Send Orders of Reprints at
[email protected] 82
Current Stem Cell Research & Therapy, 2013, 8, 82-90
Myogenic Potential of Mesenchymal Stem Cells - the Case of Adhesive Fraction of Human Umbilical Cord Blood Cells Iwona Grabowska1, Wladyslawa Streminska1, Katarzyna Janczyk-Ilach1, Eugeniusz K. Machaj2,3, Zygmunt Pojda2,3, Grazyna Hoser4, Jerzy Kawiak4, Jerzy Moraczewski1, Maria A. Ciemerych1 and Edyta Brzoska*,1 1
Department of Cytology, Institute of Zoology, Faculty of Biology, University of Warsaw, 02-096 Warsaw, Poland; Department of Cellular Engineering, Maria Sklodowska-Curie Memorial Cancer Center and Institute of Oncology, 02781 Warsaw, Poland; 3Department of Regenerative Medicine, Military Institute of Hygiene and Epidemiology, 01-163 Warsaw, Poland; 4Department of Clinical Cytology, Medical Centre of Postgraduate Education, 01-813 Warsaw, Poland 2
Abstract: Different sources of stem cells are considered as a potential source of precursor cells that could improve skeletal muscle regeneration. Under physiological conditions muscle regeneration is based on the satellite cells, i.e. adult muscle precursor cells that are localized between muscle fiber and surrounding basal lamina. These cells remain quiescent but after skeletal muscle injury activate, proliferate, differentiate, and fuse either to form new muscle fibers or reconstruct the damaged ones. As it was shown in many studies few populations of stem cells other than satellite cells are able to support skeletal muscle regeneration. Among them are mesenchymal stem cells (MSCs) that are present in many niches within adult organism and also in fetal tissues, such as human umbilical cord blood (HUCB) or umbilical cord connective tissue, i.e. Wharton’s jelly. Thus, MSCs are intensively tested to prove that they are able to differentiate into various cell types, including skeletal myoblasts, and therefore could be useful in regenerative medicine. In our previous study we showed that MSCs isolated from Wharton’s jelly expressed pluripotency as well as myogenic markers and were able to undergo myogenic differentiation both in vitro and in vivo. We also analyzed the potential of HUCB cells population which contains not only MSCs but also hematopoietic precursors. Our analyses of whole population of HUCB cells showed that these cells express myogenic regulatory factors, i.e. MyoD, and are able to contribute to skeletal muscle regeneration. In the present study we document that adherent fraction of HUCB cells, i.e. the cells that constitute the subpopulation enriched in MSCs, expresses pluripotency and myogenic markers, and have a positive impact at the regeneration of injured mouse skeletal muscle.
Keywords: Human umbilical cord blood, mesenchymal stem cells, myogenesis, regeneration. INTRODUCTION The phenomenon of muscle regeneration occurs thanks to the satellite cells that are precursor cells located between muscle fiber sarcolemma and surrounding basal lamina (reviewed in [1, 2]). Under physiological conditions these cells are able to self-renew their population fulfilling one of the characteristics of stem cells. As a result of injury damaged muscle fiber is first destroyed and then reconstructed (reviewed in [3, 4]). During the destruction phase secreted calcium-dependent proteases, such as calpains, digest structural proteins, e.g. titin, nebulin, myosin, and actin. Next, inflammatory cells phagocyte necrotic muscle fibers. Simultaneously, activated resident macrophages release chemoattractants that guide other cells, such as neutrophils and macrophages into the site of injury. Two distinct populations of macrophages were described to infiltrate damaged muscle *Address correspondence to this author at the Department of Cytology, Institute of Zoology, Faculty of Biology, University of Warsaw, Ilji Miecznikowa 1, 02-096 Warsaw, Poland; Tel: (+48) 225542203; Fax: (+48) 225542202; E-mail:
[email protected] 2212-3946/13 $58.00+.00
[5]. After 24h post injury the early “inflammatory” macrophages, expressing CD68 surface marker, lacking CD163 marker, and secreting pro-inflamatory cytokines, such as tumor necrosis factor (TNF ) as well as interleukin 1 (IL 1), appear within the site of damage. After next 2 – 4 days “anti-inflammatory” macrophages colonize the tissue. These cells, derived from “inflammatory” macrophages by phenotype switch, lack CD68, express CD163, and produce anti-inflammatory cytokines, such as interleukin 10 (IL 10). Importantly, these cells also release the factors that activate satellite cells. The most important event during muscle reconstruction is the activation of satellite cells [6, 7]. Quiescent satellite cells are characterized by the expression of transcription factor Pax7 which is a paired box protein [8, 9]. However, initiation of myogenic program, associated with satellite cell activation, needs the expression of basic helix loop helix (bHLH) myogenic regulatory transcription factors (MRFs), i.e. myoblast determination protein (MyoD), myogenic factor 5 (Myf5), myogenin, and muscle-specific regulatory factor MRF4 (known also as Myf6) [10-12]. The expression of © 2013 Bentham Science Publishers
Myogenic Potential of Mesenchymal Stem Cells
MRFs is regulated by Pax7 and its paralog Pax3. These factors were shown to directly bind proximal promoters of MyoD and distal enhancer elements of Myf5 [13]. On the other hand timely regulated MRFs, control the proper myoblast differentiation, for example by controlling the expression of skeletal muscle structural proteins. Thus, activated satellite cells intensively proliferate producing population of myoblasts that differentiate and fuse to form myotubes, and then immature muscle fibers with centrally located nuclei (reviewed in [14]). Next, in the process of muscle fibers maturation their nuclei migrate towards the periphery and become localized in the vicinity of the sarcolemma. The proper muscle fiber formation depends on the myoblast fusion. Our previous studies showed that formation of multiprotein complex in the cell membrane is the key event allowing both myoblast adhesion and fusion. This complex includes integrin integrin 3 and 1 subunits, as well as metalloproteinase ADAM12 [15]. Moreover, during myotube formation ADAM12 binds integrin 7 and 9 [16, 17]. Also M-cadherin was shown to be involved in this process [18]. Thus, several “elements”, such as adhesion proteins, sequentially expressed MRFs, and skeletal muscle specific structural proteins have to be “in place” in order to produce functional muscle fiber.
Current Stem Cell Research & Therapy, 2013, Vol. 8, No. 1
83
AC133+ cells into the bloodstream of mdx mice (Xchromosome linked muscular dystrophy) - an animal model of DMD, significantly improved the structure and functionality of regenerated dystrophic muscles. New muscle fibers were formed with the participation of AC133+ cells. Importantly, progeny of these cells were also present within the satellite cell niche, suggesting that they might be able to reconstruct satellite cell population [29]. Importantly, some of mentioned cells can be delivered into the site of injury via circulation, i.e. after intravenous injection [32].
Under some pathological conditions skeletal muscle regeneration can be affected by the lack of satellite cells. Among such pathologies are skeletal muscle dystrophies, such as Duchenne’s muscle dystrophy (DMD) caused by the mutation in dystrophin gene. Absence of dystrophin manifests in the repetitive rounds of muscle damage and regeneration and leads to the exhaustion of satellite cells pool. This in turn disables muscle regeneration and results in patient death. Among the therapeutic strategies envisioned to treat dystrophic or severely damaged muscles is the transplantation of exogenous stem cells isolated either from skeletal muscles or other tissues. Amid the cells of the first choice, selected to be transplanted into injured or dystrophic skeletal muscles, were satellite cells. For example, the transplantation of single muscle fiber, together with resident satellite cells, was shown to improve regeneration of injured mouse limb muscle [19]. However, many other studies showed limitations in using myoblasts as donor cells. First, the satellite cells transplanted into damaged skeletal muscle are characterized by restricted migration abilities. Next, such transplanted cells are characterized with high apoptosis rate. Moreover, in vitro culture of satellite cell-derived myoblasts which is necessary to expand their population, results in the loss of their regenerative ability.
Among the stem cells that do not reside within the muscle but were shown to be able to effectively follow the myogenic program are mesenchymal stem cells (MSCs) [33]. MSCs present in the bone marrow are characterized by expression of CD105, CD73, CD90, and lack of expression of hematopoietic markers, i.e. CD45, CD34, CD14. These cells play important role in the formation of hematopoietic microenvironment, modulation of immune cells activity, and regulation of cell trafficking. In vitro cultured MSCs constitutively secret a wide range of chemokines, including CCL2, CCL3, CCL4, CCL5, CCL7, CCL20, CCL26, CX3CL1, CXCL1, CXCL2, CXCL5, CXCL8, CXCL10, CXCL11, and CXCL12 (known as SDF-1). MSCs were also identified in fetal cord blood, umbilical cord blood, and Wharton’s jelly (reviewed in [34]). In vitro grown cord blood MSCs are spindle-shaped, plastic-adherent, and express surface markers typical for bone marrow MSCs. They could undergo adipo-, chondro-, and osteogenic differentiation, and also could give rise to neurons, glial cells, hepatocytes, skeletal myoblasts, or cardiomyocytes (reviewed in [34]). Umbilical cord MSCs (UC-MSCs) could be found in all structures forming the umbilical cord: Wharton’s jelly, perivascular regions, and subendothelium of umbilical vein, and are similar to MSCs isolated from other sources. UC-MSCs could also differentiate in osteocytes, chondrocytes, and adipocytes, as well as cardiomyocytes [35], neurons and glial cells [36], hepatocytes [37], pancreas cells [38], and myoblasts [39]. MSCs are present not only in bone marrow or fetal tissues but also were found in other locations, including adipose tissue [40], skin [41], liver, kidney, brain [42], skeletal muscles [43], and heart muscle [4]. Few features of MSCs make them a very attractive tool that can be used in regenerative medicine [45]. They are present in many tissues, easy to isolate and culture in vitro, and also able to engraft injured tissues (reviewed in [46]). In some clinical trials MSCs were already tested to improve myocardial infarction [47], support organ transplantation [48], ameliorate Crohn’s disease [49], or multiple sclerosis [50].
The process of muscle regeneration could be supported with other stem cells, such as mesoangioblasts (perivascular cells) [20-24], side population (SP) cells [25], myoendothelial cells [26], PICs (PW1+/Pax7- interstitial cells) [27], pericytes (smooth muscle-like cells surrounding the endothelium at the microvasculature wall)[28], or the CD133positive cells [29-31]. CD133+ cells, also described as AC133+, were shown to be present in the peripheral blood, bone marrow (BM), kidney, pancreas, umbilical cord blood, fetal liver, and other tissues. They have the ability to differentiate into various lineages, including hematopoietic stem cell lines, neuronal or endothelial cells. Introduction of
Until now, many studies aimed at the assessment of the myogenic potential of MSCs. First to be examined were MSCs isolated from bone marrow (BM). Pioneering experiments conducted in the 1980’s included the transplantation of BM cells into the regenerating muscles of rats and monkeys. Under such experimental conditions the presence of BM cells significantly improved muscle regeneration and also reduced fibrosis, i.e. excessive development of connective tissue [51]. Subsequent reports indicated that BM cells are able to respond to signals present in the environment of regenerating muscle, synthesize some myogenic markers Myf5, integrin 7, c-Met, and finally participate in the re-
84 Current Stem Cell Research & Therapy, 2013, Vol. 8, No. 1
construction of muscle fibers. Importantly, they were also shown to colonize the satellite cell niche [52, 53]. In 1998, Ferrari and co-workers analyzed BM cells participation in the regeneration of mouse skeletal muscle [52]. In this experiment whole population of BM cells were transplanted into damaged skeletal muscle of immunodefficient mice (SCID/BG). However, the obtained results were unsatisfactory because the number of myonuclei derived from transplanted BM cells was very low. Similar studies using different experimental models have been conducted by other research groups (e.g. [32, 53]). Since BM consists of different stem cell populations - hematopoietic stem cells (HSCs) and stromal cells (also described as MSCs) experiments mentioned above did not allow to determine whether the two populations of BM stem cells are equally involved in the regeneration of skeletal muscle. In 2003, two research groups independently demonstrated that a single HSC transplanted into mouse damaged skeletal muscle participated in the regeneration [54, 55]. Daughter cells derived from the transplanted BM cell colonized muscle and took part in the formation of myofibers. Camargo and colleagues (2003) pointed out, however, that cells derived from HSCs have not been able to colonize the satellite cell niche. This suggested that HSCs took part in the formation of myofibers only by fusion with myoblasts and fibers of the recipient, but not by transforming into functional myoblasts. Subsequent experiments confirmed that HSCs were able to participate in the formation of muscle fibers with a low frequency (usually less than 1%) and were only occasionally detected in satellite cell niche. Moreover, Sherwood and colleagues showed that HSCs are not able to take part in subsequent rounds of muscle regeneration which means that they were not functional [56]. De Bari and colleagues documented that MSCs isolated from the synovial membrane participated in the regeneration of mouse skeletal muscle and were present in satellite cells niches. In addition, these cells partially improved function of skeletal muscle of mdx mice [33]. After the introduction into the dystrophic or damaged muscle MSCs took part in the creation of a significant number of muscle fibers (30-60% of all fibers analyzed), and were able to colonize satellite cell niche, as well as to participate in subsequent rounds of regeneration [33, 57, 58]. Moreover, in vitro experiments proved that MSCs significantly more often than HSCs fused with the cultured myoblasts, such as C2C12 cells, suggesting that these cells possess greater myogenic potential than HSCs [57]. Multipotent MSCs along with the hematopoietic stem and precursor cells are also present within human umbilical cord blood (HUCB) [59, 60]. As a consequence of their stemness HUCB cells can reconstitute hematopoietic system [61-65]. These cells also possess endothelial [66-69], osteogenic [70], as well as neurogenic potential [71-76]. Adherent fraction of HUCB cells constitute the subpopulation enriched in MSCs [77-79]. However, the full potential of these adherent cells has not yet been precisely tested. Despite that it has been shown that these cells were able to contribute at least to the embryonic neurogenesis [80]. In our own study we showed that HUCB cells are also able to participate in skeletal muscle regeneration, however their potential was
Grabowska et al.
limited [81]. Similar observation was made for umbilical cord mesenchymal stem cells (UC-MSC) [39]. In present study we tested myogenic potential of adherent fraction of human umbilical cord blood cells (adHUCB cells). We suggest that the enrichment of HUCB cells in the adherent ones would improve their efficiency to engraft injured muscle and improve regeneration. MATERIALS AND METHODS Human umbilical cord blood samples were processed according to the procedures approved by the Institutional Review Board of the Maria Sklodowska-Curie Memorial Cancer Center and Institute of Oncology. All animal studies were approved by Local Ethics Committee No. 4 in Warsaw, Poland. Isolation and Culture of Adherent Fraction of Human Umbilical Cord Blood Cells (adHUCBC) The term placentas from healthy donor mothers were obtained with former informed consent. The umbilical cord blood (30–50 ml) was drained with the standard Baxter set with citrate volume reduced to 23 ml. Numbers of white blood cells and mononuclear cells were estimated using Sysmex 820 semiautomatic hematological analyzer (Sysmex Co., Kobe, Japan). Next, blood, diluted 1:1 with phosphatebuffered saline (PBS) was applied to Ficoll (Invitrogen Ltd, Paisley, UK) -Uropoline (Polpharma SA, Starogard Gdanski, Poland) of density (d) = 1.077 g/ml, and centrifuged for 40 minutes, at 400 g, at 4°C. Isolated cells were centrifuged, pelleted, and washed in DMEM (Invitrogen Ltd, Paisley, UK) containing 10% fetal bovine serum (FBS, PAN Biotech GmbH, Aidenbach, Germany) [81]. Obtained cells were cultured in RPMI (Invitrogen Ltd, Paisley, UK) supplemented with 10% FBS (Invitrogen Ltd, Paisley, UK), for two weeks without passaging. The adherent HUCB (adHUCB) cells were then harvested for mRNA extraction, immunolocalization of selected epitopes or transplantation into regenerating mouse muscles. Each experiment involved analyses of at least 3 independent cell batches collected from different donors. Animals and Surgical Procedures NOD.CB17-Prkdcscid/J (described as NOD/SCID, i.e. Non Obese Diabetic/Severe Combined Immunodeficient) mice were purchased from Charles River Laboratories (France). The animals were anesthetized with pentobarbital sodium salt (Sigma - Aldrich, St. Louis, MO, USA) in physiological saline by an intraperitoneal injection (30 mg/kg of body mass). Gastrocnemius muscle was injected with 25μl of 10μM cardiotoxin (CTX, Sigma - Aldrich, St. Louis, MO, USA) in PBS. Three days after CTX injection 1 x 106 of adHUCB cells in 10l of physiological saline, were transplanted into the CTX-injured muscle. Control muscles were either intact, i.e. non-regenerating, or CTX-injected only. Regenerating muscles isolated at day 7th and 14th after the procedure were weighted. RT-PCR Total RNA was isolated from adHUCB cells using High Pure RNA Isolation Kit (Roche Diagnostics GmbH, Mannheim, Germany) according to manufacturer’s protocol. The
Myogenic Potential of Mesenchymal Stem Cells
first-strand cDNA was synthesized and then amplified with Titan One Tube RT-PCR Kit (Roche Diagnostics GmbH, Mannheim, Germany) using 0.1μg of total RNA as a template, with appropriate set of primers, specific for human sequences, under previously established conditions: (35 cycles) denaturation 94°C, 30 sec; annealing 45 sec, temp. depending on primers (annealing temp. listed below); elongation 68°C, 45 sec. Obtained products were separated in 1.5% Agarose LE gels (Roche Diagnostics GmbH, Mannheim, Germany) containing ethidium bromide. Optical densities of bands were analyzed using Gel Doc 2000 (Bio-Rad, Hercules, CA, USA) equipped with Quantity One software (BioRad, Hercules, CA, USA). The presence of mRNAs encoding Oct-4 (55.5°C; [82]), Nanog (65°C, [83]), Pax7 (53.4°C, [84]), MyoD (55.2°C, [85]), Myf5 (55.3°C, [33]), myogenin (53.8°C, [33]), integrin 3 (52.3°C, [85]), integrin 1 (57.4°C, [85]), M-cadherin (57.4°C, own design: forward 5’ TGACATTGCCAACTTCATCAG, reverse 5’ GATGAGAGCTGTGTCGTAGGG), ADAM12 (56.6°C, [86]), SDF1 (55.2°C, [87, 88]), CXCR4 (53.8°C [88] or 57.4°C, [89]), and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase GAPDH (52.3°C, [90]), was determined. Each analysis was performed at least three times, using mRNA isolated from three different batches of in vitro cultured adHUCBCs. Immunolocalization adHUCB cells, in vitro cultured on sterile cover glasses in 6-well plates, were fixed with 3% PFA in PBS for 10 min., and processed for immunolocalization of selected epitopes, according to standard previously described procedure [81, 91]. Immunodetection was performed using following primary antibodies: mouse anti-Oct3/4 (Santa Cruz Biotechnology, Santa Cruz, CA, USA; sc-5279), mouse anti-integrin 3 subunit (Santa Cruz Biotechnology, Santa Cruz, CA, USA; sc-7019), rabbit anti-M-cadherin (Santa Cruz Biotechnology, Santa Cruz, CA, USA; sc-10734), rabbit antiADAM12 (Santa Cruz Biotechnology, Santa Cruz, CA, USA; sc-25579), followed by rabbit anti-mouse IgG Alexa Fluor 488 and goat anti-rabbit IgG Alexa Fluor 488 (Molecular Probes, Invitrogen Ltd., Paisley, UK; A-11059 and A-11008). Chromatin was visualized either with DRAQ5 (Biostatus Ltd, Leicestershire, UK). Cells were analyzed with confocal microscope Axiovert 100M (Carl Zeiss Inc., Jena, Germany) equipped with LSM 510 software. Each analysis was performed at least three times using material collected during three independent experiments. Statistical Analysis Results were analyzed using SigmaStat 3.5. We applied ANOVA test to evaluate the significance of the difference between each pair of means. p
