). In 199 (64.4%) of the 309 patients, there was continued disease without progression, typically having a fluctuating course, while in the remaining 77 (24.9%), disease progression, including death due to MF, occurred. The median follow-up was 62 months (range, 1-313 months). During that period, 92 of the 309 patients died, including 47 of MF. The disease-specific survival at 5 and

Univariate analysis of variables possibly influencing disease-specific survival in the entire group of 309 patients showed that the following factors were statistically significant: stage at diagnosis (P.001), including the presence of extracutaneous disease (P.001) and the type and extent of skin involvement (P.001); no complete remission on initial treatment (P.001); associated follicular mucinosis (P = .005); and older age (P = .01). Sex (P = .69) and duration of skin lesions before diagnosis (P = .34) were not significantly related to survival, when the total group was considered. Univariate analysis of the prognostic variables per clinical stage showed that only complete remission on initial treatment within the group of patients with stage Ib MF was significantly related to survival (P = .04) (Figure 3). Multivariate analysis revealed that—in order of predictive value—presence of extracutaneous disease, type and extent of skin involvement, no complete response to initial treatment, and presence of follicular mucinosis were independently associated with MFrelated mortality. The relative risks for MF-related mortality are presented in Table 4. Regarding clinical stage, patients with stage Ia and stage Ib MF had a significantly better survival than patients with stage Ic MF (P.001). However, no significant difference in survival was found between patients with stage Ia and stage Ib disease (P = .11). Notably, not only patients with histologically documented lymph node involvement (stage III) but also patients with enlarged, but histologically uninvolved, lymph nodes (stage II) had




36

100

80

80

60

Patients With Stage I MF (n = 270) Patients With Stage II MF (n = 18) Patients With Stage III MF (n = 18) Patients With Stage IV MF (n = 3)

40

Survival, %

Survival, %

100

20

0

60

40

20

60

120

0

180

Patients With Complete Remission (n = 41) Patients Without Complete Remission (n = 94)

60

Follow-up Duration, mo

120

180

240


Figure 1. Actuarial disease-specific survival of 309 patients with mycosis fungoides (MF). The differences between the patients with each stage of MF are as follows: stage I vs stage II, P = .02; stage I vs stage III, P.001; stage II vs stage III, P = .13; and stage III vs stage IV, P.001.

Figure 3. Actuarial disease-specific survival of patients with stage Ib mycosis fungoides with or without complete remission after initial treatment. The difference between those with complete remission vs those without complete remission was significant ( P = .05).

100

Table 4. Factors Independently Influencing Disease-Specific Survival*

80

Survival, %

Factor 60

Extracutaneous involvement I (absent)† II (LN enlargement) III (LN involvement) IV (visceral involvement) Type and extent of skin lesions Ia (limited plaques)† Ib (generalized plaques) Ic (skin tumors) Complete remission after initial treatment Yes† No Follicular mucinosis Absent† Present

40

20

Patients With Stage Ia MF (n = 89) Patients With Stage Ib MF (n = 135) Patients With Stage Ic MF (n = 46)

0

60

120

180


Figure 2. Actuarial disease-specific survival of 270 patients with stage I mycosis fungoides (MF). The differences between the patients with each variation of stage I MF are as follows: stage Ia vs stage Ib, P = .11; stage Ia vs stage Ic, P.001; and stage Ib vs stage Ic, P.001.

Relative Risk

95% Confidence Interval

P

1.0 3.3 7.3 227.0

... 1.1-9.5 3.6-14.8 31.3-1646.3

... .02 .001 .001

1.0 3.2 20.9

... 0.7-14.4 4.7-92.0

... .11 .001

1.0 7.0

... 2.2-22.5

... .001

1.0 2.3

... 1.1-5.0

... .001

*Factors are presented in order of predictive value. The relative risk of different types and extents of skin lesions has been calculated for stage I only. LN indicates lymph node; ellipses, data not applicable. †Referent value.

a significantly lower survival compared with patients with stage I MF (P.001 and P = .02, respectively). DISEASE PROGRESSION

sponse to initial treatment, and the presence of follicular mucinosis were independently associated with disease progression.

One of the goals of this study was to assess the risk of disease progression, including death due to MF, for patients with different stages of MF. The calculated risks of disease progression at 5 and 10 years gradually increased from 4% to 10% for those with stage Ia disease, from 21% to 39% for those with stage Ib disease, and from 32% to 60% for those with stage Ic disease; for those with stage III disease, the risk remained at 70% at 5 and 10 years (Table 2). Table 5 shows the actual frequency of disease progression in the group of 309 patients after a median follow-up of 62 months. It also shows that the higher the clinical stage at diagnosis, the shorter the duration until disease progression. Multivariate analysis revealed that—as for diseasespecific survival—the presence of extracutaneous disease, the type and extent of skin involvement, the re-

COMMENT

In the present study, the main clinical characteristics, disease evolution, and survival of 309 Dutch patients with MF, included in the Dutch registry for cutaneous lymphomas between October 1985 and May 1997, were evaluated. In addition, prognostic variables and the risk of disease progression for those with different stages of MF were analyzed. The median age at diagnosis of 61 years and the male-female ratio of 196:113 were similar to those given in the few other large series studied.2,3,13 At the time of first presentation, 93.2% of the patients with MF had only skin lesions, including 5.8% with concurrent en-




37

Table 5. Actual Disease Progression in 309 Patients With MF After a Median Follow-up of 62 Months* Stage at Diagnosis Ia (n = 89) Ib (n = 135) Ic (n = 46) II (n = 18) III (n = 18) IV (n = 3) Total (N = 309)

Skin Tumors

Lymph Node Involvement

Visceral Involvement

Death Due to MF

Progression†

Duration Until Disease Progression, mo‡

3 (3) 28 (21) 0 3 (17) 2 (11) 0 36 (12)

2 (2) 19 (14) 11 (24) 5 (28) 0 0 37 (12)

1 (1) 5 (4) 7 (15) 2 (11) 3 (17) 0 18 (6)

2 (2) 13 (10) 15 (33) 4 (22) 11 (61) 2 (67) 47 (15)

4 (4) 33 (24) 18 (39) 9 (50) 11 (61) 2 (67) 77 (25)

73 (49-96) 45 (8-109) 37 (1-242) 24 (14-51) 32 (8-56) 6 (2-9) 40 (1-242)

*Data are given as number (percentage) of patients unless otherwise indicated. The clinical stages are explained in the footnote to Table 1. MF indicates mycosis fungoides. †Total number (percentage) of patients showing disease progression. ‡Data are given as the median (range).

progression was much more frequent in patients with stage Ib MF than in those with stage Ia MF suggests that with longer follow-up, the difference in survival might become statistically significant. Our study did not include patients with largeplaque parapsoriasis, characterized by the presence of patches or slightly infiltrated plaques but with histological changes not diagnostic of MF. While we consider such lesions as a potential precursor of MF, other groups26 have expressed the view that large-plaque parapsoriasis, and even small-plaque parapsoriasis, should be considered as MF, and not as precursors of MF. However, in view of the excellent prognosis of patients with stage Ia MF— similar to that of a race-, age-, and sex-matched control population10—and the low tendency to progress, it is questionable which patient with small-plaque parapsoriasis will benefit from being marked as a patient with CTCL. Because of this ongoing controversy and the inconsistent use of the terms large-plaque parapsoriasis and smallplaque parapsoriasis, it is perhaps better to abandon these terms. The only question that really matters is the following: is it MF or is it not MF? Tumor stage MF is often associated with a poor prognosis. However, this and other studies11,12,14 clearly indicate that patients with skin tumors without concurrent extracutaneous disease (stage Ic) still have a diseaserelated 5-year survival of approximately 70% to 80%. Whether patients with enlarged, but histologically uninvolved, lymph nodes (stage II) have a more unfavorable prognosis compared with patients without clinically enlarged lymph nodes is a matter of controversy.4,11,13 In the present study, patients with stage II disease had a significantly lower survival rate than patients with stage I MF (P.001). Previous studies27 suggested that T-cell receptor gene rearrangement analysis is a more accurate and objective method of diagnosing early lymph node involvement in patients with MF than routine histological features. However, in prior studies,28 which included lymph nodes of 7 of the 18 patients with stage II MF included in this study, no clonal T-cell populations were found in any of the dermatopathic, but noninvolved, lymph nodes. There is, therefore, no evidence that the lymph nodes of these patients with stage II MF were actually involved, which leaves the more unfavorable prognosis of this group unexplained.

larged but histologically uninvolved lymph nodes, whereas only 6.8% presented with concurrent nodal or visceral involvement. In the Netherlands, patients with MF are treated traditionally with skin-directed therapies, including topical corticosteroids, psoralen–UV-A therapy, UV-B therapy, or topical mechlorethamine hydrochloride, and additional radiotherapy in case of concurrent skin tumors, whereas multiagent chemotherapy is generally only used in patients with extracutaneous localizations. Initial treatment according to this classic approach resulted in a complete remission in almost one third of the patients (98 of the 309 patients). As expected, in most patients, this complete remission was short-lived. However, in 33 (34%) of the 98 patients achieving complete remission on initial treatment, and not receiving any type of maintenance treatment, there was no subsequent relapse. Eighteen of these 33 patients, including 9 with stage Ia, 5 with stage Ib, 3 with stage Ic, and 1 with stage IIb MF, have been in complete remission for more than 5 years, and, since most relapses occur within 5 years after achieving complete remission,10,13 may be considered as potential cures. The present retrospective study does not allow a representative comparison of the effects of the different treatment modalities, since treatment selection may have been affected by disease severity. It is, therefore, not surprising that we did not find a relation between the results of initial treatment and the type of treatment given (data not shown). The complete response of only 10 (55.6%) of the 18 patients to total skin electron beam irradiation at initial therapy may be explained by the fact that 4 of 18 patients had stage III disease, and 8 of the 14 remaining patients had MF-associated follicular mucinosis, a combination known to be rather refractory to total skin electron beam irradiation.25 The disease-related and overall survival for the whole group of 309 patients was 89% and 80% at 5 years, and 75% and 57% at 10 years, respectively. For the survival rates for the different stages of MF, the overall and disease-specific survival rates at 5 and 10 years for patients with stage Ia and Ib MF (Table 2) were similar to those reported in previous studies.4,5,10-14 In this study, we did find a difference in survival between those with stage Ia and those with stage Ib MF, but this did not reach statistical significance. The fact that disease ARCH DERMATOL / VOL 136, APR 2000 509



38

In the literature, the following prognostic variables have been described: stage of disease,3-5,11-14 age,2,10,12,13 race,2 response to initial treatment,3,10,13 and prior malignant neoplasm.2 In the present study, stage at diagnosis (ie, the presence of extracutaneous disease and the type of skin involvement), complete remission after initial treatment, and the presence of follicular mucinosis proved independently predictive of disease-specific survival and disease progression. In the group of 32 patients with MF-associated follicular mucinosis, disease progression occurred more often and disease-specific survival rates were significantly lower than in the 277 patients without follicular mucinosis. In the 32 patients with follicular mucinosis, disease progression was estimated to occur in 89% within 10 years after diagnosis vs 32% in the 277 patients without follicular mucinosis. The disease-related survival at 5 and 10 years was 81% and 36%, and the overall survival 75% and 21%, respectively. A more detailed clinical and histological analysis of a group of 40 patients with MF-associated follicular mucinosis will be published separately. Older patients had significantly lower diseasespecific survival rates and higher disease progression rates. However, older age was associated with more advanced stages of MF, and it appeared not to be an independent prognostic factor. Mycosis fungoides is generally depicted as a malignant disease that slowly evolves through patch, plaque, and tumor stages, and ultimately may develop into an extracutaneous and generally fatal disease. Because of the increased accessibility of medical literature through Internet services, we are confronted more frequently with patients with newly diagnosed MF who have come to believe that this sequence of events invariably takes place. On the other hand, clinical experience suggests that many patients with MF, in particular those with stage Ia and perhaps also many with stage Ib disease, may have stable disease for decades, and that only a proportion of patients with MF progresses and will develop extracutaneous disease. Consistently, the results of this and other recent studies10,12,13 indicate that the risk of disease progression within the first 10 years after diagnosis is about 5% to 10% for patients with stage Ia and between 17% and 39% for patients with stage Ib disease. In patients with more advanced stages of MF, the risk of disease progression was higher and the duration until progression shorter (Tables 2 and 5). These results confirm the clinical impression that, at least within the first 10 years after diagnosis, disease progression occurs in only a few patients. Further studies are warranted to elucidate the risk factors associated with disease progression within these early stages of MF.

REFERENCES 1. Weinstock M, Horm J. Mycosis fungoides in the United States: increasing incidence and descriptive epidemiology. JAMA. 1988;260:42-46. 2. Weinstock M, Horm J. Population-based estimate of survival and determinants of prognosis in patients with mycosis fungoides. Cancer. 1988;62:1658-1661. 3. Lamberg S, Green S, Byar D, et al. Status report of 376 mycosis fungoides patients at 4 years: Mycosis Fungoides Cooperative Group. Cancer Treat Rep. 1979; 63:701-707. 4. Hamminga L, Hermans J, Noordijk E, Meijer C, Scheffer E, van Vloten W. Cutaneous T-cell lymphoma: clinicopathological relationships, therapy and survival in ninety-two patients. Br J Dermatol. 1982;107:145-155. 5. Sausville E, Eddy J, Makuch R, et al. Histopathological staging at initial diagnosis of mycosis fungoides and the Se´zary syndrome: definition of three distinctive prognostic groups. Ann Intern Med. 1988;109:372-382. 6. Hoppe R, Wood G, Abel E. Mycosis fungoides and the Se´zary syndrome: pathology, staging and treatment. Curr Probl Cancer. 1990;14:293-371. 7. Hermann J, Roenigk H, Hurria A, et al. Treatment of mycosis fungoides with photochemotherapy (PUVA): long-term follow-up. J Am Acad Dermatol. 1995; 33:234-242. 8. Zackheim H. Topical carmustine (BCNU) for patch/plaque mycosis fungoides. Semin Dermatol. 1994;13:202-206. 9. Quiros P, Kacinski B, Wilson L. Extent of skin involvement as a prognostic indicator of disease free survival and overall survival of patients with T3 cutaneous T-cell lymphoma treated with total skin electron beam radiation therapy. Cancer. 1996;77:1912-1917. 10. Kim Y, Jensen R, Watanabe G, Varghese A, Hoppe R. Clinical stage IA (limited patch and plaque) mycosis fungoides. Arch Dermatol. 1996;132:1309-1313. 11. Toro J, Stoll H, Stomper P, Oseroff A. Prognostic factors and evaluation of mycosis fungoides and Se´zary syndrome. J Am Acad Dermatol. 1997;37:58-67. 12. Vonderheid E, Ekbote S, Kerrigan K, et al. The prognostic significance of delayed hypersensitivity to dinitrochlorobenzene and mechlorethamine hydrochloride in cutaneous T cell lymphoma. J Invest Dermatol. 1998;110:946-950. 13. Kim Y, Chow S, Varghese A, Hoppe R. Clinical characteristics and long-term outcome of patients with generalized patch and/or plaque (T2) mycosis fungoides. Arch Dermatol. 1999;135:26-32. 14. Zackheim H, Amin S, Kashani-Sabet M, McMillan A. Prognosis in cutaneous Tcell lymphoma by skin stage: long-term survival in 489 patients. J Am Acad Dermatol. 1999;40:418-425. 15. Beljaards R, Meijer C, Scheffer E, et al. Prognostic significance of CD30 (Ki-1/ Ber-H2) expression in primary cutaneous large-cell lymphomas of T-cell origin: a clinico-pathological and histochemical study in 20 patients. Am J Pathol. 1989; 135:1169-1178. 16. Willemze R, Kerl H, Sterry W, et al. EORTC classification for primary cutaneous lymphomas: a proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer. Blood. 1997;90: 354-371. 17. Nickoloff BJ. Light-microscopic assessment of 100 patients with patch/plaque stage mycosis fungoides. Am J Dermatopathol. 1988;10:469-477. 18. Fuks Z, Bagshaw M, Farber E. Prognostic signs and the management of the mycosis fungoides. Cancer. 1973;32:1385-1395. 19. Bunn P, Lamberg S. Report of the Committee on Staging and Classification of Cutaneous T-Cell Lymphomas. Cancer Treat Rep. 1979;63:725-728. 20. Scheffer E, Meijer C, Van Vloten W. Dermatopathic lymphadenopathy and lymph node involvement in mycosis fungoides. Cancer. 1980;45:137-148. 21. Kaplan E, Meier P. Nonparametric estimation from incomplete observations. J Am Stat Assoc. 1958;53:475-480. 22. Cox D, Snell E. Analysis of Binary Data. New York, NY: Chapman & Hall; 1989. 23. Beljaards R, Willemze R. The prognosis of patients with lymphomatoid papulosis associated with other types of malignancies. Br J Dermatol. 1992;126:596-602. 24. Basarab T, Fraser-Andrews E, Orchard G, et al. Lymphomatoid papulosis in association with mycosis fungoides: a study of 15 cases. Br J Dermatol. 1998;139: 630-638. 25. Wilson L, Cooper D, Goodrich A, et al. Impact of non-CTL dermatologic diagnosis on cutaneous T-cell lymphoma patients treated with total skin electron beam radiation therapy. Int J Radiat Oncol Biol Phys. 1994;28:829-837. 26. King-Ismael D, Ackerman AB. Guttate parapsoriasis/digitate dermatosis (small plaque parapsoriasis) is mycosis fungoides. Am J Dermatopathol. 1992;14:518-530. 27. Weiss LM, Hu E, Wood GS, et al. Clonal rearrangements of T-cell receptor genes in mycosis fungoides and dermatopathic lymphadenopathy. N Engl J Med. 1985; 313:539-544. 28. Bakels V, van Oostveen JW, Geerts ML, et al. Diagnostic and prognostic significance of clonal T-cell receptor beta gene rearrangements in lymph nodes of patients with mycosis fungoides. J Pathol. 1993;170:249-255.

Accepted for publication October 26, 1999. We thank P. D. Bezemer, PhD, P. J. Kostense, PhD, and J. J. Oudejans, MD, for their statistical advice. Reprints: Rein Willemze, MD, Department of Dermatology, B1-Q-93, Leiden University Medical Center, PO Box 9600, 2300 RC Leiden, the Netherlands (e-mail: [email protected]). ARCH DERMATOL / VOL 136, APR 2000 510



39

40

Chapter 3

Follicular mycosis fungoides, a distinct disease entity with or without associated follicular mucinosis: a clinicopathologic and follow-up study of 51 patients

Arch Dermatol. 2002 Feb: 138(2):191-8

41

STUDY

Follicular Mycosis Fungoides, a Distinct Disease Entity With or Without Associated Follicular Mucinosis A Clinicopathologic and Follow-up Study of 51 Patients Remco van Doorn, MD; Erik Scheffer, MD; Rein Willemze, MD; for the Dutch Cutaneous Lymphoma Group Objective: To determine the clinicopathologic fea-

severe pruritus. Characteristic histologic findings were the presence of perifollicular neoplastic infiltrates with a variable degree of folliculotropism, but generally no epidermotropism, follicular mucinosis (49 of 51 cases), and often a considerable admixture of eosinophils and plasma cells. Response on initial treatment, risk of disease progression (development of extracutaneous disease and/or death from lymphoma), and disease-specific and overall survival of patients with follicular MF were worse than in classic MF patients. The actuarial disease-specific survival was 68% at 5 years and 26% at 10 years.

tures and the disease course of patients with follicular mycosis fungoides (MF). Design: A multicenter, 14-year, retrospective cohort

analysis. Setting: Dutch Cutaneous Lymphoma Group. Patients: Fifty-one patients with the clinicopathologic features of follicular MF with (n=49) or without (n=2) associated follicular mucinosis. Follow-up data were compared with those of 158 patients with the classic epidermotropic type of MF, including 122 patients with generalized plaque-stage MF (T2 N0 M0) and 36 patients with tumor-stage MF (T3 N0 M0).

Conclusions: Follicular MF shows distinctive clinicopathologic features, is more refractory to treatment, and has a worse prognosis than the classic type of MF; it should be considered a distinct type of cutaneous T-cell lymphoma. Based on these results and those of other studies, we suggest the term follicular MF for cases with or without associated follicular mucinosis.

Observations: Characteristic clinical features not or rarely observed in classic MF were the preferential localization of the skin lesions in the head and neck region (45 of 51 patients), the presence of follicular papules, alopecia, acneiform lesions, mucinorrhoea, and often

M

Arch Dermatol. 2002;138:191-198

YCOSIS fungoides (MF)

is the most common type of cutaneous T-cell lymphoma, characterized clinically by an indolent clinical course with the subsequent evolution of patches, plaques, and tumors, and histologically by the infiltration of the epidermis by medium-sized to large atypical T cells with cerebriform nuclei.1

See also pages 182 and 244 From the Departments of Dermatology (Dr van Doorn) and Pathology (Dr Scheffer), Vrije Universiteit Medical Center, Amsterdam, and Department of Dermatology (Dr Willemze), Leiden University Medical Center, the Netherlands. A complete list of the participants in the Dutch Cutaneous Lymphoma Group is available from the authors.

In the first 10 years after diagnosis, disease progression, including development of extracutaneous disease and diseaserelated deaths, occurs in only a minority of patients.2 Apart from this so-called classic Alibert-Bazin type of MF, many clinical and histologic subtypes have been reported, including hypopigmented, vesicular, pustular, granulomatous, and other types of MF. Since these variant types of MF have the same clinical course and clinical

(REPRINTED) ARCH DERMATOL / VOL 138, FEB 2002 191

behavior and require the same therapeutic approach as the classic type of MF, they are generally not considered separate entities. In both the EORTC (European Organization for Research on the Treatment of Cancer)1 classification for primary cutaneous lymphomas and in the WHO (World Health Organization) classification,3 only pagetoid reticulosis and MF-associated follicular mucinosis have been categorized as separate entities. Hereinafter, the latter condition will be referred to as follicular MF, a term also used in the WHO classification for cases with or without associated follicular mucinosis. Follicular MF has been classified as a separate entity because it has distinctive clinical and histologic features, is more refractory to standard treatment, and has a worse prognosis than classic MF. However, this observation is particularly based on clinical experience of members of the classification committee of the EORTC Cutaneous Lymphoma Group and is not sub-



43

PATIENTS AND METHODS

additional studies to determine visceral involvement were performed. In all cases clinical records and follow-up data, which had been collected yearly, were evaluated. The following variables were recorded: age; sex; duration of skin lesions before diagnosis; type of initial therapy; whether there was a complete remission after initial therapy; the date of disease progression if applicable; and the date of last contact (or death if applicable). Because of difficulties in defining skin stage in patients with follicular MF, disease progression was defined by the development of histologically documented nodal involvement in patients with previously skin-limited disease, the development of visceral involvement in patients with prior skin and/or lymph node involvement, and death due to lymphoma. In all cases, one or multiple skin biopsy specimens obtained at the time of diagnosis, and in most cases also obtained during follow-up, were reviewed. To evaluate differences in clinical behavior between follicular MF and classic MF, 49 patients with follicular MF presenting with disease confined to the skin were compared with 158 patients with classic MF included in an earlier study.2 This latter group included 122 patients with generalized plaque-stage MF (T2 N0 M0) and 36 patients with tumor-stage MF (T3 N0 M0) without evidence of extracutaneous disease and without associated follicular mucinosis at the time of diagnosis. Actuarial survival curves were calculated from the date of diagnosis to the date of last contact (or the date of death) using the Kaplan-Meier technique. Differences between survival and disease progression curves were analyzed using the log-rank test. Univariate analysis of possible prognostic factors was performed using the log-rank test and Cox proportional hazards regression analysis. Patients lost to follow-up were considered censored at the time of last contact. Analyses were performed using the SPSS statistical software (SPSS Inc, Chicago, Ill).

Between October 1985 and December 1998, 57 patients with follicular MF were included in the registry of the Dutch Cutaneous Lymphoma Group. Three of the 57 had to be excluded from the present study, 1 because of incomplete follow-up data and 2 because of lack of representative skin biopsy specimens. Another 3 patients were excluded because they had a history of classic epidermotropic MF for 4 to 7 years before they developed skin tumors on the face with the histologic features of MF-associated follicular mucinosis. The final study group consisted of 51 patients. In each patient the diagnosis had been made by an expert panel of dermatologists and pathologists at one of the quarterly meetings of the Dutch Cutaneous Lymphoma Group. The main criteria for diagnosis and for inclusion in the study were the presence of perifollicular-to-diffuse dermal infiltrates with variable numbers of atypical T cells with cerebriform nuclei infiltrating the follicular epithelium and the presence of mucinous degeneration of the follicular epithelium, as confirmed by Alcian blue staining of the first diagnostic biopsy specimens (diagnostic specimens).6,7 Forty-nine patients met both criteria. Two cases with the same cytoarchitectural features in the diagnostic specimen but without associated follicular mucinosis were included as well. The time of evaluation of the first diagnostic specimen was considered the time of diagnosis. In all cases diagnostic evaluation at the time of diagnosis consisted of a thorough physical examination, complete blood cell count, serum chemistry studies, and skin specimen evaluation. Lymph node biopsies and thoracic and abdominal computed tomographic scans were performed only in patients with enlarged peripheral lymph nodes. Lymph node involvement was assessed using criteria described previously.10 When indicated clinically,

stantiated sufficiently in the literature. In fact, published reports on follicular MF are relatively scarce, generally concern case reports or small series of patients, and have mainly been focused on differentiation between MF-associated follicular mucinosis and alopecia mucinosa, the benign idiopathic form of follicular mucinosis.4-9 In a recent study by members of our group2 on 309 patients with MF, the 32 patients with follicular MF seemed to have significantly higher disease progression and mortality rates than the 277 patients without follicular mucinosis. These observations prompted us to review all cases of follicular MF registered at the Dutch Cutaneous Lymphoma Group between 1985 and 1998.

49 patients (96%) had disease confined to the skin, including 4 patients with enlarged but histologically uninvolved lymph nodes, whereas 1 patient had concurrent lymph node involvement and another, concurrent visceral involvement. At the time of diagnosis, 34 of 51 patients had only patches, plaques, or (grouped) follicular papules, often associated with alopecia; 14 had (concurrent) nodules or tumors; and 3 had erythroderma (Figure 1). Acneiform lesions, including comedolike lesions and epidermal cysts, were a prominent feature in 4 patients. Mucinorrhea (ie, discharge of mucinous substance from the follicular orifices) was noted in 3 patients. During the course of their disease, 2 patients developed a leonine face (Figure 2). In 45 of 51 patients, the skin lesions were preferentially localized in the head and neck region at the time of diagnosis. A characteristic finding in 25 of these 45 patients was the presence of plaques or tumors on the head or neck, whereas the trunk and extremities showed only patches or slightly infiltrated plaques and/or grouped follicular papules (Figure 1A-B). Infiltrated plaques in the eyebrows with concurrent alopecia were a common finding. Most patients had moderate to severe pruritus.

RESULTS

CLINICAL CHARACTERISTICS The main clinical features and relevant follow-up data have been summarized in Table 1. Fifty-one patients, including 42 male and 9 female, were included in this study. Four (8%) of 51 patients were younger than 40 years at the time of diagnosis. At the time of diagnosis, (REPRINTED) ARCH DERMATOL / VOL 138, FEB 2002 192



44

HISTOLOGIC FEATURES

Table 1. Clinical Characteristics and Follow-up Data of 51 Patients With Follicular Mycosis Fungoides*

A total of 74 representative skin biopsy specimens from these 51 patients were reviewed. These included the 51 diagnostic specimens, 8 prediagnostic specimens obtained 4 to 30 months (median, 12 months) prior to diagnosis, and 15 specimens obtained during follow-up at the time of relapse or disease progression. Characteristically, the diagnostic specimens showed perifollicular and perivascularto-diffuse dermal infiltrates with variable infiltration of the follicular epithelium by medium-sized to large atypical T cells with cerebriform nuclei (Figure 3). Pautrier microabscesses appeared in only a minority of specimens. Infiltration of the interfollicular epidermis by (atypical) T cells, as in classic MF, was rare. Only 5 of 51 specimens showed infiltration of both the epidermis (epidermotropism) and the follicular epithelium (folliculotropism). Prominent infiltration of the eccrine sweat glands was observed in 3 specimens. In all but 2 cases, the skin specimens showed mucinous degeneration of the hair follicles, varying from focal spots of mucin deposition (which had to be searched for in serial sections) to lakes of mucin (Figure 3B). The number of atypical T cells infiltrating the follicular epithelium was generally low and did not correlate with the amount of mucin deposition. The perifollicular infiltrates consisted of variable numbers of medium-sized to large atypical T cells with cerebriform nuclei and blast cells and admixed small lymphocytes, histiocytes, eosinophils (which were numerous in 13 of 51 specimens), and plasma cells, in particular in patients with secondary bacterial infection (Figure 3C). Concurrent patches on the trunk showed essentially the same histologic features, though the number of atypical T cells was often less than in the more infiltrated lesions in the head and neck, which made a definite diagnosis in these specimens more difficult or even impossible. Immunohistochemical analysis demonstrated a CD3+-CD4+-CD8− phenotype of the neoplastic T cells in all cases studied. Small numbers of scattered CD30+ blast cells were regularly observed, as were small clusters of admixed B cells. In the initial diagnostic specimens of 7 of the 51 patients, we found a considerable number of blast cells (�15%; generally a mixture of CD30+ and CD30− blast cells). Six of these 7 patients died of lymphoma 11 to 100 months (median, 40 months) after diagnosis. In follow-up specimens taken during disease progression, the dermal infiltrates tended to become more diffuse, sometimes showed complete effacement of the follicular structures, and invariably showed increasing numbers of CD30− and/or CD30+ blast cells. In the 8 prediagnostic specimens, the dermal infiltrates were mainly confined to the perifollicular areas. Although some of these specimens already contained small numbers of atypical T cells in the follicular epithelium and in the perifollicular infiltrates, the size and morphologic characteristics of the infiltrating T cells did not warrant a definite diagnosis of follicular MF.

Characteristic Age at diagnosis, median (range), y Male-female ratio Duration of skin lesions before diagnosis, median (range), mo Type of skin lesions at diagnosis Patches/plaques/papules Nodules/tumors Cysts/comedones Erythroderma Clinical stage at diagnosis Only skin lesions Enlarged, but uninvolved nodes (DL) Lymph node involvement Visceral involvement Folicular mucinosis Present Absent Initial treatment PUVA TSEBI Radiotherapy + other Other Complete remission on initial therapy Calculated risk of disease progression†, % At 5 y At 10 y Current status Alive without disease Alive with disease Died of other cause Died of FMF Disease-specific survival, % At 5 y At 10 y Overall survival, % At 5 y At 10 y

Finding 57 (15-84) 4.7 (42:9) 48 (4-156) 44 (86) 14 (27) 4 (8) 3 (6) 45 (88) 4 (8) 1 (2) 1 (2) 49 (96) 2 (4) 22 (43) 11 (22) 7 (14) 11 (22) 8 (16) 37 66 5 (10) 20 (39) 6 (12) 20 (39) 68 26 64 14

*Unless otherwise indicated, data are number (percentage) of patients. DL indicates histologic features of dermatopathic lymphadenopathy; PUVA, psoralen plus UV-A therapy; TSEBI, total skin electron beam irradiation; and FMF, follicular mycosis fungoides. †Disease progression means development of extracutaneous disease and/or death from lymphoma.

tion (TSEBI) in 11 patients (Table 1). Seven patients were initially treated with local radiotherapy in combination with other therapies, including PUVA with or without retinoids, UV-B, topical mechlorethamine, or topical steroids. For the remaining patients treatments included topical steroids (3 patients), topical mechlorethamine (1 patient), UV-B (1 patient), PUVA in combination with retinoids (1 patient), prednisone (1 patient), azathioprine in combination with topical mechlorethamine (1 patient), or polychemotherapy (2 patients). One patient refused treatment. Only 8 (16%) of 51 patients, each with disease confined to the skin, achieved complete remission on initial treatment. Six of them had been treated with TSEBI, 1 with PUVA, and 1 with a combination of PUVA, retinoids, and local radiotherapy. Two of these 7 patients were still in complete remission after a follow-up of 38 and 192 months, respectively, and may be considered cured.

THERAPY AND FOLLOW-UP Initial therapy consisted of psoralen plus UV-A (PUVA) treatment in 22 patients and total skin electron beam irradia(REPRINTED) ARCH DERMATOL / VOL 138, FEB 2002 193



45

A

B

C

D

E

F

Figure 1. Clinical appearances of follicular mycosis fungoides. A, Boggy infiltrates on the cheek and neck; B, concurrent grouped follicular papules on the trunk; C, Infiltrated plaque with alopecia and cystic lesions above the left eye; D, the same patient had numerous cysts and comedolike lesions on the trunk; E, Diffuse erythema and alopecia of the eyebrows (and eyelashes, not shown); F, Infiltrated plaque on the forehead with alopecia of the left eyebrow.

The follow-up period varied between 8 and 239 months (median, 48 months; mean, 58 months). Development of lymph node or visceral involvement was documented in 14 and 7 patients, respectively. Disease progression defined as the development of extracutaneous disease or death from lymphoma occurred in 20 (39%) of 51 patients, and occurred 11 to 168 months (median, 45 months) after diagnosis. The calculated risk of disease progression during the first 5 years after diagnosis was 37%; at 10 years, 66%. At the conclusion of the study, 26 patients had died, 20 from lymphoma. The 5- and 10-

year disease-specific survival rate was 68% and 26%, respectively. The respective overall survival rates at 5 and 10 years were 64% and 14%. Univariate analysis demonstrated no association between disease-specific survival and age at diagnosis, sex, duration of skin lesions before diagnosis, or response to initial treatment. FOLLICULAR MF VS CLASSIC MF To evaluate differences in clinical behavior and prognosis between follicular MF and classic MF, we compared




46

A

B

C

D

Figure 2. Sequential photographs of a 39-year-old man with follicular mycosis fungoides. A, At the time of diagnosis; B, 26 months after diagnosis with a leonine face; C, 29 months after diagnosis; and D, 35 months after diagnosis following total skin electron beam irradiation, which had not resulted in complete remission. The patient died of lymphoma 42 months after diagnosis.

relevant clinical features of the 49 patients with follicular MF who had disease confined to the skin with the features of 122 patients with generalized plaque-stage MF and 36 patients with tumor-stage MF without evidence of extracutaneous disease and without associated follicular mucinosis (Table 2). Patients with follicular MF showed a significantly higher male-female ratio and less frequently achieved complete remission on initial treatment. The calculated risk of disease progression, as defined in this study, within the first 5 years after diagnosis was 36% for follicular MF vs 12% for classic plaque-stage MF and 24% for tumor-stage MF. Disease-specific and overall survival in patients with follicular MF were significantly lower than in patients with generalized plaque-stage MF, and were roughly similar to patients with tumor-stage MF without associated follicular mucinosis (Figure 4).

atypical T cells with cerebriform nuclei. In most cases the epidermis is spared (folliculotropism instead of epidermotropism). Mucinous degeneration of the follicular epithelium occurs in most cases, and a considerable admixture with eosinophils and plasma cells is frequently present. Clinical characteristics include the preferential localization of the skin lesions in the head and neck area (45 of 51 patients), the presence of papules (often grouped), alopecia, frequent secondary bacterial infection, and, less commonly, the presence of acneiform lesions and mucinorrhea. Unlike in classic MF, pruritus is often severe and may represent a good parameter of disease activity: in several patients, a relapse after initial therapy was preceded by the reappearance of pruritus. In addition, patients with follicular MF proved generally more refractory to standard classic MF therapies, showed more frequent disease progression, and had a less favorable prognosis (Table 2). This more unfavorable prognosis suggests a true biological difference in clinical behavior between patients with follicular MF and patients with the classic epidermotropic type of MF, which is consistent with the conclusion of a recent study.11 The similar duration of skin lesions before diagnosis in patients with follicular MF and patients with classic-type MF indicates that the difference in survival does not simply result from a selection of patients with

COMMENT

The results of the present study clearly demonstrate that follicular MF has distinctive clinicopathologic features and should be considered a distinct disease entity. Characteristic histologic features include the primary perifollicular localization of the dermal infiltrates, with variable infiltration of the follicular epithelium by medium-sized to large (REPRINTED) ARCH DERMATOL / VOL 138, FEB 2002 195



47

A

B

Figure 3. Characteristic histologic features of follicular mycosis fungoides. Perifollicular infiltrates with marked folliculotropism and associated follicular mucinosis. A, Note the absence of epidermal involvement. B, Alcian blue staining of a concurrent lesion showing mucin deposits. C, Detail of perifollicular infiltrate of part A showing atypical hyperchromatic T cells, blast cells, and admixed histiocytes and eosinophils.

C

more advanced disease in the present study (Table 2). Comparison of the disease-specific and overall survival data indicate that patients with follicular MF have a similar (at 5 years) or worse (at 10 years) survival than patients with tumor-stage MF (Table 2). Nevertheless, under the classic MF classification systems,12,13 most of our patients with follicular MF would have been classified as stage IA (T1 N0 M0) or IB (T2 N0 M0), and only 14 of them had nodules or tumors at the time of diagnosis. This supports our contention that these clinical staging systems for MF are not very useful in patients with follicular MF. For instance, patients presenting with a solitary patch or plaque on the face do not have stage IA or T1 N0 M0–stage disease. Because of the perifollicular localization of the dermal infiltrates, such patients should always be considered to have tumor-stage disease, regardless of the clinical appearance of the skin lesion, and should be treated accordingly.

introduced for a rare clinical variant of MF characterized by follicular papules, follicular keratoses, comedolike lesions and epidermal cysts. Histologically, perifollicular infiltrates are present showing marked folliculotropism, but there is generally no epidermotropism or follicular mucinosis.14-22 Evaluation of published reports of “follicular MF” demonstrates considerable clinical heterogeneity and suggests that this term has been used for the diagnoses of at least 3 different groups of patients. The largest group comprises patients with clinically and histologically classic MF prior to or, less often, concurrent with the development of the follicular lesions.17,21,22 In the present study, 3 patients with 4- to 7-year histories of classic epidermotropic MF developing skin tumors with the histologic features of follicular MF were excluded because such cases show the clinical behavior of classic MF developing tumor-stage disease. The second group includes patients presenting with acneiform lesions as the predominant or only manifestation of the disease.17,19,21,22 However, a similar clinical presentation may also occur in patients with associated follicular mucinosis23,24 and was a predominant feature in 4 of 51 patients in the present study. One of our patients was

MF-ASSOCIATED FOLLICULAR MUCINOSIS VS FOLLICULAR MF In recent years the term follicular MF or cutaneous T-cell lymphoma (also folliculocentric MF or pilotropic MF) has been (REPRINTED) ARCH DERMATOL / VOL 138, FEB 2002 196



48

Table 2. Characteristics of Patients With Folllicular, Generalized Plaque-Stage, and Tumor-Stage Mycosis Fungoides*

Characteristic Age at diagnosis, median (range), y Male-female ratio Duration of skin lesions before diagnosis (range), mo Complete remission on initial therapy, No. (%) Risk of disease progression, % At 5 y At 10 y Disease-specific survival, % At 5 y At 10 y Overall survival, % At 5 y At 10 y Follow-up duration, median (range), mo

FMF† (n = 49)

Plaque-Stage MF† (n = 122)

Tumor-Stage MF† (n = 36)

57 (15-84) 4.4 (40:9) 48 (4-156) 8 (16)

61 (14-92) 1.39 (71:51) 48 (1-840) 38 (31)

47 (35-88) 1.25 (20:16) 48 (2-600) 10 (28)

36 65

12 18

69 26

95 84

65 14 48 (11-239)

89 68 72 (14-313)

P Value (FMF vs Classic MF) Plaque

Tumor

.61 .004 .09 .05

.01 .02 .12 .20

24 47

�.001

.49

79 61

�.001

.25

�.001

.80

61 34 47 (6-249)

*FMF indicates follicular mycosis fungiodes; MF, mycosis fungoides. †Columns “FMF,” “Plaque-Stage MF,” and “Tumor-Stage MF” denote patients without extracutaneous involvement at time of diagnosis with FMF, MF with patches and plaques covering 10% or more of the skin surface (T2 N0 M0), and MF with skin tumors (T3 N0 M0), respectively.

a 16-year-old boy with a history of severely pruritic acneiform lesions and alopecia for more than 5 years before the diagnosis MF-associated follicular mucinosis was made. Despite radiotherapy and multiagent chemotherapy, he died 5 years after diagnosis of systemic lymphoma. Interestingly, while several of his acneiform lesions showed mucin deposits, others did not, even after further sectioning. Finally, some of the reported cases demonstrate all of the characteristic clinical and histologic features of the cases reported herein except for the presence of follicular mucinosis.18,20 The present study includes 2 such cases in patients who otherwise did not differ clinically or histologically from the 49 patients with associated follicular mucinosis. Based on these observations, we do not believe that it is useful to differentiate between follicular MF with and without associated follicular mucinosis in these 2 latter groups. From a biological point of view, the most relevant feature in follicular MF with or without follicular mucinosis is the deep, perifollicular localization of the neoplastic infiltrates, which makes them less accessible to skin-targeted therapies. On the basis of our own observations and the available literature,11 we are inclined to believe that follicular MF with or without follicular mucinosis should not be considered separately, and that cases with a preferential (peri)follicular distribution of the neoplastic infiltrates, regardless of the presence of mucinous degeneration, should be termed follicular MF.

100

Disease-Specific Survival, %

90

Plaque-Stage MF (n = 122)

80 70

60

Tumor-Stage MF (n = 36)

50 40

30 FMF (n = 49)

20

10 0

60

120

180


Figure 4. Actuarial disease-related survival of 49 patients with follicular mycosis fungoides (FMF), 122 with generalized plaque-stage mycosis fungoides (MF) (T2 N0 M0), and 36 with tumor-stage MF (T3 N0 M0). For FMF vs plaque-stage MF, P�.001; for FMF vs tumor-stage MF, P =.25.

prior to referral: seborrheic dermatitis in patients presenting with erythematous lesions on the scalp and eyebrows; atopic dermatitis, because of the severe pruritus; and facial granuloma with eosinophilia in patients presenting with a solitary plaque on the face and an eosinophilrich infiltrate. Finally, it should be noted that even when follicular MF is suspected, it may require several biopsies to make a definite diagnosis. It is important that biopsy specimens be taken from the most infiltrated skin lesions, generally in the face or neck, and not only from patches with or without follicular papules on the trunk.

DIFFERENTIAL DIAGNOSIS

THERAPY Although distinctive clinical and histologic features should facilitate an early and correct diagnosis, it is our experience over the last 15 years that the diagnosis of follicular MF is often overlooked. Because of the preferential involvement of the head and neck area, the absence of patches and plaques on the trunk or buttocks, and the absence of epidermotropic atypical T cells, the diagnosis of MF or cutaneous T-cell lymphoma is often not considered. The following incorrect diagnoses have been made more than once

The results of the present study confirm our clinical impression and the scattered data in literature that patients with follicular MF are generally less responsive to standard therapies used in patients with classic MF.11,20,25 Our retrospective study does not allow a meaningful comparison of the effects of the different treatment methods because patients were treated at different institutions, and treatment selection may have been affected by disease severity.




49

2. Van Doorn R, Van Haselen CW, van Voorst Vader PC, et al. Mycosis fungoides: disease evolution and prognosis of 309 Dutch patients. Arch Dermatol. 2000; 136:504-510. 3. Harris NL, Jaffe ES, Diebold J, et al. World Health Organization classification of neoplastic diseases of the hematopoietic and lymphoid tissues: report of the Clinical Advisory Committee meeting, Airlie House, Virginia, November 1997. J Clin Oncol. 1999;17:3835-3849. 4. Pinkus H. The relationship of alopecia mucinosa to malignant lymphoma. Dermatologica. 1964;129:266-270. 5. Emmerson RW. Follicular mucinosis: a study of 47 patients. Br J Dermatol. 1969; 81:395-413. 6. Nickoloff BJ, Wood C. Benign idiopathic versus mycosis fungoides–associated follicular mucinosis. Pediatr Dermatol. 1985;2:201-206. 7. Sentis HJ, Willemze R, Scheffer E. Alopecia mucinosa progressing into mycosis fungoides: a long-term follow-up study of two patients. Am J Dermatopathol. 1988;10:478-486. 8. Gibson LE, Muller SA, Leiferman KM, Peters MS. Follicular mucinosis: clinical and histopathologic study. J Am Acad Dermatol. 1989;20:441-446. 9. Mehregan DA, Gibson LE, Muller SA. Follicular mucinosis: histopathologic review of 33 cases. Mayo Clin Proc. 1991;66:387-390. 10. Scheffer E, Meijer CJ, Van Vloten WA. Dermatopathic lymphadenopathy and lymph node involvement in mycosis fungoides. Cancer. 1980;45:137-148. 11. Bonta MD, Tannous ZS, Demierre MF, Gonzalez E, Harris NL, Duncan LM. Rapidly progressing mycosis fungoides presenting as follicular mucinosis. J Am Acad Dermatol. 2000;43:635-640. 12. Bunn P, Lamberg S. Report of the Committee on Staging and Classification of Cutaneous T-cell Lymphomas. Cancer Treat Rep. 1979;63:725-728. 13. Fuks Z, Bagshaw M, Farber E. Prognostic signs and the management of the mycosis fungoides. Cancer. 1973;32:1385-1395. 14. Kim SY. Follicular mycosis fungoides. Am J Dermatopathol. 1985;7:300-301. 15. Lacour JP, Castanet J, Perrin C, Ortonne JP. Follicular mycosis fungoides—a clinical and histologic variant of cutaneous T-cell lymphoma: report of two cases. J Am Acad Dermatol. 1993;29:330-334. 16. Goldenhersh MA, Zlotogorski A, Rosenmann E. Follicular mycosis fungoides. Am J Dermatopathol. 1994;16:52-55. 17. Vergier B, Beylot-Barry M, Beylot C, et al. Pilotropic cutaneous T-cell lymphoma without mucinosis: a variant of mycosis fungoides? Arch Dermatol. 1996;132: 683-687. 18. Pereyo NG, Requena L, Galloway J, Sangueza OP. Follicular mycosis fungoides: a clinicohistopathologic study. J Am Acad Dermatol. 1997;36:563-568. 19. Fraser-Andrews E, Ashton R, Russell-Jones R. Pilotropic mycosis fungoides presenting with multiple cysts, comedones and alopecia. Br J Dermatol. 1999; 140:141-144. 20. Klemke CD, Dippel E, Assaf C, et al. Follicular mycosis fungoides. Br J Dermatol. 1999;141:137-140. 21. Hodak E, Feinmesser M, Segal T, et al. Follicular cutaneous T-cell lymphoma: a clinicopathological study of nine cases. Br J Dermatol. 1999;141:315-322. 22. Grau C, Pont V, Matarredona J, Fortea JM, Aliaga A. Follicular mycosis fungoides: presentation of a case and review of the literature. J Eur Acad Dermatol Venereol. 1999;13:131-136. 23. Wilkinson JD, Black MM, Chu A. Follicular mucinosis associated with mycosis fungoides presenting with gross cystic changes on the face. Clin Exp Dermatol. 1982;7:333-339. 24. Wittenberg GP, Gibson LE, Pittelkow MR, el-Azhary RA. Follicular mucinosis presenting as an acneiform eruption: report of four cases. J Am Acad Dermatol. 1998; 38:849-851. 25. Gilliam AC, Lessin SR, Wilson DM, Salhany KE. Folliculotropic mycosis fungoides with large-cell transformation presenting as dissecting cellulitis of the scalp. J Cutan Pathol. 1997;24:169-175.

Because of the perifollicular localization of the dermal infiltrates, patients with follicular MF should always be considered to have tumor-stage disease, regardless of the clinical appearance of the skin lesions. Therefore, in patients presenting with a single plaque or tumor or a few clustered skin lesions, but without patches or follicular papules at other sites, radiotherapy is the first choice for treatment. In selected cases with superficial lesions presenting at multiple sites, PUVA treatment might be attempted first. However, in most cases this approach will not result in complete remission. In the present series, complete remission was achieved with PUVA therapy in only 1 of 22 patients. In patients with more infiltrated skin lesions, in particular those who do not respond to PUVA therapy alone, TSEBI is the preferred method of treatment. However, only 6 of 11 patients treated with TSEBI reached complete remission, and 3 of the 6 complete responders had a relapse within 6 months. The relative unresponsiveness of follicular MF to TSEBI has been reported.18 In some patients relapsing skin disease may be controlled effectively by a maintenance treatment with topical nitrogen mustard. If TSEBI is not available, PUVA in combination with interferon alfa or retinoids and local radiotherapy for thick tumors may be an alternative. The same approach can be used for relapsing disease following TSEBI. In our experience, multiagent chemotherapy does not generally result in complete remission in patients with skin-limited disease and should therefore be reserved for patients developing extracutaneous disease. Accepted for publication July 2, 2001. Corresponding author and reprints: Rein Willemze, MD, Department of Dermatology, B1-Q-93, Leiden University Medical Center, Albinusdreef 2, 2333 ZA Leiden, the Netherlands (e-mail: [email protected]). REFERENCES 1. Willemze R, Kerl H, Sterry W, et al. EORTC classification for primary cutaneous lymphomas: a proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer. Blood. 1997;90: 354-371.

News and Notes

T

he Regional Conference on Dermatological Laser and Facial Cosmetic Surgery 2002 will be held from September 13 through September 15, 2002, at the new wing of the Hong Kong Convention and Exhibition Center. The conference is jointly organized by the University of Hong Kong, the Hong Kong Society of Dermatology and Venereology, and the Hong Kong Society of Plastic & Reconstructive Surgeons. Renowned authorities to speak at the conference include Dr Yung-lung Lai (Chang Gung Memorial Hospital, Taiwan), Dr Dieter Manstein (Harvard Medical School, United States), Prof Rolf Nordstro¨ m (Nordstro¨ m Hospital for Plastic and Reconstructive Surgery, Finland), Dr Niwat Polnikorn (Ramathibodi Hospital, Thailand), and Dr Woffles Wu (Woffles Wu Aesthetic Surgery and Laser Center, Singapore). For more information on the conference, please contact the secretariat at phone (852) 25278898; fax: (852) 28667530, or e-mail: cosfmshk@netvigator .com.




50

News and Notes

Chapter 4

CD8+ T cells in cutaneous T-cell lymphoma: expression of cytotoxic proteins, Fas ligand, and killing inhibitory receptors and their relationship with clinical behaviour

J. Clin. Oncol. 2001 Dec 1;19(23):4322-9

CD8� T Cells in Cutaneous T-Cell Lymphoma: Expression of Cytotoxic Proteins, Fas Ligand, and Killing Inhibitory Receptors and Their Relationship With Clinical Behavior By Maarten H. Vermeer, Remco van Doorn, Danny Dukers, Marcel W. Bekkenk, Chris J.L.M. Meijer, and Rein Willemze Purpose: We investigated the number, phenotype, and prognostic significance of CD8� T cells in patients with mycosis fungoides (MF) and CD30� primary cutaneous large T-cell lymphoma (PCLTCL). Patients and Methods: Immunohistochemical stainings for CD8, granzyme B (GrB), T cell–restricted intracellular antigen (TIA-1), Fas ligand (FasL), and killer-cell inhibitory receptors (KIRs; CD95, CD158a, and CD158b) were performed on 83 first-diagnostic biopsy samples obtained from patients with plaque-stage MF (n � 42), tumor-stage MF (n � 20), and CD30� PCLTCL (n � 21). Results: Serial sections and double-staining experiments showed that the large majority of CD8� T cells in MF and CD30� PCLTCL expressed TIA-1 and FasL, whereas only a minority expressed GrB, which suggested that these CD8� T cells were partly activated cytotoxic T lymphocytes (CTLs). These CD8� CTLs never or rarely expressed KIRs. This phenotype was a constant feature of CD8� CTLs and did not alter with

disease progression. In contrast, the median percentage of CD8� CTLs in plaque-stage MF (22%), tumorstage MF (7%), and CD30� PCLTCL (3%) differed significantly (P < .0001) and was associated with a significant decrease in 5-year survival. Also within the group of tumor-stage MF, a significant relation between CD8� CTLs and survival was found. Multivariate analysis in the total group of MF demonstrated that both skin stage and percentage of CD8� CTLs were independent parameters of survival. Conclusion: Our results demonstrated that partly activated CD8� CTLs were present in CTCL and that high proportions of these cells correlated with a better prognosis. This suggested that these CD8� CTLs could play an important role in the antitumor response in these conditions. J Clin Oncol 19:4322-4329. © 2001 by American Society of Clinical Oncology.

C

influx of CD8� cytotoxic T lymphocytes (CTLs) in regressing MF tumors on intralesional administration of interleukin-12 suggest that a tumor-specific immune response may play an important role.3 In vitro studies have consistently shown that malignant cells in MF display tumor-specific antigens that can be recognized by autologous CD8� CTLs.4-7 Taken together, these observations suggest that CD8� CTLs are a critical component in the antitumor immune response in CTCL. However, studies that evaluate the number and immunophenotype of CD8� CTLs in different stages of CTCL are scarce, and correlation with clinical behavior leads to contradicting results.8,9 CD8� CTL–mediated tumor-cell lysis is achieved by at least two distinct pathways: (1) by exocytosis of intracytoplasmic granules that contain perforin, granzymes, and T cell–restricted intracellular antigen (TIA-1), and (2) by the Fas-mediated pathway in which membrane-bound Fas ligand (FasL) expressed on cytotoxic T cells interacts with Fas (CD95/Apo-1) on target cells.10,11 Both pathways activate a cascade of subcellular events that ultimately lead to the activation of caspases and target-cell death. The availability of monoclonal antibodies (MoAbs) against perforin, the serine proteases granzyme A and granzyme B (GrB), TIA-1, FasL, and Fas has enabled the study of these components involved in T cell–mediated cytotoxicity in tissue sections.12-15 Recently, killing inhibitory receptors (KIRs) were discovered as a new class of molecules that are

UTANEOUS T-CELL lymphomas (CTCLs) are a group of non-Hodgkin’s lymphomas mainly with a CD3�CD4� memory T-cell phenotype that preferentially home to the skin.1 Mycosis fungoides (MF), the most common type of CTCL, is characterized by erythematous, scaly patches, and plaques in the early stages of disease and generally has an indolent clinical course.2 However, in some patients, progression to tumor-stage MF is observed, which is associated with more aggressive clinical behavior. In contrast, patients with CD30� primary cutaneous large T-cell lymphoma (PCLTCL) generally present with multiple tumors that rapidly spread to extracutaneous sites, and these patients have a poor prognosis, with a 5-year survival rate of 15%.1 The pathophysiologic mechanisms underlying these differences in biologic behavior are largely unknown. However, the protracted clinical course in most MF patients, the beneficial effect of immunomodulating therapies, and the

From the Departments of Dermatology and Pathology, Free University Hospital, Amsterdam, the Netherlands. Submitted January 22, 2001; accepted July 23, 2001. Address reprint requests to M.H. Vermeer, MD, Department of Dermatology, Leiden University Medical Center, Albinusdreef 2 2300 RC Leiden, the Netherlands; email: [email protected]. © 2001 by American Society of Clinical Oncology. 0732-183X/01/1923-4322/$20.00

4322

Journal of Clinical Oncology, Vol 19, No 23 (December 1), 2001: pp 4322-4329

53

4323

CD8� T CELLS CORRELATE WITH SURVIVAL IN CTCL

able to modulate cytotoxic function of natural killer (NK) and T cells. At present, two groups of KIRs are known: the immunoglobulin (Ig) superfamily-like receptors (CD158a, CD158b)16 and the lectin-like receptors (CD94).17 These receptor molecules are expressed by subpopulations of NK cells and CD8� CTLs. On ligation with MHC class I receptors on target cells, KIRs deliver inhibitory signals that impair cytolytic function.18 Thus, expression of KIRs by CTLs might impair their capacity to effectively kill virusinfected or tumor cells. Recent in vitro studies demonstrated the expression of functional KIRs on a CD8�, tumorspecific, cytotoxic, T-cell clone isolated from the peripheral blood of a patient with MF.19 However, studies of the expression of KIRs by cytotoxic cells in skin infiltrates of CTCL lesions have not yet been published, and the importance of the induction of KIRs as a mechanism to evade the immune response in CTCL is presently unknown. To further characterize the role of CD8� CTLs in the antitumor immune response in CTCL, we investigated the proportions of CD8� T cells and the expression of TIA-1, GrB, FasL, and KIRs by CD8� CTLs in 83 initial biopsy samples from patients with plaque-stage MF (n � 42), tumor-stage MF (n � 20), and CD30� PCLTCL (n � 21) obtained at the time of diagnosis and 27 follow-up biopsy samples and correlated the results with clinical behavior. PATIENTS AND METHODS

Patients Eighty-three paraffin-embedded skin biopsy samples obtained at the time of diagnosis from 83 untreated CTCL patients, who included 62 MF patients and 21 CD30� PCLTCL patients, were studied. The diagnosis of MF and CD30� PCLTCL was based on a combination of clinical, histologic, and immunophenotypical data as described previously.1 The duration of skin lesions before a definite diagnosis could be made varied between 2 months and more than 10 years (median, 103 months) in MF and between 3 and 24 months (median, 12 months) in patients with CD30� PCLTCL. Only cases in which the neoplastic T cells had either a CD3�/ CD4�/CD8� (n � 70) or a CD3�/CD4�/CD8� phenotype (n � 13) were included. Rare cases of MF and CD30� PCLTCL with a CD3�/CD4�/CD8� phenotype were not selected for this study because it was impossible to make a reliable estimate of the number of reactive CD8� T cells in these cases. Follow-up data, including response to initial therapy and survival, were recorded in each case (Table 1). Of the 62 MF biopsy samples taken at the time of diagnosis, 42 were obtained from plaques from patients with generalized (T2N0M0) plaque-stage MF, and 20 were obtained from skin tumors from patients with tumor-stage MF without concurrent lymph node involvement (T3N0M0). For 19 of these 62 patients, 27 follow-up biopsy samples from plaques (n � 9) or skin tumors (n � 18) obtained at the time of relapse or disease progression 1 to 90 months (median, 24 months) after the first diagnostic biopsy were studied as well. The results of these biopsies are not included in the statistical analyses and will be discussed separately.

Table 1. Clinical Characteristics of Patients Included in This Study Diagnosis

No. of patients Age, years Median Range Male/female Follow-up, months Median Range 5-year survival rate, % Current status, n Alive without disease Alive with disease Died of unrelated disease Died of lymphoma

Plaque-Stage MF (T2N0M0)

Tumor-Stage MF (T3N0M0)

CD30-Negative PCLTCL

42

20

21

65 33-93 2.0

67 47-92 1.0

71 31-88 1.7

64 12-176 85

24 3-117 55

12 1-56 0

0 35 3 6

0 8 2 12

1 2 1 17

Frozen sections obtained from the same excision biopsy sample or another biopsy sample from a similar concurrent lesion were used for KIR staining in 18 cases, including seven MF plaques, nine MF tumors, and two CD30� PCLTCL biopsy samples.

Immunohistochemistry Paraffin sections. Immunostaining on formalin-fixed, paraffin-embedded skin sections with MoAbs against CD8 (DAKO, Glostrup, Denmark), GrB,20,21 TIA-1 (Coulter Immunology, Hialeah, FL),4 FasL (clone 33; Transduction Laboratories, Lexington, United Kingdom), and CD4 (Novocastra, Newcastle on Tyne, United Kingdom), Ber-H2/ CD30 (DAKO) and polyclonal antibodies against CD3 (DAKO) was performed using a standard three-step streptavidin-biotin-peroxidase– based technique after antigen retrieval with microwave heating as described previously.22,23 In 10 cases, which included four patients with MF plaques, four with MF tumors, and two with CD30� PCLTCL, double staining for CD8 with GrB and CD8 with TIA-1 was performed as described previously.24 Frozen sections. Snap-frozen specimens were stored in liquid nitrogen until use. NK cells were identified by their staining for CD56 (IgG1 subtype; Beckton and Dickinson, Poole, United Kingdom). Expression of KIR was studied using MoAbs against CD94 (IgG2 subtype), CD158a, and CD158b (Coulter Immunology), as described previously.25 Double staining for CD94 with CD56 or CD8 was performed in eight cases, which included three patients with MF plaques, three with MF tumors, and two with CD30� PCLTCL, by simultaneous incubation with primary antibodies followed by incubation with horseradish peroxidase– conjugated goat antimouse IgG1 and biotinylated goat antimouse IgG2a for the detection of CD56 or CD8 and CD94, respectively. The horseradish peroxidase was visualized by fluorescein-conjugated tyramine,26,27 whereas the biotin label was detected with cy3-conjugated streptavidin.

Interpretation of Immunohistochemical Staining The percentages of CD8� T cells were expressed as a percentage of the total number of skin-infiltrating cells (both reactive and neoplastic). Percentages of CD8� T cells were independently estimated by two observers (M.H.V. and R.W.) to the nearest 5% for the entire tissue section in a blinded fashion. In the few cases in which there was disagreement, sections were read jointly by the two investigators, and

54

4324 Table 2.

VERMEER ET AL Percentages of CD8� T Cells in MF and CD30-Negative PCLTCL CD8 T Cells (%)*

Diagnosis

No. of Patients

MF plaque MF tumor CD30� PCTLCL

42 20 21

Median

Range

22† 10† 3†

2-50 2-20 1-25

*The percentage of CD8� T cells is taken as a percentage of the total number of skin-infiltrating cells (reactive cells and tumor cells). †Difference between MF plaques versus MF tumors and MF tumors versus CD30� PCTLCL is significant (Student’s t test, P � .0001).

consensus was reached. The percentages of CD8� T cells positive for TIA-1, GrB, FasL, and KIR were studied on serial paraffin sections stained with antibodies against CD3, CD4, CD8, GrB, TIA-1, and FasL and serial frozen sections stained with antibodies against CD56, CD8, CD94, CD158a, and CD158b. Stainings were scored as follows: negative, no or occasional (� 10%) CD8� T cells stained; positive, 10% to 50%; and double positive, more than 50%. To determine whether and to what extent TIA-1, GrB, FasL, and KIRs are expressed by inflammatory cells other than CD8� cells, we performed doublestaining experiments as described above.

Statistical Analysis Comparison of proportions of CD8� T cells and the proportions of CD8� T cells that express TIA-1, GrB, and FasL between patients with plaque-stage MF, tumor-stage MF, and CD30� PCLTCL was performed using the two-tailed Student’s t test. Univariate analysis of possible prognostic factors was performed using the log-rank test for categorical variables (stage) and Cox proportional regression analysis for continuous variables (percentage of CD8� T cells, age). To assess independence of prognostic value, multivariate analysis was performed by entering the variables of interest in Cox proportional hazards regression analysis. Actuarial survival curves in MF were calculated from the time of the initial diagnostic biopsy until death from disease or end of follow-up using the Kaplan-Meier method. P values below .05 were considered statistically significant. All analyses were performed using Statistical Products and Services Solutions Software (SPSS Inc, Chicago, IL).

RESULTS

Percentage of CD8� CTLs in CTCL The proportions of CD8� CTLs in the MF and CD30negative PCLTCL biopsy samples taken at the time of Table 3.

diagnosis are presented in Table 2. Major differences were found between MF plaques and tumors. Percentages of 20% or more CD8� T cells were observed in 21 (50%) of 42 MF plaques but not in any of the 20 MF tumors. The median number of CD8� T cells in MF was 17% (range, 2% to 50%). CD30� PCLTCL showed low percentages of CD8� T cells, with a median value of 3% and less than 5% of CD8� T cells in 12 (55%) of 21 cases. The differences in the proportions of CD8� T cells between plaque-stage and tumor-stage MF and tumor-stage MF and CD30� PCLTCL were statistically significant (Student’s t test, P � .0001 and P � .018, respectively). The results of the proportions of CD8� T cells in 27 MF biopsy samples obtained during follow-up are summarized in Table 3. Taken together, the percentages of CD8� T cells in nine MF plaques (median, 22%; range, 15% to 27%) and 18 MF tumors (mean, 10%; range, 2% to 17%) were similar to the percentages observed in plaques and tumors present at the time of diagnosis. Interestingly, examination of plaques in three MF patients who had concurrent tumors demonstrated high percentages of CD8� T cells in the plaques (median, 25%) compared with the concurrent tumors (median, 10%; range, 7% to 15%). Expression of Cytotoxic Proteins GrB, TIA-1, and FasL by CD8� T Cells Expression of GrB, TIA-1, and FasL was detected as a clear, granular, cytoplasmic staining in all cases. Because a reliable estimation of the percentages of CD8� T cells that express cytotoxic proteins might be hampered by the fact that these proteins are expressed not only by CD8� CTLs but also by the neoplastic T cells of some types of CTCL28,29 and perhaps by rare reactive CD4� T cells,30 double-staining experiments for CD8 with GrB or CD8 with TIA-1 were first performed in 10 cases, including four patients with MF plaques, four with MF tumors, and two with CD30� PCLTCL. These experiments demonstrated that TIA-1 and GrB are not or are rarely expressed by inflammatory cells other than CD8� T cells (Fig 1).

Percentages of CD8� T Cells in 27 MF Biopsy Samples Obtained During Follow-Up

Initial Biopsy Samples

Follow-Up Biopsy Samples CD8� T Cells (%)

Type of Skin Lesion

No. of Patients

Median

Range

MF plaque MF plaque

5* 9†

19 20

15-50 12-40

MF tumor

5

7

2-15

CD8� T Cells (%) Type of Skin Lesion

MF MF MF MF

plaque tumor plaque tumor

Median

Range

Median

Range

6 11 3‡ 7

20 7 25 7

15-25 2-17 25-27 2-10

12 36

3-36 18-90

7

1-16

*Patients with plaque-stage MF who developed only new plaques during follow-up. †Patients with plaque-stage MF who showed disease progression to tumor-stage MF during follow-up. ‡MF plaques in patients with concurrent skin tumors.

55

Time Interval (months)

No. of Patients

4325


were detected between MF plaques, MF tumors, and CD30� PCLTCL. Expression of KIR by CD8� T Cells To investigate whether the cytotoxic function of CD8� T cells is possibly modulated by KIR, the expression of CD94, CD158a, and CD158b was studied. All antibodies demonstrated a membranous staining. CD94�, CD158a�, or CD158b� cells comprised up to 5% of the total number of reactive cells. In all cases, the number of CD94� cells was higher than the number of CD158b� cells, which in turn outnumbered the CD158a� cells. No differences were observed in the number of reactive cells that expressed CD94, CD158a, and CD158b between MF plaques, MF tumors, and CD30� PCLTCL. Double-staining experiments for CD56 or CD8 with CD94 demonstrated coexpression of CD56 with CD94 in more than 95% of CD94� cells, whereas colocalization of CD8 with CD94 was limited to a few scattered cells (Fig 3). Correlation of CD8� T Cells With Clinical Characteristics

Fig 1. Double staining demonstrates that expression of TIA-1 is limited to CD8� T cells. Expression of TIA-1 (black dot) was observed on the majority of CD8� T cells, indicated by the arrows, but not on CD8� cells. Streptavidin-biotin-peroxidase technique; hematoxylin counterstain; magnification, �400.

Cox proportional hazards regression analysis in the total group of 62 MF patients demonstrated that survival in MF patients declined with lower numbers of CD8� T cells (P � .001). Also, within tumor-stage MF, high numbers of CD8� T cells correlated with an increased survival (P � .003). In plaque-stage MF, the relation between the percentages of CD8� T cells and survival did not reach significance, although a trend was observed toward a better survival in patients with higher numbers of CD8� T cells. Univariate analysis demonstrated that stage of disease (P � .0004) and the percentage of CD8� T cells (P � .001) but not age (P � .57) correlated with survival. Multivariate analysis showed that both stage of disease and the number of CD8� T cells were independent prognostic parameters. The actuarial survival curves for all MF patients divided the patients into two groups using the median number of CD8� T cells (17%) as the cutoff point (Fig 4).

Moreover, because of the superior morphology in paraffin sections, the differentiation between CD8� T cells and neoplastic T cells was generally not difficult. Examination of serial sections stained for CD8, GrB, TIA-1, and FasL showed a similar topographic distribution for CD8� T cells and TIA-1� and/or GrB� cells. In plaque-stage MF, tumor-stage MF, and CD30� PCLTCL, most (60% to 90%) CD8� T cells expressed TIA-1, whereas only a minority (generally less than 25%) of CD8� T cells expressed GrB (Table 4; Fig 2). Staining for FasL showed granular intracytoplasmic staining in more then 50% of the CD8� T cells in all but a few cases. Taken together, no significant differences in the relative proportions of CD8� T cells that express TIA-1, GrB, or FasL Table 4.

Expression of TIA-1, GrB, and FasL by CD8� T cells in MF and CD30� PCLTCL TIA-1

GrB

FasL

Diagnosis

No. of Patients

�

�

��

�

�

��

�

�

��

MF plaque MF tumor CD30� PCLTCL

40 17 16

0 0 0

5 1 0

35 16 16

17 4 1

20 11 11

3 2 4

0 0 0

2 0 0

38 17 16

NOTE. The expression of cytotoxic proteins by reactive cells is presented as a percentage of the number of CD8� T cells. Abbreviations: �, � 10% positive CD8� T cells; �, 10%-50% positive CD8� T cells; ��, � 50% positive CD8� T cells.

56

4326

VERMEER ET AL

Fig 2. Expression of cytotoxic proteins by CD8� T cells in an MF plaque. Serial sections demonstrate (A) localization of infiltrating CD8� T cells and (B) TIA-1 expression by these cells. Inset: the granular staining of TIA-1–positive cells. Streptavidin-biotin-peroxidase technique; hematoxylin counterstain; magnification, �400; inset, �1,000.

DISCUSSION

In the present study, the expression of cytotoxic proteins by CD8� T cells and the relation between the percentages of CD8� T cells and clinical behavior was studied in MF and CD30� PCLTCL. We demonstrated that, in all types of CTCL, the large majority of CD8� T cells expressed TIA-1 and FasL, whereas a minority was GrB positive. These results are consistent with the results of a previous study that demonstrated that the majority of CD8� T cells expressed TIA-1 but not granzymes.31 Similarly, the neoplastic cells in CD8� epidermotropic cytotoxic T-cell lymphomas, which may be considered the neoplastic equivalents of these reactive CD8� cytotoxic T cells, also showed constant expression of TIA-1 but rarely expressed GrB or perforin.32 With respect to the cytotoxic phenotype of these CD8� T cells, in vitro studies demonstrated that, although TIA-1 is expressed on both resting and activated CTLs,33 perforins and granzymes are only expressed after activation34 and might therefore be a more reliable marker for activated

CTLs. Because TIA-1 was expressed by most CD8� T cells and GrB was expressed by only a minority of these cells (5% to 10%) in all groups studied, one may wonder whether these cells are functionally active CTLs. One possible explanation for the low GrB expression is that most CD8� T cells had already secreted their GrB as has been demonstrated in skin biopsy samples of lichen planus.35 Interestingly, recent studies of our group demonstrated that, in skin biopsy samples of lichen planus, lupus erythematosus, and graft-versus-host disease, the majority of CD8� T cells expressed TIA-1, whereas GrB was expressed by only a small number of these cells (unpublished data). Epidermal injury and apoptotic keratinocytes were a constant finding in these biopsy samples, illustrating the presence of functionally active CTLs. Thus, these findings illustrated that the low expression of GrB compared with TIA-1 by the CD8� T cells in these CTCLs does not exclude the possibility that they are functionally active CTLs directed at the neoplastic T cells. Tumor cells use various escape mechanisms to evade an effective antitumor response. Recent studies of our group

57

4327


Fig 4. Actuarial survival of patients with MF, plaque and tumor stage, stratified according to the median percentage of CD8� T cells. Large numbers of CD8� T cells correlate with a favorable prognosis in MF.

Fig 3. (A) Double stainings for CD56 (red) and CD94 (green) demonstrate a low proportion of CD56/CD94 double-positive cells stained yellow. (B) On double staining for CD8 (red) and CD94 (green), no double-stained cells are observed. Immunofluorescence technique; hematoxylin counterstain; magnification, �400.

demonstrated that the loss of Fas expression by the neoplastic cells in aggressive types of CTCL may be one of these mechanisms.36 Another mechanism to evade the immune response may be the inhibition of cytolytic function through KIRs. Expression of KIRs was demonstrated on tumor-specific CD8� CTLs in melanoma patients, and functional studies showed that tumor-specific lysis was inhibited by these KIRs.37 Recent in vitro studies demonstrated the expression of functional KIRs on a CD8� tumor-specific cytotoxic T-cell clone isolated from the peripheral blood of an MF patient.19 Whether the in vitro expansion of T cells may lead to the induction of KIRs is presently unknown. In the present study, KIRs were expressed only by a few scattered NK cells but never or rarely by CD8� T cells, which argues against a role for these KIRs in tumor progression in CTCL. Correlation of the percentages of CD8� CTLs and clinical behavior in MF and CD30� PCLTCL showed that the proportions of CD8� CTLs were significantly higher in MF plaques than in MF tumors, which in turn outnumbered the

percentages of CD8� T cells in CD30� PCLTCL. The decline in the percentage of CD8� CTLs was associated with a less favorable prognosis. Also, within tumor-stage MF, a relation between higher percentages of CD8� CTLs and better survival was found. Multivariate analysis demonstrated that both skin stage and the proportion of CD8� T cells were independent parameters of survival. Examination of 27 additional follow-up skin biopsy samples of MF patients showed similar percentages of CD8� CTLs in plaques and tumors when compared with plaques and tumors biopsied at the time of diagnosis. Interestingly, MF plaques in patients who had concurrent skin tumors contained considerable proportions of CD8� CTLs (median, 25% v 10% in the concurrent tumors), as seen in MF patients with plaque lesions only. Taken together, these observations suggest that, in patients who have already progressed to tumor-stage MF, an effective antitumor response is still functioning in concurrent MF plaques that prevents tumor progression at those sites. Previous studies that address the relation between the proportions of CD8� CTLs and clinical behavior in CTCL are few, have mainly been focused on MF, and have reached conflicting conclusions.8,9 Consistent with our results, Hoppe et al9 also described a relation between high proportions of CD8� CTLs and a better survival in MF. However, no statistically significant difference in the percentage of CD8� CTLs between MF plaques and tumors was found. In contrast, in a study by Vonderheid et al,8 the percentages of CD8� CTLs decreased from 11.9% to 6.4% to 3.8% in MF patches, plaques, and tumors, respectively, but no relation between the percentages of CD8� CTLs and survival was found in this study. In the group of CD30� PCLTCL, characterized by an extremely poor prognosis, low percentages of CD8� CTLs (median, 3%) were found. Taken together, high proportions

58

4328

VERMEER ET AL

of CD8� CTLs were found in the patient group with a favorable prognosis (plaque-stage MF) and low proportions of CD8� CTLs in groups with a poor prognosis (tumorstage MF, CD30� PCLTCL), which suggests that CD8� CTLs play an important role in the antitumor immune response in CTCL. This notion is in line with earlier studies that demonstrated that malignant cells in MF express tumor-specific antigens that can be recognized by autologous CD8� CTLs in vitro.4-6 In conclusion, we demonstrated that reactive CD8� T cells in CTCL had the phenotype of partly activated

cytotoxic T cells (TIA-1�, GrB�/�, FasL�) but did not express KIRs. Moreover, we demonstrated that high percentages of infiltrating CD8� CTLs were associated with a better prognosis. Taken together, these observations suggest that CD8� CTLs could play an important role in the antitumor response in CTCL. ACKNOWLEDGMENT We thank Els de Vries and Wim Vos for their excellent technical assistance.

REFERENCES 1. Willemze R, Kerl H, Sterry W, et al: EORTC classification for primary cutaneous lymphomas: A proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer. Blood 90:354-371, 1997 2. van Doorn R, Van Haselen CW, van Voorst-Vader PC, et al: Mycosis fungoides disease evolution and prognosis of 309 Dutch patients. Arch Dermatol 136:504-510, 2000 3. Rook AH, Yoo EK, Grossman DJ, et al: Use of biological response modifiers in the treatment of cutaneous T-cell lymphoma. Curr Opin Oncol 10:170-174, 1998 4. Berger CL, Wang N, Christensen I, et al: The immune response to class I-associated tumor-specific cutaneous T-cell lymphoma antigens. J Invest Dermatol 107:392-397, 1996 5. Berger CL, Longley BJ, Imaeda S, et al: Tumor-specific peptides in cutaneous T-cell lymphoma: Association with class I major histocompatibility complex and possible derivation from the clonotypic T-cell receptor. Int J Cancer 76:304-311, 1998 6. Bagot M, Echchakir H, Mami-Chouaib F, et al: Isolation of tumor-specific cytotoxic CD4� and CD4� CD8dim� T-cell clones infiltrating a cutaneous T-cell lymphoma. Blood 11:4331-4341, 1998 7. Echchakir H, Bagot M, Dorothee G, et al: Cutaneous T-cell lymphoma reactive CD4� cytotoxic T lymphocyte clones display a Th1 cytokine profile and use a fas-independent pathway for specific tumor cell lysis. J Invest Dermatol 115:74-80, 2000 8. Vonderheid EC, Tan E, Sobel EL, et al: Clinical implications of immunologic phenotyping in cutaneous T-cell lymphoma. J Am Acad Dermatol 17:40-52, 1987 9. Hoppe RT, Medeiros LJ, Warnke R, et al: CD8-positive tumor-infiltrating lymphocytes influence the long-term survival of patients with mycosis fungoides. J Am Acad Dermatol 32:448-453, 1995 10. Kagi D, Vignaux F, Ledermann B, et al: Fas and perforin pathways as major mechanisms of T-cell-mediated cytotoxicity. Science 265:528-530, 1994 11. Peter ME, Krammer PH: Mechanisms of CD95 (APO-1/Fas)mediated apoptosis. Curr Opin Immunol 10:545-551, 1998 12. Anderson P, Nagler-Anderson C, O’Brien C, et al: A monoclonal antibody reactive with a 15-kDa cytoplasmic granule-associated protein defines a subpopulation of CD8� T lymphocytes. J Immunol 144:574-582, 1990 13. Anderson P: TIA-1 structural and functional studies on a new class of cytolytic effector molecule. Curr Top Microbiol Immunol 198:131-143, 1995

14. Griffiths GM, Mueller C: Expression of perforin and granzymes in vivo: Potential diagnostic markers for activated cytotoxic cells. Immunol Today 12:415-419, 1991 15. Krahenbuhl O, Rey C, Jenne D, et al: Characterization of granzymes A and B isolated from granules of cloned human cytotoxic T lymphocytes. J Immunol 141:3471-3477, 1988 16. Moretta A, Sivori S, Vitale M, et al: Existence of both inhibitory (p58) and activatory (p50) receptors for HLA-C molecules in human natural killer cells. J Exp Med 182:875-884, 1995 17. Moretta A, Vitale M, Sivori S, et al: Human natural killer cell receptor for HLA-class I molecules: Evidence that the Kp43 (CD94) molecule functions as a receptor for HLA-B allele. J Exp Med 180:545-555, 1994 18. Mingari MC, Schiavetti F, Ponte M, et al: Human CD8� T lymphocyte subsets that express HLA I-specific inhibitory receptors represent oligoclonally or monoclonally expanded cell populations. Proc Nat Acad Science 93:12433-12438, 1996 19. Bagot M, Martinvallet H, Echchakir H, et al: Functional inhibitory receptors expressed by a cutaneous T cell lymphomaspecific cytolytic clonal T cell population. J Invest Dermatal 115:994-999, 2000 20. Kummer JA, Kamp AM, van Katwijk M, et al: Production and characterization of monoclonal antibodies raised against recombinant human granzymes A and B showing cross reactions with the natural proteins. J Immunol Methods 163:77-83, 1993 21. Kummer JA, Kamp AM, Tadema TM, et al: Localization and identification of granzymes A- and B-expressing cells in normal human lymphoid tissue and peripheral blood. Clin Exp Immunol 100:164-172, 1995 22. Oudejans JJ, Kummer JA, Jiwa NM, et al: Granzyme B expression in Reed-Sternberg cells of Hodgkin’s disease. Am J Pathol 148:233-240, 1996 23. Zoi-Toli O, Meijer CJLM, Oudejans JJ, et al: Prognostic significance of Fas and Fas-ligand expression in cutaneous B-cell lymphomas. J Pathol 189:533-538, 1999 24. Oudejans JJ, Jiwa NM, Kummer JA, et al: Activated cytotoxic T-cells as prognostic marker in Hodgkin’s disease. Blood 89:13761382, 1997 25. Dukers DF, Vermeer MH, Jaspars LH, et al: Expression of killer cell inhibitory receptors is restricted to true NK cell lymphomas and a subset of intestinal enteropathy-type T cell lymphomas with a cytotoxic phenotype. J Clin Pathol 54:224-228, 2001 26. Raap AK, van der Corput MPC, Vervenne RAW, et al: Ultrasensitive FISH using peroxidase-mediated deposition of biotin or fluorochrome tyramides. Hum Mol Genet 4:529-534, 1995

59

4329

CD8� T CELLS CORRELATE WITH SURVIVAL IN CTCL 27. Dukers DF, ten Berge RL, Oudejans JJ, et al: A cytotoxic phenotype does not predict clinical outcome in anaplastic large-cell lymphomas. J Clin Pathol 52:129-136, 1999 28. Vermeer MH, Geelen FAMJ, Kummer JA, et al: Expression of cytotoxic proteins by neoplastic T cells in mycosis fungoides increases with progression from plaque stage to tumor stage disease. Am J Pathol 154:1203-1210, 1999 29. Kummer JA, Vermeer MH, Dukers DF, et al: Most primary cutaneous CD30 positive lymphoproliferative disorders have a CD4positive cytotoxic T-cell phenotype. J Invest Dermatol 109:636-640, 1997 30. Hahn S, Gehri R, Erb P: Mechanism and biological significance of CD4-mediated cytotoxicity. Immunol Rev 146:57-79, 1995 31. Wood GS, Edinger A, Hoppe RT, et al: Mycosis fungoides skin lesions contain CD8� tumor-infiltrating lymphocytes expressing an activated: MHC-restricted cytotoxic T-lymphocyte phenotype. J Cutan Pathol 21:151-156, 1994 32. Berti E, Tomasini D, Vermeer MH, et al: Primary cutaneous CD8-positive epidermotropic cytotoxic T-cell lymphomas: A distinc-

tive clinicopathological entity with an aggressive behavior. Am J Pathol 155:483-492, 1999 33. Podack ER: Execution and suicide: Cytotoxic T cells enforce Draconian laws through separate molecular pathways. Curr Opin Immunol 7:11-16, 1995 34. Griffiths GM: The cell biology of CTL killing. Curr Opin Immunol 7:343-348, 1995 35. Shimizu M, Higaki T, Kawashima M: The role of granzyme B-expressing CD8-positive T cells in apoptosis of keratinocytes in lichen planus. Arch Dermatol Res 289:527-532, 1997 36. Zoi-Toli O, Vermeer MH, de Vries E, et al: Expression of Fas and Fas-ligand in primary cutaneous T-cell lymphoma: Association between lack of Fas expression and aggressive types of CTCL. Br J Dermatol 143:313-319, 2000 37. Speiser DE, Pittet M, Valmori D, et al: In vivo expression of natural killer cell inhibitory receptors by human melanoma-specific cytolytic T lymphocytes. J Exp Med 190:775-782, 1999

60

Chapter 5

A novel splice variant of the Fas gene in patients with cutaneous T-cell lymphoma

Cancer Res. 2002 Oct. 1;62(19):5389-92

[CANCER RESEARCH 62, 5389 –5392, October 1, 2002]

Advances in Brief

A Novel Splice Variant of the Fas Gene in Patients with Cutaneous T-Cell Lymphoma Remco van Doorn,1,2 Remco Dijkman,1 Maarten H. Vermeer, Theo M. Starink, Rein Willemze, and Cornelis P. Tensen3 Department of Dermatology, Vrije Universiteit Medical Center, 1081 HV Amsterdam, the Netherlands, and Department of Dermatology, Leiden University Medical Center, 2333 AL Leiden, the Netherlands

Abstract

8 patients with CD30� PCLTCL. For the detection of splice variants in early CTCL, skin biopsy specimens from 7 patients with plaque-stage MF (T2N0M0; Ref. 8) were obtained. Cultured keratinocytes, phytohemagglutinin-activated CD4� and CD8� T cells, and skin biopsy specimens from patients with benign cutaneous lymphocytic infiltrates (atopic dermatitis, graft-versus-host-disease, and chronic discoid lupus erythematosus) were used as controls. Total cellular RNA was extracted from homogenized samples before treatment with RQ1 DNase (Promega, Madison, WI). cDNA synthesis was performed using Expand Reverse Transcriptase (Roche, Mannheim, Germany) after priming with an oligo(dT)12–18 primer (Invitrogen, Breda, the Netherlands). PCR amplification of cDNA was performed with five overlapping primer pairs (FAS I-V) covering the entire coding region of the Fas gene used previously (9) and an additional primer pair encompassing intron 5 (FAS intron: sense, 5� TCAAGGAATGCACACTCACC 3�; antisense, 5� CCAAACAATTAGTGGAATTG 3�). PCR was performed under the following conditions: denaturing for 30 s at 94°C; annealing for 60 s at 58°C for primer pairs I and II and at 50°C for primer pairs III, IV, and V, and intron 5; and extension for 60 s at 72°C; for 35 cycles. PCR products were separated by electrophoresis on a 2% agarose gel containing ethidium bromide and on a 12.5% acrylamide gel stained using PlusOne DNA Silver Staining Kit (Amersham Pharmacia, Uppsala, Sweden). PCR products were extracted from agarose gel and purified using the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) for reamplification under identical conditions and direct sequence analysis using the dideoxy chain termination method. The presence of transmembrane helices was predicted using TMHMM version 2.0 software (CBS, Denmark). Snap-frozen skin biopsy specimens were stained with a monoclonal antibody to Fas (Fas6 antibody; kindly provided by Dr. L. A. Aarden) as described previously (6).

Defective apoptosis signaling has been implicated in the pathogenesis of primary cutaneous T-cell lymphomas (CTCLs), a group of malignancies derived from skin-homing T cells. An important mediator of apoptosis in T cells is the Fas receptor. We identified a novel splice variant of the Fas gene that displays retention of intron 5 and encodes a dysfunctional Fas protein in 13 of 22 patients (59%) in both early and advanced CTCL. Impairment of Fas-induced apoptosis resulting from aberrant splicing potentially contributes to the development and progression of CTCL by allowing continued clonal expansion of activated T cells and by reducing susceptibility to antitumor immune responses.

Introduction CTCLs4 are a group of clinically heterogeneous malignancies of mature skin-homing T cells (1). The low mitosis index in the early stages of MF, the most common type of CTCL, and resistance to treatment with genotoxic agents suggest that defective apoptosis signaling plays a role in the pathogenesis of CTCL (2). One of the key regulators of apoptosis in mature T cells is Fas, a homotrimer cell surface receptor that mediates apoptosis upon cross-linking to Fas ligand. The Fas protein contains an intracellular region essential for transduction of the apoptotic signal termed the death domain; mutations in this domain dominantly interfere with Fas function (3, 4). Fas is a critical mediator of activation-induced cell death, a propriocidal mechanism involved in homeostasis of activated T cells (5). In addition, Fas signaling renders neoplastic cells susceptible to antitumor immune responses executed by cytotoxic T cells through cross-linking with Fas ligand. We previously reported loss of Fas protein expression in aggressive types of CTCL (6). In non-Hodgkin’s lymphoma, deleterious mutations of the Fas gene have been identified in 11% of patients (7). In the present study, we examined the occurrence of splice variants and mutations of the Fas gene as well as Fas protein expression in lesional skin biopsy specimens from patients with CTCL.

Results and Discussion In three of seven (43%) patients with tumor-stage MF and four of eight (50%) patients with CD30� PCLTCL, an aberrantly spliced transcript of the Fas gene was identified that has not been described previously. Sequence analysis revealed that this splice variant displays selective retention of intron 5, a 152-bp sequence, leading to frameshift and formation of a truncated protein (Figs. 1 and 2). Aberrant splicing of Fas pre-mRNA was not due to splice site mutations because none were detected in intron 5 or in its boundaries. The presence of this particular splice variant was confirmed by using a different primer set designed to amplify the exonic sequences flanking intron 5 and cannot be due to contamination with genomic DNA because this would have generated a larger PCR product containing not only intron 5 but also intron 4. Subsequent examination of an additional group of seven patients with early patch/plaque-stage MF for this splice variant revealed that it was also present in six of seven (85%) patients. It could not be demonstrated in benign cutaneous lymphocytic infiltrates, keratinocytes (Fig. 1A), or phytohemagglutinin-activated CD4� and CD8� T cells (data not shown). This indicates that the aberrant

Materials and Methods Lesional skin biopsy specimens were obtained from 15 patients with advanced CTCL, including 7 patients with tumor-stage MF (T3N0M0) and Received 7/23/02; accepted 8/19/02. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. 1 R. v. D. and R. D. contributed equally to this study. 2 R. v. D. is supported by a grant from the Dutch foundation “De Drie Lichten.” 3 To whom requests for reprints should be addressed, at Department of Dermatology, Leiden University Medical Center, Wassenaarseweg 72, 2333 AL Leiden, the Netherlands, Phone: 31-71-5271903; Fax: 31-71-5271910; E-mail:[email protected]. 4 The abbreviations used are: CTCL, cutaneous T-cell lymphoma; MF, mycosis fungoides; PCLTCL, primary cutaneous large T-cell lymphoma.

5389

63

Fas SPLICE VARIANT IN CTCL

Fig. 1. Detection and analysis of Fas transcripts. A, reverse transcription-PCR analysis of human Fas mRNA using primer pair FAS III. In addition to the expected PCR product of 240 bp, a second PCR product of 392 bp (indicated by the arrow) was detected. Input cDNA template was synthesized from RNA isolated from the following sources. A1: Lane 1, H2O (no cDNA) control; Lane 2, cultured primary keratinocytes; Lanes 3, 5, 6, 7, 11, and 12, MF tumor-stage biopsies; Lanes 4, 8, 9, and 13–17, PCLTCL biopsies; Lane 10, benign lymphocytic skin infiltrate biopsy. A2: Lane 1, H2O (no cDNA) control; Lanes 2– 6, benign lymphocytic skin infiltrate biopsies; Lanes 7–13, patch/plaque-stage biopsies. Lane M, molecular size marker (Generuler; MBI Fermentas, St. Leon-Rot, Germany). B, sequence analysis of reverse transcription-PCR products of 240 and 392 bp demonstrating the wild-type transcript and the alternative transcript that exhibits retention of a 152-bp sequence corresponding to intron 5.

Fig. 2. Top, schematic representation of the FAS-encoding exons, the FAS protein, and amplified regions of FAS cDNA in this study. Bottom, location of retained intron found in cDNA synthesized from RNA isolated from CTCL biopsies and schematic representation of altered protein encoded by mRNA with retained intron 5. CRD, cysteine-rich domains; TM, transmembrane domain. Nucleotides are numbered starting with the ATG encoding the initiating methionine as 1 (taken from GenBank accession number M67454).

5390

64


Table 1 Clinical features, Fas mutations and alternative transcripts, and Fas protein expression of 15 patients with advanced CTCL Patient no.

a b

Diagnosis

Age, sex

Disease coursea

Fas protein expression � � �

1 2 3

MF tumor stage MF tumor stage MF tumor stage

46 F 83 F 88 M

D� 12 mo D� 18 mo D� 10 mo

4 5 6 7

MF MF MF MF

68 57 54 68

D� A� D� D�

8

CD30� PCLTCL

87 F

D� 5 mo

�

9 10 11 12 13 14

CD30� CD30� CD30� CD30� CD30� CD30�

74 63 82 73 81 67

D� D� D� D� D� D�

� � � ndb � �

15a 15b

CD30� PCLTCL CD30� PCLTCL

tumor tumor tumor tumor

stage stage stage stage

PCLTCL PCLTCL PCLTCL PCLTCL PCLTCL PCLTCL

M M M F

M F F M M M

87 M 87 M

15 mo 36 mo 9 mo 89 mo

18 mo 14 mo 27 mo 31 mo 10 mo 9 mo

D� 24 mo D� 17 mo

Nucleotide change 836 C3T None Insertion of 416 A3G 836 C3T Insertion of None Insertion of 836 C3T Insertion of 406 G3C 417 G3T None None None Insertion of None Insertion of 892 C3T Insertion of Insertion of

� � (50%) � �

� (75%) � (75%)

152 bp at nucleotide 699 152 bp at nucleotide 699 152 bp at nucleotide 699 152 bp at nucleotide 699

152 bp at nucleotide 699 152 bp at nucleotide 699 152 bp at nucleotide 699 152 bp at nucleotide 699

Type of mutation Silent None Frameshift Silent Silent Frameshift None Frameshift Silent Frameshift Missense Missense None None None Frameshift None Frameshift Missense Frameshift Frameshift

Protein alteration

Termination at codon 201 Termination at codon 201 Termination at codon 201 Termination at codon 201 R71T V75F

Termination at codon 201 Termination at codon 201 I233T Termination at codon 201 Termination at codon 201

A�, alive with disease; D�, died of lymphoma; mo, months after taken biopsy; D�, died of other cause. nd, not done.

thymocytes, where five splice variants have been demonstrated (11). Another three different Fas splice variants have been detected in leukocytes from patients with silicosis (9). One of the regulators of alternative splicing of Fas is TIA-1, an apoptosis-promoting protein that has been shown to be expressed by neoplastic T cells in a subset of patients with MF (15, 16). In conclusion, we found a splice variant of the Fas tumor suppressor gene, associated with formation of a dysfunctional protein that dominantly interferes with Fas-induced apoptosis, frequently and specifically occurring in patients with CTCL. This could be implicated in the pathogenesis of CTCL by allowing continued clonal expansion of activated T cells and in tumor progression by reducing the susceptibility to antitumor immune responses.

splicing of Fas generating this particular variant is specific for CTCL and is an early event in lymphomagenesis. Detection of this transcript might therefore be useful in the early diagnosis of this group of lymphomas. From one patient with CD30� PCLTCL, we analyzed the presence of this splice variant in a skin biopsy specimen obtained at the time of diagnosis and in a separate skin biopsy specimen obtained 7 months later (Table 1, patient 15a and 15b). Analysis revealed the identical splice variant (Fig. 1A, Lanes 13 and 14), suggesting that alternative splicing of Fas is a persistent event. Translation of the aberrantly spliced variant results in a protein that contains 32 novel amino acid residues and terminates prematurely at codon 201. The predicted translation product encodes a form of Fas that does not contain a functional transmembrane anchor domain and lacks the death domain (Fig. 2). Therefore, if the aberrantly spliced variant is translated exclusively in a cell, the resulting aberrant Fas receptor would not be expressed on the plasma membrane. If both the wild-type and alternative transcript are translated simultaneously, assembly and expression of dysfunctional mixed receptor complexes are predicted to occur (10, 11). In skin biopsy specimens from the 15 patients with advanced CTCL, Fas protein could not be detected on neoplastic T cells in 9 cases (56%). In five of the seven skin biopsy specimens in which the splice variant was identified, Fas protein expression was not detectable (Table 1). In addition, three missense point mutations and two silent point mutations were detected in the 15 patients with advanced CTCL. Two missense point mutations detected in one patient were located in the extracellular domain (G to C at position 406 causing substitution of Thr for Arg at codon 71 and G to T at position 417 causing substitution of Phe for Val at codon 75). One point mutation (C to T at position 892 causing substitution of Thr for Ile at codon 233) was located in the cytoplasmic domain and is predicted to interfere dominantly with the function of Fas. The observed low frequency of deleterious point mutations in the Fas gene in CTCL corresponds with the recent findings of Dereure et al. (12). Although alternative splicing is used extensively by genes involved in apoptosis, a role for this mechanism in the pathogenesis of lymphoma has scarcely been described thus far (13, 14). The function of the Fas gene is regulated at the level of pre-mRNA splicing in human

Acknowledgments We appreciate the help of Dr. Zoi-Toli, Ing. P. van Beek, and Ing. A. Mulder in preparing sections and staining biopsy material.

References 1. Willemze, R., Kerl, H., Sterry, W., Berti, E., Cerroni, L., Chimenti, S., Diaz-Perez, J. L., Geerts, M. L., Goos, M., Knobler, R., Ralfkiaer, E., Santucci, M., Smith, N., Wechsler, J., van Vloten, W. A., and Meijer, C. J. EORTC classification for primary cutaneous lymphomas: a proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer. Blood, 90: 354 –371, 1997. 2. Kikuchi, A., and Nishikawa, T. Apoptotic and proliferating cells in cutaneous lymphoproliferative diseases. Arch. Dermatol., 133: 829 – 833, 1997. 3. Cascino, I., Papoff, G., De Maria, R., Testi, R., and Ruberti, G. Fas/Apo-1 (CD95) receptor lacking the intracytoplasmic signaling domain protects tumor cells from Fas-mediated apoptosis. J. Immunol., 156: 13–17, 1996. 4. Vaishnaw, A. K., Orlinick, J. R., Chu, J. L., Krammer, P. H., Chao, M. V., and Elkon, K. B. The molecular basis for apoptotic defects in patients with CD95 (Fas/Apo-1) mutations. J. Clin. Investig., 103: 355–363, 1999. 5. Chan, K. F., Siegel, M. R., and Lenardo, J. M. Signaling by the TNF receptor superfamily and T cell homeostasis. Immunity, 13: 419 – 422, 2000. 6. Zoi-Toli, O., Vermeer, M. H., De Vries, E., Van Beek, P., Meijer, C. J., and Willemze, R. Expression of Fas and Fas-ligand in primary cutaneous T-cell lymphoma (CTCL): association between lack of Fas expression and aggressive types of CTCL. Br. J. Dermatol., 143: 313–319, 2000. 7. Gronbaek, K., Straten, P. T., Ralfkiaer, E., Ahrenkiel, V., Andersen, M. K., Hansen, N. E., Zeuthen, J., Hou-Jensen, K., and Guldberg, P. Somatic Fas mutations in non-Hodgkin’s lymphoma: association with extranodal disease and autoimmunity. Blood, 92: 3018 –3024, 1998. 8. Bunn, P., and Lamberg, S. Report of the Committee on Staging and Classification of Cutaneous T-Cell Lymphomas. Cancer Treat. Rep., 63: 725–728, 1979.

5391

65


9. Otsuki, T., Sakaguchi, H., Tomokuni, A., Aikoh, T., Matsuki, T., Isozaki, Y., Hyodoh, F., Kawakami, Y., Kusaka, M., Kita, S., and Ueki, A. Detection of alternatively spliced variant messages of Fas gene and mutational screening of Fas and Fas ligand coding regions in peripheral blood mononuclear cells derived from silicosis patients. Immunol. Lett., 72: 137–143, 2000. 10. Siegel, R. M., Frederiksen, J. K., Zacharias, D. A., Chan, F. K., Johnson, M., Lynch, D., Tsien, R. Y., and Lenardo, M. J. Fas preassociation required for apoptosis signaling and dominant inhibition by pathogenic mutations. Science (Wash. DC), 288: 2354 –2357, 2000. 11. Jenkins, M., Keir, M., and McCune, J. M. A membrane-bound Fas decoy receptor expressed by human thymocytes. J. Biol. Chem., 275: 7988 –7993, 2000. 12. Dereure, O., Levi, E., Vonderheid, E. C., and Kadin, M. E. Infrequent Fas mutations but no Bax or p53 mutations in early mycosis fungoides: a possible mechanism for the

accumulation of malignant T lymphocytes in the skin. J. Investig. Dermatol., 118: 949 –956, 2002. 13. Jiang, Z., and Wu, J. Alternative splicing and programmed cell death. Proc. Soc. Exp. Biol. Med., 220: 64 –72, 1999. 14. Xerri, L., Hassoun, J., Devilard, E., Birnbaum, D., and Birg, F. BCL-X and the apoptotic machinery of lymphoma cells. Leuk. Lymphoma, 28: 451– 458, 1998. 15. Forch, P., Puig, O., Kedersha, N., Martinez, C., Granneman, S., Seraphin, B., Anderson, P., and Valcarcel, J. The apoptosis-promoting factor TIA-1 is a regulator of alternative pre-mRNA splicing. Mol. Cell, 6: 1089 –1098, 2000. 16. Vermeer, M. H., Geelen, F. A., Kummer, J. A., Meijer, C. J., and Willemze, R. Expression of cytotoxic proteins by neoplastic T cells in mycosis fungoides increases with progression from plaque stage to tumor stage disease. Am. J. Pathol., 154: 1203–1210, 1999.

5392

66

Chapter 6

Aberrant expression of the tyrosine kinase receptor EphA4 and the transcription factor Twist in Sezary syndrome identified by gene expression analysis

Cancer Res. 2004 Aug. 15;64(16)5578-86

[CANCER RESEARCH 64, 5578 –5586, August 15, 2004]

Aberrant Expression of the Tyrosine Kinase Receptor EphA4 and the Transcription Factor Twist in Se´zary Syndrome Identified by Gene Expression Analysis Remco van Doorn, Remco Dijkman, Maarten H. Vermeer, Jacoba J. Out-Luiting, Elisabeth M. H. van der Raaij-Helmer, Rein Willemze, and Cornelis P. Tensen Department of Dermatology, Leiden University Medical Center, Leiden, the Netherlands

ABSTRACT Se´zary syndrome (Sz) is a malignancy of CD4� memory skin-homing T cells and presents with erythroderma, lymphadenopathy, and peripheral blood involvement. To gain more insight into the molecular features of Sz, oligonucleotide array analysis was performed comparing gene expression patterns of CD4� T cells from peripheral blood of patients with Sz with those of patients with erythroderma secondary to dermatitis and healthy controls. Using unsupervised hierarchical clustering gene, expression patterns of T cells from patients with Sz were classified separately from those of benign T cells. One hundred twenty-three genes were identified as significantly differentially expressed and had an average fold change exceeding 2. T cells from patients with Sz demonstrated decreased expression of the following hematopoietic malignancy-linked tumor suppressor genes: TGF-� receptor II, Mxi1, Riz1, CREB-binding protein, BCL11a, STAT4, and Forkhead Box O1A. Moreover, the tyrosine kinase receptor EphA4 and the potentially oncogenic transcription factor Twist were highly and selectively expressed in T cells of patients with Sz. High expression of EphA4 and Twist was also observed in lesional skin biopsy specimens of a subset of patients with cutaneous T cell lymphomas related to Sz, whereas their expression was nearly undetectable in benign T cells or in skin lesions of patients with inflammatory dermatoses. Detection of EphA4 and Twist may be used in the molecular diagnosis of Sz and related cutaneous T-cell lymphomas. Furthermore, the membrane-bound EphA4 receptor may serve as a target for directed therapeutic intervention.

INTRODUCTION Se´zary syndrome (Sz) is a leukemic variant of cutaneous T cell lymphoma (CTCL) characterized by erythroderma, generalized lymphadenopathy, and the presence of neoplastic CD4� skin-homing memory T cells (Se´zary cells) in the skin, lymph nodes, and peripheral blood (1, 2). In the early phases of the disease, differentiation between Sz and benign forms of erythroderma secondary to atopic dermatitis, chronic dermatitis, or adverse drug reactions may be very difficult. Because of the similarity of their histopathological and immunophenotypical features, Sz is generally considered to be a leukemic variant of the more common CTCL mycosis fungoides (3). Severe pruritus, ectropion, alopecia, palmoplantar keratoderma, and generalized immunosuppression are common associated features. The results of various treatments for Sz are generally disappointing. Subjects with Sz have an unfavorable prognosis with an estimated 5-year survival of 15% (4). Previous studies on the pathogenesis of Sz have pointed to aberrations of signaling by the STAT family of transcription factors (5– 8), overexpression of JunB (9), diminished expression of the tumor suppressor genes TGF-� receptor II (10), p15, p16 (11), and Fas (12). Other studies have pointed to the presence of chromosomal alterations, indicating genomic instability (13, 14). Nonetheless, compreReceived 4/13/04; revised 6/14/04; accepted 6/22/04. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Note: R. van Doorn and R. Dijkman contributed equally to this study. Requests for reprints: Cornelis P. Tensen, Department of Dermatology, Sylvius Building Room 3042, Wassenaarseweg 72, 2333 AL Leiden, the Netherlands. Phone: 31-71-5271900; Fax: 31-71-5271910; E-mail address: [email protected].

hension of the pathogenic mechanisms implicated in the development and progression of this T-cell malignancy is still limited. To expand the understanding of the pathogenesis and to facilitate the molecular diagnosis of Sz, we performed oligonucleotide array analysis on T cells isolated from the peripheral blood of patients with Sz. Gene expression patterns were compared with those of CD4� T cells isolated from the blood of patients with erythroderma secondary to atopic or chronic dermatitis and of healthy volunteers. The gene expression patterns of malignant T cells from patients with Sz demonstrated consistent differences with those of benign T cells. The transcriptional program distinctive for the malignant phenotype revealed evidence for the dysregulation of multiple growthregulatory signal transduction pathways, such as the TGF-� receptor and c-myc pathway. We identified high and selective expression in Sz and related CTCLs of the tyrosine kinase receptor EphA4 and the transcription factor Twist. These genes, which may also be implicated in the pathogenesis of Sz, could serve as molecular markers in the diagnosis or as therapeutic targets in the treatment of this malignancy. MATERIALS AND METHODS Selection of Patients. Cryopreserved blood samples from 10 patients with Sz (seven males, three females; median age 62 years) were available for inclusion in this study. Sz was defined by the criteria of the European Organization for Research and Treatment of Cancer classification (4). All patients showed highly elevated CD4/CD8 ratios and clonal T cells in the peripheral blood, as described previously (15). Follow-up data revealed that all patients had died of Sz; the median survival time was 26 months. For comparative analysis, blood samples were obtained from a group of eight control patients that included five patients with a benign form of erythroderma (BE; three males, two females; median age, 57 years) and three healthy volunteers. The BE group included three patients with atopic dermatitis and two with idiopathic chronic dermatitis. Examination of the peripheral blood in these five BE patients showed an absence of atypical T cells, normal CD4/CD8 ratios, and no evidence of a T cell clone. Follow-up (median duration 29 months) was unremarkable. From all Sz patients and controls, peripheral blood samples were collected at the time of diagnosis before systemic or phototherapeutic treatment had been given. In addition, for realtime quantitative PCR experiments, lesional skin biopsy specimens from patients with plaque-stage (T2N0M0) and tumor-stage (T3N0M0) mycosis fungoides as well as primary cutaneous CD30-negative large T cell lymphoma were obtained. As controls for these experiments phytohemagglutinin-activated and interleukin 2-expanded peripheral blood T cells as well as biopsies of benign cutaneous lymphocytic infiltrates from patients with inflammatory skin diseases (M. Jessner, chronic discoid lupus erythematosus, graft-versushost disease, benign erythroderma secondary to dermatitis, lichen planus, and cutaneous vasculitis) were used. T-Cell Isolation and RNA Isolation. Peripheral blood mononuclear cells were obtained by Ficoll density centrifugation. The percentage of CD4� Sz cells in the peripheral blood mononuclear cells samples of Sz patients ranged from 90 to 97%, as verified by fluorescence-activated cell sorter analysis. Mononuclear cells of the patients with BE and from healthy volunteers were subjected to further purification by negative selection using magnetic beads (CD4� T-cell isolation kit, Miltenyi Biotec, Bergisch Gladbach, Germany). The purification of control samples yielded �95% CD4� T cells, similar to the percentage of CD4� T cells in peripheral blood mononuclear cell samples from Sz patients. RNA was extracted from T-cell samples and homogenized cryopreserved skin biopsy samples using the RNeasy kit (Qiagen, Hilden, Germany).

5578

69

GENE EXPRESSION PROFILING OF SE´ZARY SYNDROME

Table 1 Sequences of primers used for amplification of selected transcripts by qPCR Name

Accession

Forward primer (5�-3�)

Reverse primer (5�-3�)

Product size (bp)

EphA4 Twist STAT4 TNFSF7 LCK CREBBP TGF-� R2 SATB1 CCR4 KIR3DL2

L36645 BC036704 L78440 L08096 AF228313 AJ251843 M85079 NM_002971 NM_005508 AF263617

ggaaggcgtggtcactaaat cactgaaaggaaaggcatca cagaaaggggtgacaaaggt atcacacaggacctcagcag ctacgggacattcaccatca cacaagtccatttggacagc atctcgctgtaatgcagtgg gacttttagcccagcagtcc actgctgccttaatcccatc gggacctcagtggtcatctt

tctgccatcatttttcctga ggccagtttgatcccagtat atgggaagaaggtctgatgg atacgtagctgccccttgtc gttggtcatccctgggtaag gttgaccatgctctgtttgc cacgttgtccttcatgcttt gtgttggtcgaaacctgttg ccacagtattggcagagcac gctcttggtccattacagca

96 107 102 105 99 99 99 102 111 99

NOTE. Also indicated are sizes of the PCR products and accession numbers of the respective genes. Abbreviation: bp, base pair(s).

Fig. 1. Unsupervised hierarchical clustering of gene expression profiles generated from CD4� T cells from peripheral blood of 10 patients with Sz, CD4� T cells from three healthy volunteers, and five patients with BE. The dendrograms are generated using a hierarchical clustering algorithm on 12,625 transcripts based on the average-linkage method.

Preparation and Hybridization of Fluorescent-Labeled antisense RNA. Samples and microarrays were processed according to the manufacturer’s protocol (available from Affymetrix, Santa Clara, CA). In brief, using the MessageAmp antisense RNA kit (Ambion, Huntingdon, United Kingdom), total RNA was reverse transcribed using an oligodeoxythymidylic acid-T7 promoter primer to prime first-strand synthesis. After second-strand synthesis, the purified cDNA product was in vitro transcribed using T7 RNA polymerase, biotin-UTP, and biotin-CTP to generate fragmented biotinylated antisense RNA. Fragmented antisense RNA (5 �g) was hybridized to a Human Genome U95Av2 Array (Affymetrix), interrogating 12,625 human transcripts, for 16 h at 45°C with constant rotation at 60 rpm. After hybridization, the microarray was washed, stained on an Affymetrix fluidics station, and scanned with an argon-ion confocal laser with 488-nm excitation and 570-nm detection wavelengths. Microarray Experimental Design and Data Analysis. The array images were quantified using MicroArray Suite v5.0 software (Affymetrix, Santa Clara, CA). The average fluorescence intensity was determined for each microarray, and then the output of each experiment was globally scaled to 200. Normalization was performed using variant stability and normalization (16) part of the R statistical software package.3 Significance analysis of microarrays (SAM; ref. 17) was applied to compare gene expression patterns of T cells from 10 Sz patients with those of the eight controls. A false discovery rate of �1 was chosen to select genes significantly up- or down-regulated. Gene expression patterns were further analyzed, and output was visualized using Spotfire DecisionSite (Spotfire, Go¨teborg, Sweden) and MicroArray Suite v5.0 software. Real-Time Quantitative PCR. cDNA synthesis was performed on 1 �g of total RNA after treatment with RQ1 DNase I (Promega, Madison, WI) using Superscript III reverse transcriptase (Invitrogen, Breda, the Netherlands) and an oligo(dT)12–18 primer (Invitrogen, Breda, the Netherlands) in a final volume of 20 �l. Real-time quantitative PCR (qPCR) was performed using SYBR Green PCR Master Mix in an ABI-Prism 7700 sequence detection system (Applied Biosystems, Nieuwerkerk aan den IJssel, the Netherlands). The primer sequences (Invitrogen) of selected transcripts are given in Table 1. The cycle parameters for these transcripts and for the housekeeping genes U1A and RPS11 used for normalization were as follows: denaturing for 15 s at 95°C; annealing and extension for 60 s at 60°C, for 40 cycles. Specificity of the PCR product was confirmed by agarose gel electrophoresis and subsequent DNA 3

www.bioconductor.org.

sequence analysis of test samples and melting curve analysis in the case of patient material. The crossover point (Ct) values, defined as the cycle number at which each curve intersects the threshold detection value, were used to calculate the gene-specific input mRNA amount for each tissue according to the calibration curve method. Data were evaluated using the SDS software version 1.9.1 (Applied Biosystems) and the second derivative maximum algorithm.

RESULTS Distribution of Gene Expression. Initial analysis of the hybridization signal of the 12,625 transcripts represented on the oligonucleotide array revealed that malignant T cells of Sz patients on average expressed 6,100 of the interrogated genes; in CD4� T cells from peripheral blood of BE patients and healthy volunteers 5,771 respectively 5,975 of the genes were expressed. Analysis of the entire set of expressed genes using an unsupervised hierarchical clustering analysis algorithm, grouping the samples on the basis of similarity of their expression profiles, showed that the Sz samples display a relatively homogeneous gene expression pattern that is classified separately from that of benign CD4� T cells (see Fig. 1 for dendrogram representing cluster analysis of the entire set of expressed genes). The transcript profiles of T cells from patients with BE were markedly different from those of Sz patients and were more related to transcript profiles of T cells from healthy volunteers. Se´zary Syndrome-Specific Gene Expression Pattern. Comparative analysis of the 10 Sz samples with the 8 control samples implementing the SAM algorithm demonstrated that 176 genes were statistically significantly differentially expressed at P � 0.01. Of these genes significant in the separation of Sz CD4� T cells and benign CD4� T cells, 69 were relatively overexpressed, with fold changes ranging from 1.7 to 19.8. One hundred and seven genes were downregulated in the malignant T cells, with fold changes ranging from 1.4 to 13. Of the 176 significantly differentially expressed genes, 123 genes were up- or down-regulated with fold changes exceeding 2. Comparative gene expression profiles of these 59 overexpressed and 64 underexpressed genes are shown in Fig. 2.

5579

70


A

Sézary Syndrome

Healthy Benign Controls Erythroderma Fold Change 12,59 tumor necrosis factor (ligand) superfamily, member 11 (RANKL) 6,91 protein tyrosine phosphatase, receptor type, N polypeptide 2 4,97 EphA4 4,83 protein kinase, cAMP-dependent, regulatory, type K, alpha 3,86 interleukin 6 receptor 3,41 tumor necrosis factor (ligand) superfamily, member 7 (DC70) 3,37 SHP2 interacting transmembrane adaptor 3,22 SH2 domain protein 1A 3,11 protein kinase (cAMP-depenent, catalytic) inhibitor alpha 3,06 calcium/calmodulin-dependent serine protein kinase 2,46 integrin, beta 1 2,32 mitogen-activated protein kinase 1 2,3 serine/threonine kinase 38 2,19 PI3-kinase, regulatory subunit, polypeptide 3 (p55, gamma) 2,16 RAS p21 protein activator (GTPase activating protein) 1 2 ADP-ribosylation factor related protein 1 19,82 transcription factor AP-2 alpha 10,11 Twist 4,48 RecQ protein-like (DNA helicase Q1-like) 3,09 sin3-associated polypeptide, 18kDa 2,59 high mobility group nucleosomal binding domain 4 2,57 zinc finger protein 146 2,38 SMARC D2 2,36 c-myc binding protein 2,17 transcription factor 12 2,11 nuclear factor (erythroid-derived 2)-like 1 2,53 NS1-binding protein 2,35 nuclear cap binding protein subunit 2, 20kDa 3,78 phenylalanine-tRNA synthetase-like 3,06 testis enhanced gene transcript (BAX inhibitor 1) 4,41 acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain 3,83 cytochrome b5 outer mitochondrial membrane precursos 3,35 acyl-Coenzyme A oxidase 3, pristanoyl 2,59 aconitase 2, mitochondrial 2,55 phosphoribosyl pyrophhosphate synthetase-associated protein 1 2,41 15kDa selenoprotein 2,41 uncoupling protein 2 2,34 phosphoglucomutase 1 2,3 AAS dehydrogenase-phosphopantetheinyl transferase 2,13 ATP synthase f chain, mitochondrial 2,45 transmembrane 9 superfamilyy member 1 2,21 tetracycline transporter-like protein 3,73 Vacuolar ATP synthase subunit C 2,18 acid phosphatase 2, lysosomal 5,28 unc-84 homolog A 3,46 ARP2 actin-related protein 2 homolog 3,07 dynein, cytoplasmic, intermediate polypeptide 2 2,87 actin related protein 2/3 complex, subunit 5, 16kDa 2,1 actin related protein 2/3 complex, subunit 4, 20kDa 7,39 sialyltransferase 8A 6,03 parathyroid hormone-like hormone 4,44 ceroid-lipofuscinosis, neuronal 5 3,89 presenilin 1 3,01 coproporphyrinogen oxidase 2,97 MHC class I region ORF 2,86 tumor differentially expressed 1 2,47 neutral sphingomyelinase activation associated factor 2,4 BAI1-associated protein 3 2,37 telomeric repeat binding factor 1 (TRF1)

Signal transduction

Transcriotion regulation

RNA processing Translation Apoptosis

Metabolism

Transport Degradation Cytoskeleton

Miscellaneous

z-score

2

0

-2

Fig. 2. Supervised analysis performed on 10 tumor samples of CD4� T cells from peripheral blood of patients with Sz versus eight control samples, consisting of CD4� T cells from three healthy volunteers and five patients with BE. Represented genes are selected by the SAM algorithm and have an average fold change exceeding 2. Values are visualized according to the scale bar that represents the difference in the z-score (expression difference/SD) relative to the mean. A, the analysis identified 69 genes that are up-regulated in CD4� T cells from peripheral blood of patients with Sz compared with the controls. Fold change denotes the ratio of average normalized expression level in the Sz and the control group of samples. B, 107 genes are down-regulated in CD4� T cells from peripheral blood of patients with Sz compared with the controls. Fold change denotes the ratio of average normalized expression level in the control and the Sz group of samples.

Table 2 displays the most discriminating genes, according to fold change between average expression levels in the malignant T cells compared with the benign T cells. The most differentially expressed genes, with fold changes exceeding 10, were the transcription factor activator protein 2-�; dual specificity phosphatase 8; the tumor necrosis factor (TNF) receptor family ligand, receptor activator of nuclear factor-�B ligand (RANKL; TNFSF11); and the transcription factor Twist. Among the genes highly overexpressed in T cells of Sz patients, especially up-regulation of the genes Twist and EphA4 was consistently seen. Transcripts of Twist and EphA4 were present in 9 respectively 8 of 10 Sz samples. Expression of the following genes was undetectable in any of the control samples but present in Sz T cells: EphA4 (expressed in 8 of 10 Sz samples), phenylalanine-tRNA synthetase-like (expressed in 7 of 10 Sz samples), RANKL (expressed in 7 of 10 Sz samples), transcription factor activator protein 2-� (expressed in 3 of 10 Sz samples), and peroxisomal

acyl-CoA oxidase 3 (expressed in 3 of 10 Sz samples). Although the level of RANKL transcript level was undetectable in benign T cells in this array analysis study, it is normally expressed by activated T cells (18). Interestingly, phenylalanine-tRNA synthetase-like transcript has been demonstrated previously to be expressed in a human acute-phase chronic myeloid leukemia cell line but not in its non-tumorigenic variant, suggesting that selective expression of this member of the tRNA synthetase family is more common in hematopoietic neoplasms (19). Real-Time Quantitative PCR of Selected Genes, Including EphA4 and Twist. To validate the results of microarray analysis data, qPCR was applied on a panel of 10-selected genes. As Fig. 3A shows, qPCR results were all in agreement with gene-profiling data. In general, differences in transcript levels between malignant and benign T cells appeared to be more pronounced when measured by qPCR compared with oligonucleotide microarray analysis. Next we evaluated the expression of EphA4 and Twist, the two

5580

71


B

Sézary Syndrome

Healthy Benign Controls Erythroderma Fold Change 13,02 5,39 4,75 3,56 3,44 2,83 2,73 2,69 2,17 2,09 2,06 5,61 4,62 4,47 3,33 3,16 3,14 3,00 2,84 2,71 2,69 2,68 2,65 2,57 2,47 2,44 2,41 2,39 2,37 2,15 2,12 2,11 3,09 3,01 2,68 2,49 2,37 2,11 2,10 2,32 4,67 2,45 4,30 2,75 5,22 4,31 2,42 2,24 2,21 2,06 2,80 2,25 2,16 2,15 7,29 2,49 2,41 2,26 3,25 7,40 4,02 3,28 2,40 2,14

Signal transduction

Transcriotion regulation

RNA processing

Translation Apoptosis Cell ccle regulation Metabolism

Transport

Degradation Cytoskeleton Miscellaneous

dual specificity phosphatase 8 iller cell lectin-like receptor subfamily B, member 1 transforming growth factor, beta receptor II (70/80kDa) guanine nucleotide binding protein (G protein), alpha 15 (Gq class) C-type lectin, superfamily member 2 (activation-induced) son of sevenless homolog 2 serine/threonine kinase 17b (apoptosis-inducing) activated p21cdc42Hs kinase A kinase (PRKA) anchor protein 8 CD6 antigen transforming growth factor, beta 1 signal transducer and activator of transcription 4 special AT-rich sequence binding protein 1 PR domain containing 2, with ZNF domain ring finger protein 10 basic transcription element binding protein 1 CBF1 interacting corepressor heat shock transcription factor 2 MXI1 gene product, mRNA sequence mediator of RNA polymerase II transcription, subunit 6 homolog MAX binding protein CCAAT-box-binding transcription factor H1 histone family, member X basic helix-loop-helix domain containing, class B, 2 POU domain, class 2, transcription factor 1 SON DNA binding protein chromodomain helicase DNA binding protein 3 putative DNA/chromatin binding motif CREB binding protein forkhead box O1A BcI-2-associated transcription factor PHD finger protein 1 splicing factor, arginine/serine-rich 12 RNA, U17D small nucleolar small nuclear ribonucleoprotein polypeptide A’ serine/arginine repetitive matrox 2 U2-associated SR140 protein PRP8 pre-mRNA processing factor 8 homolog heterogeneous nuclear ribonucleoprotein A1 eukaryotic translation initiation factor 5 BCL2-like 11 B-cell CLL/lymphoma 2 BTG family, member 3 M-phase phosphoprotein 9 short-chain dehydrogenase/reductase 1 proprotein convertase subtilisin/kexin type 5 non-metastatic cells 4, protein expressed in dihydrolipoamide S-succinyltransferase histidine decarboxylase Rab geranylgeranyltransferase, beta subunit Sec23-interacting protein p125 nucleoporin 98kDa nucleoporin 88kDa potassium voltage-gated channel, KQT-like subfamily, member 1 glutathione S-transferase M1 F-box and leucine-riche repeat protein 11 ubiquitin-conjugating enzyme E2, J1 glutathione S-transferase M4 diaphanous homolog 2 amyloid beta (A4) precursor protein-binding, family A, member 2 monocyte to macrophage differentiation-associated ectodermal-nneural cortex (with BTB-like domain) rearranged L-myc fusion sequence cryptochrome 2 (photolyase-like)

z-score Fig. 2 Continued

most selectively and consistently up-regulated genes in the malignant T cells of Sz patients, using qPCR in a larger set of CTCL and control samples. To assess whether EphA4 and Twist were also expressed by malignant T cells of patients with mycosis fungoides and CD30negative primary cutaneous large T-cell lymphoma, transcript levels were analyzed in lesional skin biopsy samples of patients with these

2

0

-2

Sz-related CTCLs. Included as additional controls were T cells in vitro activated with phytohemagglutinin and expanded with interleukin-2 as well as lesional skin biopsy samples from patients with T cell-rich inflammatory dermatoses. EphA4 was highly expressed in lesional skin of three of nine patients with mycosis fungoides, whereas its expression was nearly undetectable in any of the

Table 2 List of 10 transcripts including fold change that are most significantly up- or down-regulated in CD4� T cells from patients with Sz when comparing average expression levels to those in CD4� T cells from controls Up-regulated in Sézary syndrome

Down-regulated in Sézary syndrome

Gene description

Fold change

Gene description

Fold change

Transcription factor AP2-� Twist TNFSF11 (RANKL) Protein tyrosine phosphatase, receptor type, N polypeptide 2 Parathyroid hormone-like hormone Sialyltransferase 8A Unc-84 homolog A EphA4 Protein kinase, cAMP-dependent, regulatory, type I, � RecQ protein-like (DNA helicase Q1-like)

19.82 12.59 10.11 7.39 6.91 6.03 5.28 4.97 4.83 4.48

Dual specificity phosphatase 8 Amyloid beta (A4) precursor protein-binding, family A, member 2 Glutathione S-transferase M1 STAT4 Killer cell lectin-like receptor subfamily B, member 1 Short-chain dehydrogenase/reductase 1 TGF-� receptor II BCL2-like 11 (Bcl-11a) Special AT-rich sequence binding protein 1 (SATB1) PR domain containing 2 (PRDM2, Riz1)

13.02 7.4 7.29 5.61 5.39 5.22 4.75 4.67 4.62 4.47

5581

72


Fig. 3. Results of real-time quantitative PCR analysis. A, histogram showing expression levels of 10-selected genes as measured by oligonucleotide array analysis (f) and qPCR (�). Fold change of oligonucleotide and qPCR experiments denote average expression level in patients with Sz relative to average expression level in controls. For qPCR experiments, expression levels of the gene of interest were normalized to those of two housekeeping genes. B, histogram showing expression level of the EphA4 gene as measured by qPCR in peripheral blood T cells of Sz patients, BE patients, healthy volunteers, in vitro-stimulated peripheral blood T cells, as well as in lesional skin biopsy samples from patients with cutaneous T-cell lymphoma and various inflammatory skin diseases. C, histogram showing expression level of the Twist gene as measured by qPCR in these samples. Fold change denotes the expression of EphA4 or Twist relative to expression of the housekeeping gene U1A. MF, mycosis fungoides; CD30-PCLTCL, CD30-negative primary cutaneous large T-cell lymphoma; PHA, phytohemagglutinin; PBL-T, peripheral blood T cells; CDLE, chronic discoid lupus erythematosus.

isolated or in vitro-activated T cell samples (Fig. 3B). In the benign lesional skin biopsy samples, occasionally weak expression of EphA4 was observed, which might be attributable to the presence of endothelial cells in skin that have been reported to be capable of expressing the EphA4 receptor. The Twist gene was overexpressed in four of nine mycosis fungoides skin biopsy samples including one patient with patch-stage disease, whereas its expression in control samples was only weak or absent (Fig. 3C). Expression Patterns of Genes Reported to Be Differentially Expressed in Se´zary Syndrome. Subsequently we evaluated the transcript levels of selected genes reported in the literature to be specifically or differentially expressed by Sz T cells. Presented in Fig. 4 are Sz-associated genes reported in previous publications accompanied by a heat map indicating the relative expression levels of each gene in Sz and control samples resulting from our microarray analysis. It should be mentioned that for some of the selected genes, different expression has been described on the protein level but not on

the mRNA level. As Fig. 3 shows, consistent with reports from the literature, we found high expression of JunB (9), versican (20), TRAIL (20), T-plastin (22), Kir3DL2 (23), integrin �1 (26), as well as low expression of STAT4 (6), TGF-� receptor II (10), Fas (12) and CD26 (33) in Sz T cells. In addition to the reported selective expression of the killer cell immunoglobulin-like receptor KIR3DL2, we found expression of KIR2DL4 transcript by Sz cells. We did not observe aberrant expression of MAGE1 (34), P-glycoprotein (35), or SOCS3 (36). Contradictory to previous reports we found increased rather than decreased levels of TIA1 (30) and SHP1 (31) transcripts. DISCUSSION The purpose of this study was to apply gene expression analysis using oligonucleotide microarrays to gain more insight into the pathogenesis of Sz and to identify tumor-associated markers for potential use in the diagnosis and therapy of this malignancy. We compared

5582

73


Fig. 3

gene expression patterns of malignant T cells from peripheral blood of patients with Sz with expression of CD4� T cells from healthy volunteers and from patients with benign forms of erythroderma. Microarray results were validated by real-time quantitative PCR on a subset of genes. Transcriptional profiles of Sz T cells demonstrated to be relatively homogeneous and unsupervised hierarchical clustering revealed that malignant T-cell profiles were classified separately from those of benign T cells used as controls. The expression patterns of T cells from patients with BE were more related to those of T cells from healthy volunteers than to those of T cells from Sz patients. By implementing the SAM algorithm, 176 genes were identified that were significantly differentially expressed in the 10 Sz samples compared with the group of eight control samples. Fifty-nine of these differentially expressed genes were up-regulated, and 64 genes were down-regulated �2-fold (Fig. 2). Approximately half of the genes encode proteins that function in cell signaling and transcription regulation. First, we examined these differentially expressed genes to identify genes specifically expressed in Sz that might serve as tumor-associated markers. Second, we attempted to discern oncogenic pathways in this transcriptional pattern that separates malignant T cells of Sz patients from benign T cells. Among the most highly overexpressed genes in Sz, two genes (Twist and EphA4) were very consistently up-regulated, whereas transcripts were nearly undetectable in any of the control samples. The potential tumor-associated gene Twist was expressed in 9 of 10 Sz patient T-cell samples and only weakly in one of the control samples; the average fold change was 12.6. The Twist gene encodes a transcription factor that functions as a regulator of mesodermal differentiation and is normally not expressed in lymphoid cells (37, 38). Twist belongs to the basic helix-loop-helix family of transcription factors, several members of which are known to be T-cell oncoproteins (39). Twist has been shown to have oncogenic properties because it can prevent c-myc-induced apoptosis by antagonizing the p53 pathway (40). The antiapoptotic properties of Twist have additionally

Continued

been suggested by its interaction with components of the nuclear factor-�B pathway regulating susceptibility to TNF-�-induced apoptosis (41). Interestingly the nuclear factor-�B pathway, which both regulates and is regulated by Twist activity in mammalian cells, has been reported to be constitutively activated in CTCL cells (42). In human rhabdomyosarcoma and experimental avian nephroblastoma, increased expression of the Twist gene was noted (40, 43). It was shown recently that overexpression of Twist in cancer cell lines is associated with acquisition of resistance to the anticancer drugs taxol and vincristine (44). However, it remains to be established whether increased expression of Twist also has an important role in the pathogenesis of Sz. EphA4, another potential tumor-associated marker that was highly expressed in 8 of 10 Sz T-cell samples and none of the control samples, belongs to the Eph-receptor subfamily of transmembrane protein-tyrosine kinases (45– 47). The expression of Eph receptors has been found most consistently in brain where they are implicated in regulation of neuronal migration and angiogenesis (48, 49). Recently, EphA4 and active signaling by this receptor has been demonstrated in human T cells (50). However, its function in T cells is not clear; nor is it clear whether expression of EphA4 is confined to a specific subset of T cells. Expression of Eph receptors has been linked to malignant transformation. The EphA2 receptor, closely related to EphA4, is highly expressed in several human cancers such as breast, colon, and prostate carcinoma where it has been demonstrated to function as an oncoprotein (51, 52). A possible functional role of EphA4 tyrosine kinase activity in the pathogenesis of Sz may be suspected because components of its downstream signal transduction pathway such as Fyn, Grb2, and Abl were also found to be up-regulated in Sz T cells. Recently activation of EphA4 was described to activate Jak/STAT signaling and induce phosphorylation of STAT3, a transcriptional activator reported to be constitutively phosphorylated in malignant T cells of Sz patients (5, 7, 53). If EphA4 expression would also be functionally significant in Sz T cells, this membrane-bound receptor would constitute an attractive target for therapeutic intervention using

5583

74


Sézary Syndrome

A

Fig. 4. Expression patterns of selected genes reported in the literature to be differentially expressed in T cells of patients with Sz. Values are visualized according to the scale bar that represents the difference in the z-score (expression difference/SD) relative to the mean, similar to Fig. 2. A, relative normalized expression levels of genes reported to be overexpressed in Sz. B, relative normalized expression levels of genes reported to be underexpressed in Sz.

Healthy Benign Controls Erythroderma

Versican (chondroitin sulfate proteoglycan 2) 20 TRAIL (TNFSF10) 20 Ras homolog gene family, member B (ARHB) 20 T-plastin (plastin 3, T-isoform) 21 L-selectin (CD62L) 22 KIR3DL2 (CD158k, NKAT4) 23 JunB 9 Interferon inhibiting cytokine (IK cytokine) 24 Interferon-γ receptor accessory factor-1 (AF-1) 25 Integrin β1 26 IL-7 receptor 27 IL-11 receptor (α chain) 20 GATA-3 20 DUSP1 20 CD15 (fucosyltransferase 4) 28 ILT2 receptor (CD85j, LILRB1) 29

B

TIA1 30 TGF-β receptor II 10 STAT4 6 SHP1 (PTPN6, PTP1c) 31 p53 32 LFA-1 (β subunit) 22 LFA-1 (α subunit) 22 interleukin 2 receptor (β subunit) 20 interleukin 1 receptor type II 20 interleukin 2 receptor type 1 20 Fas (CD95, TNFRSF6) 12 integrin α4 (α4β1, CD49d, CD29) 28 CD26 (dipeptidyl peptidase IV) 33 CD40 (TNFRSF5) 20 z-score

monoclonal antibodies or small molecular inhibitors of its kinase domain. Both EphA4 and Twist appeared to be expressed in lesional skin biopsy samples of a subset of patients with mycosis fungoides, a more common CTCL related to Sz, and CD30-negative primary cutaneous T cell lymphoma, but not or only weakly in skin lesions of patients with inflammatory dermatoses. This observation indicates that aberrant expression of these two genes is not limited to malignant T cells of Sz patients and might be a feature of CTCL other than Sz. The transcriptional profile of Sz T cells demonstrated dysregulation of several other potentially oncogenic signal transduction pathways. We observed a general increased expression of growth-promoting tyrosine kinases including several mitogen-activated protein kinases and decreased expression of inactivating phosphatases such as dual specificity phosphatase 8. In T cells from Sz patients, the expression of a number of tumor suppressor genes that are known to be implicated in the pathogenesis of hematopoietic neoplasms was diminished, including the histone methyltransferase PRDM2 (Riz1; 54), the proapoptotic protein Bcl-11a (55), CREB-binding protein (56), TGF-� receptor II (10), Mxi1 (57), and Forkhead box O1A (FOXO1A, FKHR; 58). A recurrent feature of Sz cells in our study was the decreased expression of the tumor suppressor gene TGF-� receptor II and of its ligand TGF-�1. Also its downstream signaling components SMAD3 and SMAD7 were significantly down-regulated in T cells from Sz patients, with fold changes of 1.8 and 1.7, respectively. The resulting disruption of the TGF-� receptor signaling pathway is associated with

0

-2

loss of growth inhibition by TGF-�, an antiproliferative and proapoptotic cytokine for lymphoid cells (59). Diminished cell surface expression of the TGF-� receptor II protein on CD4� T cells from Sz patients and loss of sensitivity to TGF-� in the progression of CTCL have been described previously (60, 61). The consistent down-regulation of multiple components of the TGF-� receptor pathway in patients with Sz supports the notion that abrogation of this signaling pathway is a critical event in the pathogenesis of this malignancy. The tumor suppressor genes Mxi1 and Mnt, which both antagonize the activity of the potentially oncogenic transcription factor c-myc (62), were consistently down-regulated in the malignant T cells. In addition, malignant T cells in Sz demonstrate high expression of MycBP (Amy1) that encodes a protein that stimulates transcriptional activity of c-myc (63). In mice, targeted deletion of the Mxi1 gene results in a phenotype that shows concordance with that of c-mycoverexpressing mice, including predisposition to the development of lymphomas, implying that Mxi1 functions as a tumor suppressor gene in lymphoid cells (57). Interestingly, the Mxi1 gene is located at chromosome 10q24 –26 and the Mnt gene at 17p13.3, chromosomal regions that are frequently lost in Sz cells as shown by cytogenetic studies (14). Although the c-myc gene itself was not consistently overexpressed in the malignant T cells, potentially oncogenic activation of the c-myc pathway could result from altered expression of three of its regulatory proteins, Mxi1, Mnt, and MycBP (62). Another tumor suppressor gene, which may be relevant in the pathogenesis of Sz and which was down-regulated in T-cell samples from each Sz patient with an average fold change of 2.2, is the

5584

75

2


transcription factor FOXO1A. FOXO1A is a downstream target of the phosphatidylinositol 3�-kinase-PTEN-AKT signal transduction pathway (64). Dysregulation of this pathway is a critical event in several hematopoietic neoplasms such as T-cell chronic lymphocytic leukemia (65). In addition, T cell-specific deletion of PTEN in mice has been shown to result in the development of CD4� T-cell lymphomas (66). An essential role of FOXO1A in the lymphomagenic properties of this signaling pathway is suggested by the recent observation that in PTEN-deficient cells tumorigenicity is reversed by restoration of FOXO1A activity (67). It therefore seems likely that the loss of FOXO1A expression has pro-oncogenic consequences, comparable with those conferred by the loss of PTEN. Another noticeable feature of the expression pattern particular to Sz T cells is increased expression of the TNF receptor ligands TNFSF7 (CD70) and TNFSF11 (RANKL) in 7 respectively 8 of 10 Sz patients. Deregulated expression of several other members of the TNF receptor family CD40, CD40L and TRAIL has been reported previously in related CTCLs (20, 68, 69). In Sz T cells, overexpression of the TNFSF7 gene encoding the transmembrane protein CD70 is paralleled by high expression of its receptor CD27. CD70 is normally only transiently expressed on antigen-activated T cells and interaction with its receptor CD27 promotes T-cell proliferation and effector T-cell functions (70, 71). In transgenic mice, constitutive expression of CD70 leads to a state of chronic immune activation with excessive formation of effector T cells and progressive depletion of naive T cells resulting in lethal T-cell immunodeficiency (72). Also RANKL can induce inappropriate immune activation through enhancing the costimulatory properties of dendritic cells (18, 73). Sz patients can also be severely immunocompromised and susceptible to opportunistic infection, one of the main causes of mortality in these patients. It has been proposed that the immunodeficiency observed in advanced CTCL is caused primarily by T-cell depletion (74). Indicative of T-cell depletion, also observed in CD70-transgenic mice, peripheral blood of patients with Sz displays a marked decrease of absolute normal CD4� T cells as well as a reduction of the complexity of the T-cell receptor repertoire (75). The coordinate expression of CD70 and CD27 can thus be expected to stimulate activation and proliferation of the malignant T-cell pool in Sz patients. An additional consequence of high expression of CD70 as well as RANKL in Sz patients may be detrimental persistent immune activation and depletion of the naive T-cell pool, resulting in immunodeficiency. As shown in Fig. 4, many of our findings on gene expression in malignant T cells from Sz patients are consistent with previous findings reported in the literature. We identified the proposed tumorassociated markers T-plastin (21), Kir3DL2 (23), and JunB (9) as up-regulated in Sz T cells, but in the included Sz patient samples their expression patterns were not significantly discriminating according to the SAM algorithm. Recently Kari et al. (20) performed cDNA microarray analysis on T cells from patients with erythrodermic CTCL. Although the results of their study show similarities with the present study such as decreased expression of STAT 4 and high expression of transcription factor activator protein 2-� in malignant T cells, differences predominate. The discrepancies between the results are likely to be attributable to the characteristics of the patient group they studied that included erythrodermic CTCL other than Sz, their choice of cultured peripheral blood mononuclear cells skewed to the Th2 phenotype as control, the use of cDNA microarrays that analyze a different and smaller set of genes, as well as the data analysis methods applied. Our studies indicate that malignant T cells of Sz patients display a gene expression pattern that separates them from benign T cells of patients with BE and healthy controls. Among the most highly and consistently expressed genes in T cells of Sz patients are the

membrane-bound tyrosine kinase receptor EphA4 and Twist, a potentially oncogenic transcription factor. Additional studies are necessary to evaluate whether these tumor-associated proteins are involved in the development and progression of Sz and if they can be used as targets for therapeutic intervention. ACKNOWLEDGMENTS The authors thank Eveline Mank (Dept. of Human and Clinical Genetics, LUMC) and Aat Mulder for their excellent technical assistance and Dr. Pieter van der Velden for initial help with analysis of the micro-array data.

REFERENCES 1. Se´zary A, Bouvrain Y. Erythrodermie avec presence de cellules monstrueuses dans le derme et dans le sang circulant. Bull Soc Fr Dermatol Syphilogr 1938;45:254 – 60. 2. Vonderheid EC, Bernengo MG, Burg G, et al. Update on erythrodermic cutaneous T-cell lymphoma: report of the International Society for Cutaneous Lymphomas. J Am Acad Dermatol 2002;46:95–106. 3. Kamarashev J, Burg G, Kempf W, Hess Schmid M, Dummer R. Comparative analysis of histological and immunohistological features in mycosis fungoides and Sezary syndrome. J Cutan Pathol 1998;25:407–12. 4. Willemze R, Kerl H, Sterry W, et al. EORTC classification for primary cutaneous lymphomas: a proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer. Blood 1997;90:354 –71. 5. Zhang Q, Nowak I, Vonderheid EC, et al. Activation of Jak/STAT proteins involved in signal transduction pathway mediated by receptor for interleukin 2 in malignant T lymphocytes derived from cutaneous anaplastic large T-cell lymphoma and Sezary syndrome. Proc Natl Acad Sci USA 1996;93:9148 –53. 6. Showe LC, Fox FE, Williams D, Au K, Niu Z, Rook AH. Depressed IL-12-mediated signal transduction in T cells from patients with Sezary syndrome is associated with the absence of IL-12 receptor beta 2 mRNA and highly reduced levels of STAT4. J Immunol 1999;163:4073–9. 7. Eriksen KW, Kaltoft K, Mikkelsen G, et al. Constitutive STAT3-activation in Sezary syndrome: tyrphostin AG490 inhibits STAT3-activation, interleukin-2 receptor expression and growth of leukemic Sezary cells. Leukemia 2001;15:787–93. 8. Mitchell TJ, Whittaker SJ, John S. Dysregulated expression of COOH-terminally truncated Stat5 and loss of IL2-inducible Stat5-dependent gene expression in Sezary Syndrome. Cancer Res 2003;63:9048 –54. 9. Mao X, Orchard G, Lillington DM, Russell-Jones R, Young BD, Whittaker SJ. Amplification and overexpression of JUNB is associated with primary cutaneous T-cell lymphomas. Blood 2003;101:1513–9. 10. Kadin ME, Cavaille-Coll MW, Gertz R, Massague J, Cheifetz S, George D. Loss of receptors for transforming growth factor beta in human T-cell malignancies. Proc Natl Acad Sci USA 1994;91:6002– 6. 11. Scarisbrick JJ, Woolford AJ, Calonje E, et al. Frequent abnormalities of the p15 and p16 genes in mycosis fungoides and Sezary syndrome. J Investig Dermatol 2002; 118:493–9. 12. Dereure O, Portales P, Clot J, Guilhou JJ. Decreased expression of Fas (APO-1/ CD95) on peripheral blood CD4� T lymphocytes in cutaneous T-cell lymphomas. Br J Dermatol 2000;143:1205–10. 13. Karenko L, Hyytinen E, Sarna S, Ranki A. Chromosomal abnormalities in cutaneous T-cell lymphoma and in its premalignant conditions as detected by G-banding and interphase cytogenetic methods. J Investig Dermatol 1997;108:22–9. 14. Mao X, Lillington DM, Czepulkowski B, Russell-Jones R, Young BD, Whittaker S. Molecular cytogenetic characterization of Sezary syndrome. Genes Chromosomes Cancer 2003;36:250 – 60. 15. Bakels V, van Oostveen JW, Preesman AH, Meijer CJ, Willemze R. Differentiation between actinic reticuloid and cutaneous T cell lymphoma by T cell receptor gamma gene rearrangement analysis and immunophenotyping. J Clin Pathol 1998;51:154 – 8. 16. Huber W, Von Heydebreck A, Sultmann H, Poustka A, Vingron M. Variance stabilization applied to microarray data calibration and to the quantification of differential expression. Bioinformatics 2002;18(Suppl 1):S96 –S104. 17. Tusher VG, Tibshirani R, Chu G. Significance analysis of microarrays applied to the ionizing radiation response. Proc Natl Acad Sci USA 2001;98:5116 –21. 18. Wong BR, Josien R, Lee SY, et al. TRANCE (tumor necrosis factor [TNF]-related activation-induced cytokine), a new TNF family member predominantly expressed in T cells, is a dendritic cell-specific survival factor. J Exp Med 1997;186:2075– 80. 19. Sen S, Zhou H, Ripmaster T, Hittelman WN, Schimmel P, White RA. Expression of a gene encoding a tRNA synthetase-like protein is enhanced in tumorigenic human myeloid leukemia cells and is cell cycle stage- and differentiation-dependent. Proc Natl Acad Sci USA 1997;94:6164 –9. 20. Kari L, Loboda A, Nebozhyn M, et al. Classification and prediction of survival in patients with the leukemic phase of cutaneous T cell lymphoma. J Exp Med 2003; 197:1477– 88. 21. Su MW, Dorocicz I, Dragowska WH, et al. Aberrant expression of T-plastin in Sezary cells. Cancer Res 2003;63:7122–7. 22. Hwang ST, Fitzhugh DJ. Aberrant expression of adhesion molecules by Sezary cells: functional consequences under physiologic shear stress conditions. J Investig Dermatol 2001;116:466 –70. 23. Bagot M, Moretta A, Sivori S, et al. CD4(�) cutaneous T-cell lymphoma cells express the p140-killer cell immunoglobulin-like receptor. Blood 2001;97:1388 –91.

5585

76


24. Willers J, Haffner A, Zepter K, et al. The interferon inhibiting cytokine IK is overexpressed in cutaneous T cell lymphoma derived tumor cells that fail to upregulate major histocompatibility complex class II upon interferon-gamma stimulation. J Investig Dermatol 2001;116:874 –9. 25. Dummer R, Heald PW, Nestle FO, et al. Sezary syndrome T-cell clones display T-helper 2 cytokines and express the accessory factor-1 (interferon-gamma receptor beta-chain). Blood 1996;88:1383–9. 26. Paulin Y, Boukhelifa M, Derappe C, Giner M, Font J, Aubery M. Activity of proximal promoter of the human beta(1)-integrin gene was increased in Sezary syndrome. Leuk Res 2001;25:487–92. 27. Bagot M, Charue D, Boulland ML, et al. Interleukin-7 receptor expression in cutaneous T-cell lymphomas. Br J Dermatol 1996;135:572–5. 28. Rappl G, Muche JM, Abken H, et al. CD4(�)CD7(�) T cells compose the dominant T-cell clone in the peripheral blood of patients with Sezary syndrome. J Am Acad Dermatol 2001;44:456 – 61. 29. Nikolova M, Musette P, Bagot M, Boumsell L, Bensussan A. Engagement of ILT2/CD85j in Sezary syndrome cells inhibits their CD3/TCR signaling. Blood 2002;100:1019 –25. 30. Matutes E, Coelho E, Aguado MJ, et al. Expression of TIA-1 and TIA-2 in T cell malignancies and T cell lymphocytosis. J Clin Pathol 1996;49:154 – 8. 31. Leon F, Cespon C, Franco A, et al. SHP-1 expression in peripheral T cells from patients with Sezary syndrome and in the T cell line HUT-78: implications in JAK3-mediated signaling. Leukemia 2002;16:1470 –7. 32. Brito-Babapulle V, Hamoudi R, Matutes E, et al. p53 allele deletion and protein accumulation occurs in the absence of p53 gene mutation in T-prolymphocytic leukaemia and Sezary syndrome. Br J Haematol 2000;110:180 –7. 33. Bernengo MG, Novelli M, Quaglino P, et al. The relevance of the CD4� CD26subset in the identification of circulating Sezary cells. Br J Dermatol 2001;144: 125–35. 34. Haffner AC, Tassis A, Zepter K, et al. Expression of cancer/testis antigens in cutaneous T cell lymphomas. Int J Cancer 2002;97:668 –70. 35. Jillella AP, Murren JR, Hamid KK, Longley BJ, Edelson RL, Cooper DL. Pglycoprotein expression and multidrug resistance in cutaneous T-cell lymphoma. Cancer Investig 2000;18:609 –13. 36. Brender C, Nielsen M, Kaltoft K, et al. STAT3-mediated constitutive expression of SOCS-3 in cutaneous T-cell lymphoma. Blood 2001;97:1056 – 62. 37. Spicer DB, Rhee J, Cheung WL, Lassar AB. Inhibition of myogenic bHLH and MEF2 transcription factors by the bHLH protein Twist. Science (Lond) 1996;272:1476 – 80. 38. Wang SM, Coljee VW, Pignolo RJ, Rotenberg MO, Cristofalo VJ, Sierra F. Cloning of the human twist gene: its expression is retained in adult mesodermally-derived tissues. Gene 1997;187:83–92. 39. Baer R. TAL1, TAL2 and LYL1: a family of basic helix-loop-helix proteins implicated in T cell acute leukaemia. Semin Cancer Biol 1993;4:341–7. 40. Maestro R, Dei Tos AP, Hamamori Y, et al. Twist is a potential oncogene that inhibits apoptosis. Genes Dev 1999;13:2207–17. 41. Sosic D, Richardson JA, Yu K, Ornitz DM, Olson EN. Twist regulates cytokine gene expression through a negative feedback loop that represses NF-kappaB activity. Cell 2003;112:169 – 80. 42. Izban KF, Ergin M, Qin JZ, et al. Constitutive expression of NF-kappa B is a characteristic feature of mycosis fungoides: implications for apoptosis resistance and pathogenesis. Hum Pathol 2000;31:1482–90. 43. Pajer P, Pecenka V, Karafiat V, Kralova J, Horejsi Z, Dvorak M. The twist gene is a common target of retroviral integration and transcriptional deregulation in experimental nephroblastoma. Oncogene 2003;22:665–73. 44. Wang X, Ling MT, Guan XY, et al. Identification of a novel function of TWIST, a bHLH protein, in the development of acquired taxol resistance in human cancer cells. Oncogene 2004;23:474 – 82. 45. Kullander K, Klein R. Mechanisms and functions of Eph and ephrin signalling. Nat Rev Mol Cell Biol 2002;3:475– 86. 46. Lindberg RA, Hunter T. cDNA cloning and characterization of eck, an epithelial cell receptor protein-tyrosine kinase in the eph/elk family of protein kinases. Mol Cell Biol 1990;10:6316 –24. 47. Wilkinson DG. Multiple roles of EPH receptors and ephrins in neural development. Nat Rev Neurosci 2001;2:155– 64. 48. Ramaswamy S, Tamayo P, Rifkin R, et al. Multiclass cancer diagnosis using tumor gene expression signatures. Proc Natl Acad Sci USA 2001;98:15149 –54.

49. Hafner C, Schmitz G, Meyer S, et al. Differential gene expression of eph receptors and ephrins in benign human tissues and cancers. Clin Chem 2004;50:490 –9. 50. Sharfe N, Freywald A, Toro A, Roifman CM. Ephrin-A1 induces c-Cbl phosphorylation and EphA receptor down-regulation in T cells. J Immunol 2003;170:6024 –32. 51. Walker-Daniels J, Coffman K, Azimi M, et al. Overexpression of the EphA2 tyrosine kinase in prostate cancer. Prostate 1999;41:275– 80. 52. Zelinski DP, Zantek ND, Stewart JC, Irizarry AR, Kinch MS. EphA2 overexpression causes tumorigenesis of mammary epithelial cells. Cancer Res 2001;61:2301– 6. 53. Lai KO, Chen Y, Po HM, Lok KC, Gong K, Ip NY. Identification of the Jak/Stat Proteins as Novel Downstream Targets of EphA4 Signaling in Muscle: implications in the regulation of acetylcholinesterase expression. J Biol Chem 2004;279:13383–92. 54. Sasaki O, Meguro K, Tohmiya Y, Funato T, Shibahara S, Sasaki T. Altered expression of retinoblastoma protein-interacting zinc finger gene, RIZ, in human leukaemia. Br J Haematol 2002;119:940 – 8. 55. Satterwhite E, Sonoki T, Willis TG, et al. The BCL11 gene family: involvement of BCL11A in lymphoid malignancies. Blood 2001;98:3413–20. 56. Kang-Decker N, Tong C, Boussouar F, et al. Loss of CBP causes T cell lymphomagenesis in synergy with p27Kip1 insufficiency. Cancer Cell 2004;5:177– 89. 57. Schreiber-Agus N, Meng Y, Hoang T, et al. Role of Mxi1 in ageing organ systems and the regulation of normal and neoplastic growth. Nature (Lond) 1998;393:483–7. 58. Hideshima T, Nakamura N, Chauhan D, Anderson KC. Biologic sequelae of interleukin-6 induced PI3-K/Akt signaling in multiple myeloma. Oncogene 2001;20: 5991– 6000. 59. Totth A, Sebestyen A, Barna G, et al. TGF beta 1 induces caspase-dependent but death-receptor independent apoptosis in lymphoid cells. Anticancer Res 2001;21: 1207–12. 60. Capocasale RJ, Lamb RJ, Vonderheid EC, et al. Reduced surface expression of transforming growth factor beta receptor type II in mitogen-activated T cells from Sezary patients. Proc Natl Acad Sci USA 1995;92:5501–5. 61. Kadin ME, Levi E, Kempf W. Progression of lymphomatoid papulosis to systemic lymphoma is associated with escape from growth inhibition by transforming growth factor-beta and CD30 ligand. Ann N Y Acad Sci 2001;941:59 – 68. 62. Pelengaris S, Khan M, Evan G. c-MYC: more than just a matter of life and death. Nat Rev Cancer 2002;2:764 –76. 63. Taira T, Maeda J, Onishi T, et al. AMY-1, a novel C-MYC binding protein that stimulates transcription activity of C-MYC. Genes Cells 1998;3:549 – 65. 64. Burgering BM, Kops GJ. Cell cycle and death control: long live Forkheads. Trends Biochem Sci 2002;27:352– 60. 65. Pekarsky Y, Hallas C, Croce CM. Targeting mature T cell leukemia: new understanding of molecular pathways. Am J Pharmacogenomics 2003;3:31– 6. 66. Suzuki A, Yamaguchi MT, Ohteki T, et al. T cell-specific loss of Pten leads to defects in central and peripheral tolerance. Immunity 2001;14:523–34. 67. Nakamura N, Ramaswamy S, Vazquez F, Signoretti S, Loda M, Sellers WR. Forkhead transcription factors are critical effectors of cell death and cell cycle arrest downstream of PTEN. Mol Cell Biol 2000;20:8969 – 82. 68. Tracey L, Villuendas R, Dotor AM, et al. Mycosis fungoides shows concurrent deregulation of multiple genes involved in the TNF signaling pathway: an expression profile study. Blood 2003;102:1042–50. 69. Storz M, Zepter K, Kamarashev J, Dummer R, Burg G, Haffner AC. Coexpression of CD40 and CD40 ligand in cutaneous T-cell lymphoma (mycosis fungoides). Cancer Res 2001;61:452–54. 70. Lens SM, Baars PA, Hooibrink B, van Oers MH, van Lier RA. Antigen-presenting cell-derived signals determine expression levels of CD70 on primed T cells. Immunology 1997;90:38 – 45. 71. Tesselaar K, Xiao Y, Arens R, et al. Expression of the murine CD27 ligand CD70 in vitro and in vivo. J Immunol 2003;170:33– 40. 72. Tesselaar K, Arens R, van Schijndel GM, et al. Lethal T cell immunodeficiency induced by chronic costimulation via CD27-CD70 interactions. Nat Immunol 2003; 4:49 –54. 73. Josien R, Li HL, Ingulli E, et al. TRANCE, a tumor necrosis factor family member, enhances the longevity and adjuvant properties of dendritic cells in vivo. J Exp Med 2000;191:495–502. 74. Rook AH, Heald P. The immunopathogenesis of cutaneous T-cell lymphoma. Hematol Oncol Clin North Am 1995;9:997–1010. 75. Yawalkar N, Ferenczi K, Jones DA, et al. Profound loss of T-cell receptor repertoire complexity in cutaneous T-cell lymphoma. Blood 2003;102:4059 – 66.

5586

77

78

Chapter 7

Epigenetic profiling of cutaneous T-cell lymphoma: promoter hypermethylation of multiple tumor suppressor genes including BL7a, PTPRG and p73

J. Clin. Oncol. 2005 May 16

Published Ahead of Print on May 16, 2005 as 10.1200/JCO.2005.11.353 VOLUME

23

JOURNAL

d

NUMBER

OF

17

d

JUNE

10

2005

CLINICAL ONCOLOGY

O R I G I N A L

R E P O R T

Epigenetic Profiling of Cutaneous T-Cell Lymphoma: Promoter Hypermethylation of Multiple Tumor Suppressor Genes Including BCL7a, PTPRG, and p73 Remco van Doorn, Willem H. Zoutman, Remco Dijkman, Renee X. de Menezes, Suzan Commandeur, Aat A. Mulder, Pieter A. van der Velden, Maarten H. Vermeer, Rein Willemze, Pearlly S. Yan, Tim H. Huang, and Cornelis P. Tensen From the Departments of Dermatology and Medical Statistics, Leiden University Medical Center, Leiden, the Netherlands; and Division of Human Cancer Genetics, Comprehensive Cancer Center, Ohio State University, Columbus, OH. Submitted January 11, 2005; accepted April 4, 2005. R. van Doorn was supported by a Genomics Fellowship, awarded by the Netherlands Organization for Scientific Research. Authors’ disclosures of potential conflicts of interest are found at the end of this article.

Address reprint requests to Cornelius P. Tensen, MD, Leiden University Medical Center, Dermatology, Wassenaarseweg 72, Leiden ZH 2333AL, the Netherlands; e-mail: [email protected]. � 2005 by American Society of Clinical Oncology 0732-183X/05/2317-1/$20.00 DOI: 10.1200/JCO.2005.11.353

A

B

S

T

R

A

C

T

Purpose To analyze the occurrence of promoter hypermethylation in primary cutaneous T-cell lymphoma (CTCL) on a genome-wide scale, focusing on epigenetic alterations with pathogenetic significance. Materials and Methods DNA isolated from biopsy specimens of 28 patients with CTCL, including aggressive CTCL entities (transformed mycosis fungoides and CD30-negative large T-cell lymphoma) and an indolent entity (CD30-positive large T-cell lymphoma), were investigated. For genome-wide DNA methylation screening, differential methylation hybridization using CpG island microarrays was applied, which allows simultaneous detection of the methylation status of 8640 CpG islands. Bisulfite sequence analysis was applied for confirmation and detection of hypermethylation of eight selected tumor suppressor genes. Results The DNA methylation patterns of CTCLs emerging from differential methylation hybridization analysis included 35 CpG islands hypermethylated in at least four of the 28 studied CTCL samples when compared with benign T-cell samples. Hypermethylation of the putative tumor suppressor genes BCL7a (in 48% of CTCL samples), PTPRG (27%), and thrombospondin 4 (52%) was confirmed and demonstrated to be associated with transcriptional downregulation. BCL7a was hypermethylated at a higher frequency in aggressive (64%) than in indolent (14%) CTCL entities. In addition, the promoters of the selected tumor suppressor genes p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) were hypermethylated in CTCL. Conclusion Malignant T cells of patients with CTCL display widespread promoter hypermethylation associated with inactivation of several tumor suppressor genes involved in DNA repair, cell cycle, and apoptosis signaling pathways. In view of this, CTCL may be amenable to treatment with demethylating agents. J Clin Oncol 23. � 2005 by American Society of Clinical Oncology INTRODUCTION

Primary cutaneous T-cell lymphomas (CTCLs) are extranodal non-Hodgkin’s lymphomas derived from mature T cells presenting in the skin. CTCLs encompass a group of distinct entities with different clinical behavior.1 Management of patients with

CTCL may be very difficult as few therapies are able to influence the generally progressive disease course of these malignancies. In malignant T cells of patients with CTCL, many oncogenic alterations have been demonstrated, such as functional inactivation of the Fas receptor, the transforming growth factor beta receptors, 1

81

Copyright 2005 by American Society of Clinical Oncology

van Doorn et al

p16, constitutive activity of STAT3, and chromosomal instability.2-6 Although only few causative genetic lesions have been identified, the epigenetic mechanism of promoter hypermethylation has been found to be associated with inactivation of several tumor suppressor genes in CTCL.6-9 Methylation of CpG islands located in the promoter or first exon of genes is associated with transcriptional downregulation through alteration of the chromatin conformation and interference with binding of transcription factors.10 Aberrant promoter methylation is increasingly recognized as an important factor in the pathogenesis of cancer as many tumor suppressor genes can be inactivated through this epigenetic mechanism.11 Both the frequency and the patterns of promoter hypermethylation vary markedly between different tumor types.12,13 Promoter hypermethylation in cancer cells is interesting from a clinical point of view as its detection can be exploited in the diagnosis and prognosis of cancer patients.14 The potential reversibility of gene silencing associated with promoter hypermethylation through pharmacologic manipulation with demethylating agents, such as 5-aza-2#-deoxycytidine, zebularine, and MG98, promises epigenetic approaches to cancer therapy.15 The notion that epigenetic dysregulation has an important role in the development and progression of CTCL is supported by the observation that these malignancies respond favorably to treatment with histone deacetylase inhibitors.16 Moreover, promoter hypermethylation, that often coincides with repressive histone modifications, is displayed by hematopoietic malignancies at a higher frequency than by other tumor types.12,13,17,18 Consistently, in the few studies performed thus far, promoter hypermethylation of the p15, p16, MLH1, and SHP1 genes has been demonstrated in CTCL.6-9 The purpose of this study was to analyze the occurrence of promoter hypermethylation in CTCL on a genome-wide scale. We analyzed DNA isolated from skin tumor biopsy specimens of 28 patients with CTCL, including CTCL entities with aggressive clinical behavior (transformed mycosis fungoides and CD30-negative primary cutaneous large T-cell lymphoma) and indolent CTCL (CD30-positive primary cutaneous large T-cell lymphoma). To identify novel methylation targets and to screen for global DNA methylation patterns, differential methylation hybridization (DMH) using CpG island microarrays was applied.19,20 Additionally, the methylation status of eight tumor suppressor genes, selected for their known involvement in lymphomagenesis, was examined using bisulfite sequence analysis (BSA). In this study, we show that malignant T cells in CTCL exhibit widespread promoter hypermethylation suggestive of epigenetic instability. The novel methylation targets we identified in CTCL include the putative tumor suppressor

genes BCL7a (B-cell CLL/Lymphoma 7a), PTPRG (protein tyrosine phosphatase receptor gamma), and THBS4 (thrombospondin 4). We found six of eight selected tumor suppressor gene promoters hypermethylated in CTCL including MGMT, p73, p16, p15, CHFR, and TMS1. MATERIALS AND METHODS Patient Samples Snap-frozen biopsy specimens were obtained from skin tumors of 28 patients with CTCL, including 12 patients with tumor-stage mycosis fungoides with blast cell transformation (MF-TR) characterized by the presence of � 25% blast cells, five patients with CD30-negative primary cutaneous large T-cell lymphoma (CD30� LTCL) and 11 patients with CD30positive primary cutaneous large T-cell lymphoma (CD30� LTCL), defined by criteria of the European Organisation for Research and Treatment of Cancer classification for cutaneous lymphomas.1 MF-TR and CD30� LTCL have an estimated 5-year survival of approximately 25%; CD30� LTCL has a 5-year survival of 96%.1,21,22 Skin biopsy specimens were required to contain at least 70% malignant T cells for inclusion in the study. As controls, seven CD4� T-cell samples isolated from peripheral blood of healthy volunteers and three skin biopsy specimens from patients with inflammatory dermatoses (atopic dermatitis, discoid lupus erythematosus) were used. DNA was extracted using the Genomic Tip kit (Qiagen, Hilden, Germany). All 28 CTCL samples were analyzed using DMH; 21 CTCL samples were analyzed using BSA. DMH Using CpG Island Microarrays DMH was performed according to the detailed protocol published by Yan et al,20 with the only modification that tumor and control amplicons were hybridized to microarrays separately and fluorescence signal intensities instead of ratios were used as a measure of CpG island methylation. Briefly, DNA isolated from tumor tissue was digested by MseI, ligated to linkers, and sequentially digested with methylation-sensitive restriction enzymes (HpaII and BstUI). The digested linker-ligated DNA was used as template for polymerase chain reaction (PCR) amplification (20 cycles) and fluorescence labeling using Cy5 before hybridization to the CpG island microarray. As probes, a panel containing 8640 CpG island tags prepared from a genomic library arrayed on glass slides were used. The identity of selected CpG islands (CpGIs) was determined by sequence analysis of plasmids contained in the CGI library. Statistical Analysis Data from DMH experiments were normalized using variance stabilizing normalization implemented in the R statistical software package.23 A Wilcoxon rank-sums test was applied separately to each CpG island in order to identify those with consistently different intensity patterns in the 28 tumors when compared with the 10 controls. The resulting list of P values was corrected for multiple testing via the false discovery rate step-up procedure of Benjamini & Hochberg.24 To identify CpG islands methylated sporadically in only a subset of tumors, for which the Wilcoxon test is not suited, we first estimated the CpG island– specific intensity distribution based upon the 10 control samples and a gamma-distribution model. These estimates were used to compute upper-tail probabilities corresponding to the intensity

2

JOURNAL

Downloaded from www.jco.org at WALAEUS LIBRARY on May 20, 2005 . Copyright © 2005 by the American Society of Clinical Oncology. All rights reserved.

82

OF

CLINICAL ONCOLOGY

Epigenetic Profiling of CTCL

of each tumor. A threshold D Z 0.01 for these probabilities was applied, below which tumor intensities were classified as potentially methylated. Under the hypothesis that tumor intensities behave in the same way as control intensities, the number of potentially methylated intensities per CpG island follows a binomial distribution, with sample size 28 and probability D Z 0.01. This yields a list of P values, which were then corrected for multiple testing as those from the Wilcoxon test. Considered as frequently hypermethylated were CpG islands that exhibited values exceeding this threshold in at least four tumor samples. The false discovery rate for CpG islands selected using the Wilcoxon test was 30% and for the sporadic test, 2.1%. Subsequently excluded were CpG islands that had fluorescence intensity values that were below a predetermined background level in all tumor samples or above this level in any of the control samples.

sal methylated DNA (Chemicon, Hampshire, United Kingdom) for each primer combination demonstrated absence of PCR bias and showed that methylation could accurately be detected if a minimum of 25% of total analyzed DNA was methylated. Cytosine peaks in the chromatogram with a height of 0.4 or more relative to the thymine peak height were considered as indicative of methylation. A CpG island was defined as aberrantly methylated if the density of methylated CpG dinucleotides contained in the amplified sequence exceeded 15%, consistent with the threshold value implemented in other studies.25,26 Cell Culture, 5-Aza-2#-Deoxycytidine Treatment The MF cell line MyLa (courtesty of Dr K. Kaltoft) was cultured in RPMI 1640 (Invitrogen) supplemented with 200 U/mL penicillin, 200 �g/mL streptomycin, 2 �mol/mL L-glutamine, 20% fetal calf serum, and 12.5% crude T-cell extract at 37�C, 5% CO2.27 For demethylation studies, cells were cultured in this medium to which 5-aza-2#-deoxycytidine (Sigma, St. Louis, MO) was added to a concentration of 2 �mol/L for 4 days before extraction of RNA using the RNeasy kit (Qiagen).

Bisulfite Sequence Analysis Two �g of patient sample–derived DNA was bisulfiteconverted using the EZ DNA methylation kit (Zymo Research, Orange, CA). Primers were designed to anneal to bisulfiteconverted DNA as template. Primer sequences (Invitrogen, Breda, the Netherlands) are given in Table 1. PCR reactions were carried out in 25-�L volume using 50-ng bisulfiteconverted DNA as template. Cycle parameters for all analyzed CpG islands were as follows: denaturing at 94�C for 5 minutes; annealing at temperatures varying from 63�C to 56�C according to primer set for 1 minute and extension at 72�C for 1 minute for five cycles; followed by denaturing for 30 seconds, annealing for 1 minute and extension for 1 minute at similar temperatures for 30 cycles. Following electrophoresis, PCR products were excised from the agarose gel and purified using the Qiaquick Gel Extraction Kit (Qiagen). Sequence analysis was performed on an ABI Prism 3700 DNA analyzer (Applied Biosystems, Nieuwerkerk aan den IJssel, the Netherlands) under standard conditions. Validation experiments using mixtures (1:1 and 1:3) of unmethylated semen and completely methylated CpGnome univer-

Real-Time Quantitative PCR cDNA synthesis was performed on 1-�g total RNA after treatment with RQ1 DNase I (Promega, Madison, WI) using Superscript III reverse transcriptase (Invitrogen) and an oligo(dT)12-18 primer. Quantitative PCR (qPCR) was performed using DyNAmo HS SYBR Green qPCR kit (Finnzymes, Espoo, Finland) in an ABI-Prism 7700 sequence detection system (Applied Biosystems). For normalization, cleavage and polyadenylation specific factor 6 (CPSF6) and TATA-box-binding protein (TBP) were used, genes stably expressed also after treatment with 5-aza-2#-deoxycytidine (T. van Wezel, personal communication, September 2004). Primer sequences are given in Table 2. Cycle parameters were as follows: denaturing for 15 seconds at 95�C, and annealing and extension for 60 seconds at 60�C for 40 cycles. Specificity of PCR products was confirmed by agarose

Table 1. Primers for Bisulfite Sequence Analysis

Gene BCL7a PTPRg THBS4 p15 p16 p73 MGMT MLH1 RB1 SOCS1 TMS1 CHFR

Primer Sequence (5# - 3#) S AS S AS S AS S AS S AS S AS S AS S AS S AS S AS S AS S AS

GAGAGTTTTTGGTGGTTTGTTTGGTA GGTATTTGTAGTTTTCGAGGAAGGGTTAG GGAGTTGTTTGTTTGAAGTTCGGAGA CCACCAACACGATTCCAATAACCT TTAGGATAGGGGATTTCGTTAAGGG CAAATCCCTCCACTCACTCAACA GGATAGGGGGCGGAGTTTAAGG CTCTTCCCTTCTTTCCCACGCTACTC AGTATTAGGAGGAAGAAAGAGGAG TCCAATTCCCCTACAAACTCC GGTTGGGGTTGGGAGAGTAGTTT CCAAACGACCCATCTTTCCTAACA GGAGCGGTATTAGGAGGGGAGAGA CCTTCCCAACTTCCGCCTAAAACT GAGTGAAGGAGGTTACGGGTAAGT CTCAAACTCCTCCTCTCCCCTTA GGAGGGGGTGGTTTTGGGTAG CCCCCGCCCGACAACTAAAC GTAGGGGAGGAGAGGATAGGGTTT CCCCCAACTCCACTTTTAATTTCTC GAGGGGATTAAGGGTGTAGTAAGGAAG CTACAACTACCCGACCATCTCCTACA GTTTTGTGTTTTAGATTTCGGATTTGTG CTCGACCATCTTTAATCCTAACCAAAC

CpGs in Amplicon

Position of Amplicon Relative to Transcription Start Site

Amplicon Size (bp)

26

�192, �546

355

60

�464, �30

494

56

�86, �532

446

32

�109, �266

375

32

�204, �215

419

21

�740, -448

292

21

�568, -339

229

33

�697, -354

343

22

�250, -8

242 338

25

�446, -108

44

�85, �458

439

15

�400, -130

270

3

www.jco.org

83

van Doorn et al

Table 2. Primers for Real-Time Quantitative Polymerase Chain Reaction

cDNA BCL7a PTPRG CPSF6 TBP

Primer Sequence (5# - 3#) S AS S AS S AS S AS

Accession No.

TGGTGACACATCCCTACGAA CACTTCTCGTCCTTGCCTTT TTGGGATCATAACGCACAGA CTCGACTTGGCCAGTACACA AAGATTGCCTTCATGGAATTGAG TCGTGATCTACTATGGTCCCTCTCT CACGAACCACGGCACTGATT TTTTCTTGCTGCCAGTCTGGAC

Exonic Location

Amplicon Size (bp)

NM_020993

2,3

99

NM_002841

26,27

86

NM_007007

9,10

137

NM_003194

5,6

89

BCL7a gene was among the most discriminating between CTCL and control samples. Methylation in CTCL was evenly distributed over the various chromosomes, in contrast to acute myeloid leukemia, where preferential methylation of CpG islands located on one particular chromosome was observed.31 Among the CpG islands hypermethylated in CTCL were the promoters of collagen alpha II type I and THBS4, genes previously shown to be methylated in colon cancer cells using different methylation detection methods.18,32

gel electrophoresis, melting curve, and sequence analysis of test samples. Experiments were performed in duplicate. Cross-over point values were used to calculate the gene-specific input cDNA amount. Data were evaluated using Sequence Detection System software version 1.9.1 (Applied Biosystems) and the second derivative maximum algorithm. RESULTS

Examination of DNA Methylation Patterns Using CpG Island Microarrays To screen for hypermethylated CpG islands in the 28 CTCL tumor specimens, we applied DMH using CpG island microarrays. DMH allows screening of methylation of 8640 CpG islands, most of which are located in gene promoters, and has been established in previous studies to accurately identify DNA methylation patterns.20,28,29 This method is based on the use of methylation-sensitive endonucleases that digest unmethylated DNA sequences, whereas methylated sequences are protected from digestion. Following methylation-sensitive digestion of DNA extracted from tumor and control samples, methylated DNA sequences can therefore be selectively amplified by PCR, labeled, and hybridized to a high-density microarray of CpG islands.19 Differences in methylation of a particular CpG island between tumor and control samples are reflected in differences in fluorescence intensities of CpG island tags on the microarray corresponding to the amplified DNA sequences. Since T cells have been found to display heterogeneous DNA methylation patterns, we compared methylation characteristics of 28 CTCL samples with those of multiple controls including seven T-cell samples and three inflammatory skin disease biopsy specimens.30 A statistical algorithm suited for the analysis of methylation profiling data was used, which detects CpG islands methylated consistently as well as CpG islands methylated sporadically in four or more of the tumor samples. Thus 35 CpG islands were identified as differentially methylated in CTCL. The methylation patterns, identity, and location of these 35 CpG islands are presented in Figure 1. Fourteen of these CpG islands were identified as consistently methylated using the Wilcoxon test, 15 as sporadically methylated, and six CpG islands were identified by both methods. The CpG island associated with the

Confirmation of BCL7a, PTPRG, and THBS4 as Novel Methylation Targets in CTCL Among the 35 CpG islands identified as hypermethylated in CTCL by DMH, we selected for confirmation studies CpG islands of BCL7a, PTPRG, and THBS4, as their epigenetic inactivation may be relevant in the pathogenesis of CTCL. These putative tumor suppressor genes were detected as consistently hypermethylated (THBS4), sporadically hypermethylated (PTPRG), or identified by both methods (BCL7a). Direct BSA, applied to confirm the results of DMH experiments, provides a map of average methylation densities for each of the cytosines contained in the DNA sequences amplified by PCR following bisulfite conversion.25,26,33 This method makes use of the fact that sodium bisulfite deaminates cytosine to uracil, which is replaced in subsequent PCR amplification by thymine, while leaving methylated cytosine unaltered. Each cytosine base present in the DNA sequence following bisulfite conversion and PCR amplification is indicative of methylated cytosine in the original DNA sequence. Figure 2 illustrates the results of BSA of the CpG island located in the first exon of BCL7a. As presented in Table 3, the CpG islands of BCL7a, PTPRG, and THBS4 were hypermethylated in 48%, 24%, and 52% of CTCL samples respectively, confirming DMH results. These three novel methylation targets were methylated among all three CTCL entities, as well as in the CTCL cell line MyLa, but not in any of the six control samples analyzed. Demethylation and Reactivation of BCL7a and PTPRG Expression Next we analyzed whether methylation of the CpG island located in the first exon of BCL7a and in the

4

JOURNAL


84

OF

CLINICAL ONCOLOGY


MF-TR

CD30 - LTCL

CD30 + LTCL

Controls

Gene name

predicted gene NT_005079.5 SIN3A GRIK2 angiomotin-like 1 collagen, type I, alpha 1 Sideroflexin 3 clone RP11-603F24 clone 10PTEL013 Ells1 Paired Box Protein PAX-6 SIN3A Serpine 1 aldehyde dehydrogenase 9 family A1 PDE4DIP (myomegalin) NIMA-related kinase 11 deleted in lymphocytic leukemia 1 protein tyrosine phosphatase receptor gamma C6orf102 C9orf64 DCOHM protein tyrosine phosphatase receptor N2 clone IMAGE:4793694 clone IMAGE:4793694 collagen, type I, alpha 2 C22orf4 B-cell CLL/Lymphoma 7A (BCL7A) Gene BC030533 PACE4 latent TGF-beta binding protein 2 cadherin-like 26 thrombospondin 4 SSX2IP NYD-SP29 C6orf117 clone IMAGE:4793694 Syntaxin 17

Location

promoter promoter exon 1 intron 1 intron 1 promoter / / intron 1, exon 2 intron 5 promoter exon 1 promoter intron 1 promoter, exon 1 promoter promoter promoter promoter intron 2 intron 2 promoter, exon 1 promoter, exon 1 exon 1 promoter exon 1 promoter exon 16 intron 2 exon 10 promoter intron 1 promoter, exon 1 promoter, exon 1 promoter, exon 1 promoter

Locus

2q14.3 15q24.2 6q16.3-q21 11q21 17q21.3-q22.1 10q24.32 2p21-p22 10q26.1 7p15.1 11p13 15q23 7q21.3-q22 1q23.1 1q21.1 3q22.1 13q14.3 3p21-p14 6p21.2 9q21.32 5q31.1 7q36 19q13.43 19q13.43 7q22.1 22q13.3 12q24.13 7q34 15q26 14q24.3 20q13.2-q13.33 5q13 1p22.3 1p22.3 6q14.3 19q13.43 9q31.1

Acc. no.

AC067962 AC105137 BC037954 AF453742 BC036531 BC000124 AF106953 Z96142 AY054121 BC011953 AL832463 BC010860 BC070030 AB007923 BC028587 Y15227 L09247 AL832634 AK090882 AL136721 U81561 BC036412 BC036412 J03464 BC029897 X89984 BC030533 AB001909 Z37976 AF169690 NM_003248 AB023140 AY049724 AK090775 BC036412 AK000658

Fig 1. Methylation patterns of 35 CpG islands identified as hypermethylated when comparing 28 cutaneous T-cell lymphoma (CTCL) samples (mycosis fungoides with blast cell transformation [MF-TR], CD30-negative large T-cell lymphoma [LTCL], and CD30-positive LTCL) with 10 control samples using differential methylation hybridization (DMH) on CpG microarrays. The colors reflect normalized fluorescence values that correspond to likelihood of methylation of the particular CpG island (red Z high, white Z low). The gene name, location of the CpG island, and locus and accession number (Acc. no.) of the gene are indicated. Patient samples were ordered according to CTCL entity; the 35 CpG islands were ordered using a hierarchical clustering algorithm based on the Euclidean distance and average-linkage method.

SOCS1), or in solid tumors (TMS1 and CHFR).34-38 In addition, promoter hypermethylation of these genes is known to be associated with gene silencing in cancer cells. As presented in Table 4, aberrant promoter methylation of p73 (48%), p16 (33%), CHFR (19%), p15 (10%), and TMS1 (10%) could be detected in CTCL, but not in control samples. The CpG island located in the promoter of the MGMT gene was found to be methylated in all tested CTCL samples, but unexpectedly was also methylated in three of the six CD4� T-cell samples included as controls. An overview of clinical features, disease course data of the CTCL patients, and the methylation status of the 11 genes investigated using BSA is presented in Table 5.

promoter of PTPRG is associated with gene silencing. Promoter methylation of the THBS4 gene had previously been shown to be associated with gene silencing in cancer cells.18 The MyLa CTCL cell line with demonstrated methylation of BCL7a and PTPRG was exposed to 5-aza-2#-deoxycytidine and effects on expression of these genes before and after treatment with this demethylating agent was assessed by real-time quantitative PCR. As illustrated in Figure 3, expression of these genes, nearly undetectable before exposure to 5-aza-2#-deoxycytidine, was dramatically increased upon demethylation. Expression of BCL7a increased with a fold change, denoting the average expression of the gene of interest relative to two stably expressed genes, of approximately 489. Expression of PTPRG increased more than seven-fold. These results suggest that expression of BCL7a and PTPRG is epigenetically regulated and that promoter methylation as occurs in CTCL is associated with transcriptional downregulation.

Promoter Hypermethylation in CTCL Entities With Different Clinical Behavior To evaluate possible correlations between DNA methylation and CTCL entities with different clinical behavior, we compared the methylation characteristics of CTCL entities with known aggressive behavior (MF-TR, CD30� LTCL) with those of an indolent CTCL entity (CD30� LTCL). As noticeable in Figure 1, the CpG island methylation patterns of aggressive and indolent CTCLs as identified using DMH show great similarity. Hierarchical clustering of patient samples using the entire set of 8640 CpG islands or the selection of 35 CpG

Promoter Hypermethylation of Eight Selected Tumor Suppressor Genes in CTCL Subsequently the methylation characteristics of promoters of eight selected tumor suppressor genes were examined in 21 CTCL patient samples using BSA. Hypermethylation of these genes was recently shown in MF (p15, p16, and MLH1), in nodal lymphomas (p73, MGMT, and

5

www.jco.org


85

van Doorn et al

A

BCL7A

CpG Island 252

918

Exon 1

5'

3'

1

1063 ATG 972 192

546

Amplicon gagagtctctggtggtctgcctggcaccaggcaccttcctacaaccct 1 2 3 agttttccaaaaggacaaagcctggggcaggcgacgtcctagctcgca 4 5 6 7 tttgaacagggccgcgggccagcagagatgcgcgatgcccaactcttt 8 9 10 11 12 ccaagagcacctcgcgtcccgaaccggtgccttcaactcggagaagtc 13 14 15 16 17 18 aagagacccgcaagaaacttgcacgactgcacccgccgccgcgctctg 19 20 21 ggggctgggcaggggcagctgggctggctcccggggaacgcgaccccc 22 23 24 25 26 ccgcgccccgcagaccggctgtctcccatggacccctcggcacctgca gcctccgaggaagggtcag

B

8 9 10 11 T T T TG T G T T T T G A A T T G G T G

Nonmethylated CTCL Patient Sample

Fig 2. Hypermethylation of the CpG island located in the first exon of the BCL7a gene. (A) Schematic representation of the first exon of BCL7a (accession number AC069503) on 12q24.31, the location of the CpG island and of the region amplified for bisulfite sequence analysis. (B) Exemplary results of bisulfite sequence analysis of the BCL7a CpG island in a tumor sample of a cutaneous T-cell lymphoma (CTCL) patient with an unmethylated (upper) and a CTCL patient with a hypermethylated (lower) BCL7a CpG island. Unmethylated and methylated bisulfiteconverted sequences are indicated above the chromatograms.

8 9 10 11 T T T CG C G T T T C G A A T C G G T G Hypermethylated CTCL Patient Sample

islands hypermethylated in CTCL revealed that the two groups of CTCL entities with different clinical behavior could not be separated on the basis of their methylation pattern. In the included CTCL patient samples, the frequency of promoter methylation did not differ significantly between patients with an aggressive CTCL entity (3.2 of 11 promoters) and an indolent CTCL entity (3.1 of 11 promoters). This contrasts with acute lymphoblastic leukemia, where prognostic significance of promoter hypermethylation frequency was recently reported.39 Of the 11 investigated tumor suppressor genes, only BCL7a was methylated significantly more frequently in the aggressive CTCLs MF-TR and CD30� LTCL than in CD30� LTCL (64% v 14%; �2-test, P � .05). Comparison of survival rates using the log-rank test showed no significant association between hypermeth-

ylation of any of these 11 genes and survival, possibly related to the limited number of 21 patients and short follow-up duration in this study group. DISCUSSION

In this study we evaluated the occurrence of aberrant DNA methylation in skin biopsy specimens obtained from patients with CTCL using a combination of a screening genomic approach, DMH on CpG island microarrays, and a candidate-gene approach, BSA. Using DMH analysis, 35 CpG islands were identified as hypermethylated in at least four of 28 studied CTCL patient samples. Hypermethylation of the putative tumor suppressor genes BCL7a, PTPRG, and THBS4 was confirmed. Subsequently, we showed that promoter hypermethylation of BCL7a and PTPRG is associated with gene silencing, as expression

6

JOURNAL


86

OF

CLINICAL ONCOLOGY


C

CpG-Dinucleotides Patient Sample

1

2

3

4

5

6

7

8

9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26

MF-TR #1 MF-TR #2 MF-TR #3 MF-TR #4 MF-TR #5 MF-TR #6 MF-TR #7 MF-TR #8 MF-TR #9 MF-TR #10 MF-TR #11

Fig 2. (continued) (C) Methylation density map of the BCL7a CpG island amplicon, containing 26 CpG dinucleotides, in 21 CTCL samples and nine controls. Unmethylated cytosine bases are indicated as (h), methylated cytosines as (-). Marked in gray are the patient samples considered as having a hypermethylated BCL7a CpG island. MF-TR, mycosis fungoides with blast cell transformation; LTCL, large T-cell lymphoma.

CD30 - LTCL #1 CD30 - LTCL #2 CD30 - LTCL #3 CD30 + LTCL #1 CD30 + LTCL #2 CD30 + LTCL #3 CD30 + LTCL #4 CD30 + LTCL #5 CD30 + LTCL #6 CD30 + LTCL #7 Control #1 Control #2 Control #3 Control #4 Control #5 Control #6 Control #7 Control #8 Control #9

CD30� LTCL, which has a more favorable prognosis, on the basis of their methylation patterns. This may not be considered surprising as the three entities are very closely related, all originating from CD4�, CD45RO�, CLA� skin-homing memory T cells. Akin to loss of heterozygosity, recurrent promoter methylation of genes in cancer cells may indicate that these genes encode proteins with tumor suppressive functions, loss of which confers growth advantage. In line with this assumption, the CTCL-specific methylation pattern included several putative tumor suppressor genes. The CpG island of BCL7a, located in its first exon, was methylated in 48% of CTCL samples. Epigenetic inactivation of BCL7a may be related to clinical behavior of CTCL, as its CpG island was hypermethylated at a higher frequency in aggressive than in indolent CTCL entities. The BCL7a locus is on chromosome 12q24.31 at the site of a recurrent breaking point in B-cell lymphomas. The BCL7a gene was cloned as part of a complex chromosomal translocation in a Burkitt’s lymphoma cell line and was subsequently found to be rearranged in another cell line derived from mediastinal large B-cell lymphoma.40 The resultant disruption of this gene is considered to be implicated in the pathogenesis of these lymphomas. However, the exact cellular function of BCL7a, which is expressed at low levels in a wide variety of normal tissues, and the consequences of its functional inactivation are currently unknown. Notably, gene expression profiling has shown

of these genes was restored by chemical demethylation in the MyLa CTCL cell line that exhibits hypermethylation of these genes. The THBS4 gene was previously shown to be silenced through promoter methylation in cancer cells.18 Additionally, we demonstrated hypermethylation of six of eight selected tumor suppressor gene promoters in CTCL using BSA. Promoters of the MGMT, p73, p16, p15, CHFR, and TMS1 genes were found to be hypermethylated in CTCL at varying frequencies. Concerning the results of DMH analysis, the DNA methylation pattern exhibited by CTCL is tumor type– specific, as it was different from that of colon, ovarian, and breast cancer analyzed previously with similar methods.20,28,29 Hierarchical clustering revealed that MF-TR and CD30� LTCL could not be distinguished from Table 3. Hypermethylation of Methylation Targets Identified by Differential Methylation Hybridization Analysis in Different Cutaneous T-Cell Lymphoma Entities, As Analyzed Using Bisulfite Sequence Analysis

CTCL (n Z 21) MF-TR (n Z 11) CD30� LTCL (n Z 3) CD30� LTCL (n Z 7) Controls (n Z 6)

BCL7a (%)

PTPRG (%)

THBS4 (%)

48 64 67 14 0

24 27 0 29 0

52 45 100 43 0

Abbreviations: CTCL, cutaneous T-cell lymphoma; MF-TR, mycosis fungoides with blast cell transformation; LTCL, large T-cell lymphoma.

7

www.jco.org


87

van Doorn et al

A CpG-Dinucleotides 1

2

3

4

5

6

7

8

9

10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26

BCL7a CpG-Dinucleotides 1

2

3

4

5

6

7

8

9

10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

PTPRG

B 0.020

BCL7a

0.018 0.016

2-�Ct

0.014 0.012 0.010 0.008 0.006 0.004 0.002 0

Untreated

After 5-aza-2'-deoxycytidine

Untreated

After 5-aza-2'-deoxycytidine

C 0.12

PTPRG

Fig 3. Results of demethylation using 5-aza-2#-deoxycytidine on expression of the BCL7a and PTPRG genes as measured using real-time quantitative polymerase chain reaction analysis. Expression levels of the genes of interest are represented as the average of 2-DCt(gene of interest-CPSF6) and 2-DCt(gene of interest-TBP) . Error bars indicate standard deviation from duplicate experiments. (A) Methylation density of the CpG island located in the first exon of BCL7a and the CpG island in the promoter of PTPRG in the MyLa cell line before demethylation. (B) Histogram showing BCL7a gene expression in the MyLa cell line before and after exposure to 5-aza-2#deoxycytidine. (C) Histogram showing PTPRG gene expression in the MyLa cell line before and after exposure to 5-aza-2#-deoxycytidine.

0.10

2-�Ct

0.08

0.06

0.04

0.02

0

that expression of BCL7a is diminished in MF skin lesions: BCL7a was among the seven downregulated genes, significant in separating MF from benign inflammatory skin diseases.41 In addition, BCL7a was recently found to be expressed at significantly lower levels in peripheral T-cell

lymphomas when compared with lymphoblastic lymphomas.42 These observations combined with the finding that diminished expression of BCL7a is an unfavorable prognostic sign in patients with B-cell lymphoma strongly suggests that this gene functions as a tumor suppressor in

8

JOURNAL


88

OF

CLINICAL ONCOLOGY


event in tumorigenesis. The PTPRG tumor suppressor gene frequently contains missense mutations in colon carcinomas and is often deleted in lung and renal carcinoma.45,46 Therefore, it has been concluded that PTPRG, which is normally expressed in lymphocytes, is a tumor suppressor gene. However, the functional significance of epigenetic silencing of PTPRG in lymphoid cells has not yet been established and demands further investigation. THBS4, hypermethylated in 11 (52%) of 21 CTCL samples, encodes an extracellular calcium-binding protein involved in proliferation, adhesion, and migration. Promoter hypermethylation of THBS4, as well of THBS1, has been reported in colon carcinoma, but as yet not in lymphoma.18,47 The promoter of MGMT was methylated in all CTCL samples, but also in three of six control samples, precluding its use as a marker for malignancy in CTCL. MGMT encodes a DNA repair enzyme that acts through removal of alkylating lesions at the guanine base protecting against mutagenesis and malignant transformation, loss of which increases sensitivity to treatment with alkylating agents. The region amplified for BSA was located in the promoter of the MGMT gene, stretching 279 to 508 nucleotides upstream of the transcription start site and 365 nucleotides upstream of the region reported to be methylated in B-cell lymphomas and gliomas (accession number X61657).35,48,49 The observation of MGMT promoter methylation in T cells of healthy subjects is analogous to the finding of promoter methylation of the tumor suppressor gene DAPK in benign as well as malignant B cells.50

Table 4. Hypermethylation of Selected Tumor Suppressor Genes in Different CTCL Entities, As Analyzed Using Bisulfite Sequence Analysis

p15 p16 p73 MGMT MLH1 SOCS1 TMS1 CHFR (%) (%) (%) (%) (%) (%) (%) (%) CTCL (n Z 21) 10 MF-TR (n Z 11) 18 0 CD30� LTCL (n Z 3) 0 CD30� LTCL (n Z 7) Controls (n Z 6) 0

33 28 0

48 40 67

100 100 100

57

57

100

0

0

50

0 0 0

0 0 0

10 9 0

19 18 0

0

0

14

29

0

0

0

0

Abbreviations: CTCL, cutaneous T-cell lymphoma; MF-TR, mycosis fungoides with blast cell transformation; LTCL, large T-cell lymphoma.

lymphoid cells.43 Promoter hypermethylation is an important mechanism of its inactivation in T-cell lymphomas. PTPRG, another novel target of epigenetic inactivation in CTCL, was hypermethylated in five (24%) of 21 CTCL patients as confirmed by BSA. Because we additionally observed frequent methylation of PTPRN2 using DMH in CTCL, and because methylation of PTPRO has been described in hepatocellular carcinomas, members of the tyrosine phosphatase gene superfamily may be a common target for epigenetic inactivation.44 Protein tyrosine phosphatases play a role in setting the levels of tyrosine phosphorylation in cells by balancing the activity of tyrosine kinases, thereby regulating signaling pathways that control cellular growth. Whereas constitutive activity of tyrosine kinases has been long recognized as an important oncogenic alteration, inactivation of tyrosine phosphatases is increasingly considered as an important

Table 5. Clinical Features, Disease Course Data, and Methylation Status of Tumor Suppressor Genes in 21 CTCL Patients

Patients and Diagnosis MF-TR #1 MF-TR #2 MF-TR #3 MF-TR #4 MF-TR #5 MF-TR #6 MF-TR #7 MF-TR #8 MF-TR #9 MF-TR #10 MF-TR #11 CD30� LTCL CD30� LTCL CD30� LTCL CD30� LTCL CD30� LTCL CD30� LTCL CD30� LTCL CD30� LTCL CD30� LTCL CD30� LTCL

#1 #2 #3 #1 #2 #3 #4 #5 #6 #7

Follow-up Age Duration (years) Sex (months) Current Status 62 88 58 77 70 63 48 79 77 73 64 74 81 71 65 72 62 40 69 58 62

M F M M M M F M M M M M F M M M M F M M F

25 38 15 134 48 102 77 29 34 73 58 14 27 8 102 71 63 113 107 24 60

A� A� D� D� A� A� A� A� D� D� D� D� D� A� A� A� A� A� A� A� D�

BCL7A

PTPRG

THBS4

p15

p16

------

-

-

p73

-

---

MGMT MLH1 SOCS1

-

TMS1

CHFR

-

-

--

NOTE. A� denotes alive with disease; A� denotes alive with disease symptoms; D� denotes died due to lymphoma. Abbreviations: CTCL, cutaneous T-cell lymphoma; MF-TR, mycosis fungoides with blast cell transformation; LTCL, large T-cell lymphoma.

9

www.jco.org


89

van Doorn et al

The p73 gene promoter was hypermethylated in 11 (48%) of 21 CTCL patient samples. Epigenetic inactivation of the p73 gene appears to be particularly relevant in the pathogenesis of CTCL, since activation-induced cell death in T cells is dependent on the activity of p73.51 Activation-induced cell death is a mechanism essential in preventing unrestricted clonal expansion of activated T cells, such as occurs in CTCL. Although hypermethylation of p73 has been described in nodal B-cell lymphomas and natural-killer cell lymphomas, its methylation had not been previously reported in lymphomas of T-cell origin.35,52,53 The promoter of the CHFR gene, which encodes a protein regulating the mitotic checkpoint pathway governing the transition to metaphase, was hypermethylated in a minority of CTCL patients (19%). Its epigenetic inactivation, previously shown in colon and gastric cancer, may contribute to chromosomal instability.38 Consistent with results of other research groups, we showed hypermethylation of the p15 and p16 promoter in MF patient samples in 18% and 28%6,7 of MF patients. Promoter hypermethylation of p16 was additionally found in CD30� LTCL. Methylation of MLH1, previously found in a subset of MF patients with demonstrated microsatellite instability, could not be detected in patients included in this study.9 Our results provide evidence for epigenetic instability and widespread promoter methylation in CTCL associated with inactivation of several tumor suppressor genes, that may lead to cell cycle dysregulation (p15, p16, p73), defective DNA repair (MGMT), disruption of apoptosis signaling (TMS1, p73), and chromosomal instability (CHFR). In this study, the occurrence of promoter hypermethylation REFERENCES 1. Willemze R, Kerl H, Sterry W, et al: EORTC classification for primary cutaneous lymphomas: A proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer. Blood 90: 354-371, 1997 2. van Doorn R, Dijkman R, Vermeer MH, et al: A novel splice variant of the Fas gene in patients with cutaneous T-cell lymphoma. Cancer Res 62:5389-5392, 2002 3. Capocasale RJ, Lamb RJ, Vonderheid EC, et al: Reduced surface expression of transforming growth factor beta receptor type II in mitogen-activated T cells from Sezary patients. Proc Natl Acad Sci U S A 92:5501-5505, 1995 4. Sommer VH, Clemmensen OJ, Nielsen O, et al: In vivo activation of STAT3 in cutaneous T-cell lymphoma. Evidence for an antiapoptotic function of STAT3. Leukemia 18:1288-1295, 2004 5. Mao X, Lillington DM, Czepulkowski B, et al: Molecular cytogenetic characterization of

has been analyzed only in advanced tumor stage MF with blast cell transformation. In previous studies, promoter hypermethylation of the p16 and MLH1 gene has also been detected in the patch/plaque stage of MF, suggesting that these epigenetic alterations may arise early in the development of this T-cell malignancy.6,7,9 The demethylating agents 5-aza-2#-deoxycytidine, zebularine, and MG98, which can reverse silencing due to promoter hypermethylation, are currently tested in clinical trials for treatment of various malignancies and the first agent has already proven to be efficacious in chronic myeloid leukemia.54-56 The finding of promoter hypermethylation in CTCL not only gives insight into the molecular pathogenesis of these malignancies, but in addition provides a rationale for treatment of CTCL patients with demethylating agents. - - -

Acknowledgment We thank Joseph Liu (Division of Human Cancer Genetics, Comprehensive Cancer Center, Ohio State University) for technical assistance related to production of CpG island microarrays, Eddy Wierenga (Department of Cell Biology and Histology, AMC) for providing DNA from T cells of healthy subjects, Judith Boer (Department of Human and Clinical Genetics, LUMC) for advice concerning microarray data analysis, and Jan Willem Dierssen and Tom van Wezel (Department of Pathology, LUMC) for advice on measurement of gene expression in cells treated with 5-aza-2#-deoxycytidine. Authors’ Disclosures of Potential Conflicts of Interest The authors indicated no potential conflicts of interest.

Sezary syndrome. Genes Chromosomes Cancer 36:250-260, 2003 6. Navas IC, Ortiz-Romero PL, Villuendas R, et al: p16(INK4a) gene alterations are frequent in lesions of mycosis fungoides. Am J Pathol 156:1565-1572, 2000 7. Scarisbrick JJ, Woolford AJ, Calonje E, et al: Frequent abnormalities of the p15 and p16 genes in mycosis fungoides and Sezary syndrome. J Invest Dermatol 118:493-499, 2002 8. Zhang Q, Raghunath PN, Vonderheid E, et al: Lack of phosphotyrosine phosphatase SHP-1 expression in malignant T-cell lymphoma cells results from methylation of the SHP-1 promoter. Am J Pathol 157:1137-1146, 2000 9. Scarisbrick JJ, Mitchell TJ, Calonje E, et al: Microsatellite instability is associated with hypermethylation of the hMLH1 gene and reduced gene expression in mycosis fungoides. J Invest Dermatol 121:894-901, 2003 10. Deng G, Song GA, Pong E, et al: Promoter methylation inhibits APC gene expression by causing changes in chromatin conformation and interfering with the binding of transcription

factor CCAAT-binding factor. Cancer Res 64: 2692-2698, 2004 11. Herman JG, Baylin SB: Gene silencing in cancer in association with promoter hypermethylation. N Engl J Med 349:2042-2054, 2003 12. Costello JF, Fruhwald MC, Smiraglia DJ, et al: Aberrant CpG-island methylation has nonrandom and tumour-type-specific patterns. Nat Genet 24:132-138, 2000 13. Esteller M, Corn PG, Baylin SB, et al: A gene hypermethylation profile of human cancer. Cancer Res 61:3225-3229, 2001 14. Laird PW: The power and the promise of DNA methylation markers. Nat Rev Cancer 3: 253-266, 2003 15. Egger G, Liang G, Aparicio A, et al: Epigenetics in human disease and prospects for epigenetic therapy. Nature 429:457-463, 2004 16. Piekarz RL, Robey R, Sandor V, et al: Inhibitor of histone deacetylation, depsipeptide (FR901228), in the treatment of peripheral and cutaneous T cell lymphoma: A case report. Blood 98:2865-2868, 2001

10

JOURNAL


90

OF

CLINICAL ONCOLOGY


17. Esteller M: Profiling aberrant DNA methylation in hematologic neoplasms: A view from the tip of the iceberg. Clin Immunol 109:80-88, 2003 18. Kondo Y, Shen L, Yan PS, et al: Chromatin immunoprecipitation microarrays for identification of genes silenced by histone H3 lysine 9 methylation. Proc Natl Acad Sci U S A 101:73987403, 2004 19. Yan PS, Chen CM, Shi H, et al: Applications of CpG island microarrays for highthroughput analysis of DNA methylation. J Nutr 132:2430S-2434S, 2002 (suppl) 20. Yan PS, Efferth T, Chen HL, et al: Use of CpG island microarrays to identify colorectal tumors with a high degree of concurrent methylation. Methods 27:162-169, 2002 21. Vergier B, de Muret A, Beylot-Barry M, et al: Transformation of mycosis fungoides: clinicopathological and prognostic features of 45 cases. French Study Group of Cutaneious Lymphomas. Blood 95:2212-2218, 2000 22. Bekkenk MW, Geelen FA, van Voorst Vader PC, et al: Primary and secondary cutaneous CD30(�) lymphoproliferative disorders: A report from the Dutch Cutaneous Lymphoma Group on the long-term follow-up data of 219 patients and guidelines for diagnosis and treatment. Blood 95:3653-3661, 2000 23. Huber W, von Heydebreck A, Sultmann H, et al: Variance stabilization applied to microarray data calibration and to the quantification of differential expression. Bioinformatics 18:S96104, 2002 (suppl) 24. Benjamini Y, Hochberg Y: Controlling the false discovery rate: A practical and powerful approach to multiple testing. J R Statist Soc B 57:289-300, 1995 25. Toyota M, Kopecky KJ, Toyota MO, et al: Methylation profiling in acute myeloid leukemia. Blood 97:2823-2829, 2001 26. Garcia-Manero G, Daniel J, Smith TL, et al: DNA methylation of multiple promoter-associated CpG islands in adult acute lymphocytic leukemia. Clin Cancer Res 8:2217-2224, 2002 27. Kaltoft K, Bisballe S, Dyrberg T, et al: Establishment of two continuous T-cell strains from a single plaque of a patient with mycosis fungoides. In Vitro Cell Dev Biol 28A:161-167, 1992 (3 pt 1) 28. Yan PS, Chen CM, Shi H, et al: Dissecting complex epigenetic alterations in breast cancer using CpG island microarrays. Cancer Res 61: 8375-8380, 2001 29. Wei SH, Chen CM, Strathdee G, et al: Methylation microarray analysis of late-stage ovarian carcinomas distinguishes progressionfree survival in patients and identifies candidate epigenetic markers. Clin Cancer Res 8:22462252, 2002 30. Zhu X, Deng C, Kuick R, et al: Analysis of human peripheral blood T cells and single-cell-

derived T cell clones uncovers extensive clonal CpG island methylation heterogeneity throughout the genome. Proc Natl Acad Sci U S A 96:8058-8063, 1999 31. Rush LJ, Dai Z, Smiraglia DJ, et al: Novel methylation targets in de novo acute myeloid leukemia with prevalence of chromosome 11 loci. Blood 97:3226-3233, 2001 32. Sengupta PK, Smith EM, Kim K, et al: DNA hypermethylation near the transcription start site of collagen alpha2(I) gene occurs in both cancer cell lines and primary colorectal cancers. Cancer Res 63:1789-1797, 2003 33. Fraga MF, Esteller M: DNA methylation: A profile of methods and applications. Biotechniques 33:632,634,636-49, 2002 34. Kawano S, Miller CW, Gombart AF, et al: Loss of p73 gene expression in leukemias/ lymphomas due to hypermethylation. Blood 94:1113-1120, 1999 35. Esteller M, Gaidano G, Goodman SN, et al: Hypermethylation of the DNA repair gene O(6)methylguanine DNA methyltransferase and survival of patients with diffuse large B-cell lymphoma. J Natl Cancer Inst 94:26-32, 2002 36. Chim CS, Wong KY, Loong F, et al: SOCS1 and SHP1 hypermethylation in mantle cell lymphoma and follicular lymphoma: Implications for epigenetic activation of the Jak/STAT pathway. Leukemia 18:356-358, 2004 37. Conway KE, McConnell BB, Bowring CE, et al: TMS1, a novel proapoptotic caspase recruitment domain protein, is a target of methylation-induced gene silencing in human breast cancers. Cancer Res 60:6236-6242, 2000 38. Toyota M, Sasaki Y, Satoh A, et al: Epigenetic inactivation of CHFR in human tumors. Proc Natl Acad Sci U S A 100:78187823, 2003 39. Roman-Gomez J, Jimenez-Velasco A, Castillejo JA, et al: Promoter hypermethylation of cancer-related genes: A strong independent prognostic factor in acute lymphoblastic leukemia. Blood 104:2492-2498, 2004 40. Zani VJ, Asou N, Jadayel D, et al: Molecular cloning of complex chromosomal translocation t(8;14;12)(q24.1;q32.3;q24.1) in a Burkitt lymphoma cell line defines a new gene (BCL7A) with homology to caldesmon. Blood 87:3124-3134, 1996 41. Tracey L, Villuendas R, Dotor AM, et al: Mycosis fungoides shows concurrent deregulation of multiple genes involved in the TNF signaling pathway: An expression profile study. Blood 102:1042-1050, 2003 42. Martinez-Delgado B, Melendez B, Cuadros M, et al: Expression profiling of T-cell lymphomas differentiates peripheral and lymphoblastic lymphomas and defines survival related genes. Clin Cancer Res 10:4971-4982, 2004

43. Alizadeh AA, Eisen MB, Davis RE, et al: Distinct types of diffuse large B-cell lymphoma identified by gene expression profiling. Nature 403:503-511, 2000 44. Motiwala T, Ghoshal K, Das A, et al: Suppression of the protein tyrosine phosphatase receptor type O gene (PTPRO) by methylation in hepatocellular carcinomas. Oncogene 22:63196331, 2003 45. Wang Z, Shen D, Parsons DW, et al: Mutational analysis of the tyrosine phosphatome in colorectal cancers. Science 304:1164-1166, 2004 46. LaForgia S, Morse B, Levy J, et al: Receptor protein-tyrosine phosphatase gamma is a candidate tumor suppressor gene at human chromosome region 3p21. Proc Natl Acad Sci USA 88:5036-5040, 1991 47. Ahuja N, Mohan AL, Li Q, et al: Association between CpG island methylation and microsatellite instability in colorectal cancer. Cancer Res 57:3370-3374, 1997 48. Esteller M, Garcia-Foncillas J, Andion E, et al: Inactivation of the DNA-repair gene MGMT and the clinical response of gliomas to alkylating agents. N Engl J Med 343:1350-1354, 2000 49. Rossi D, Capello D, Gloghini A, et al: Aberrant promoter methylation of multiple genes throughout the clinico-pathologic spectrum of B-cell neoplasia. Haematologica 89:154164, 2004 50. Reddy AN, Jiang WW, Kim M, et al: Deathassociated protein kinase promoter hypermethylation in normal human lymphocytes. Cancer Res 63:7694-7698, 2003 51. Lissy NA, Davis PK, Irwin M, et al: A common E2F-1 and p73 pathway mediates cell death induced by TCR activation. Nature 407: 642-645, 2000 52. Martinez-Delgado B, Melendez B, Cuadros M, et al: Frequent inactivation of the p73 gene by abnormal methylation or LOH in non-Hodgkin’s lymphomas. Int J Cancer 102:15-19, 2002 53. Siu LL, Chan JK, Wong KF, et al: Aberrant promoter CpG methylation as a molecular marker for disease monitoring in natural killer cell lymphomas. Br J Haematol 122:70-77, 2003 54. Issa JP, Garcia-Manero G, Giles FJ, et al: Phase 1 study of low-dose prolonged exposure schedules of the hypomethylating agent 5-aza2#-deoxycytidine (decitabine) in hematopoietic malignancies. Blood 103:1635-1640, 2004 55. Cheng JC, Yoo CB, Weisenberger DJ, et al: Preferential response of cancer cells to zebularine. Cancer Cell 6:151-158, 2004 56. Davis AJ, Gelmon KA, Siu LL, et al: Phase I and pharmacologic study of the human DNA methyltransferase antisense oligodeoxynucleotide MG98 given as a 21-day continuous infusion every 4 weeks. Invest New Drugs 21:85-97, 2003

11

www.jco.org


91

92