N. Egypt. J. Microbiol. Vol. 48, September, 2017 ...

N. Egypt. J. Microbiol. Vol. 48, September, 2017.

14

VIRULENCE CHARACTERISTICS OF METHICILLIN RESISTANT STAPHYLOCOCCUS AUREUS ISOLATED FROM DIFFERENT CLINICAL SOURCES BY Ramadan Hassan; Rasha Barwa; Mohamed M. EL-Sokkary and Dina Ashraf

FROM Microbiology and Immunology Department, Faculty of Pharmacy, Mansoura University, Mansoura 35516, Egypt.

ABSTRACT This study reports the virulence characteristics of Methicillin-resistant Staphylococcus aureus (MRSA) isolates from different Mansoura Hospitals. From 120 S. aureus isolates 88 isolates were identified as MRSA by screening with the cefoxitin and oxacillin disc diffusion method and molecular method. Wound was considered the most predominant source for isolation of MRSA in our study. In addition, it was found that the highest prevalence of virulence factors were detected in wound isolates. Antimicrobial sensitivity testing revealed that 78.4% of MRSA isolates were resistant to cefotaxim and 54.5% of MRSA isolates were resistant to gentamicin. The most suitable antibiotic in the present study for treatment of MRSA was vancomycin and linezolid where only 0% and 4.5% were resistant respectively. Ten virulence genes (LukE, LukD, LukF, LukS, hla, geh, cna, icaA, icaD and tst) were detected by PCR. Among all tested genes, LukE (89.74%) and tst (4.55%) genes exhibited the highest and lowest frequencies, respectively. Our results indicate MRSA infection remains a significant problem in Mansoura Hospitals and to solve the MRSA infection problem effectively, further efforts toward infection control and management strength should be made with more studies about MRSA.

INTRODUCTION The massive consumption or misuse of therapeutic antibiotics by people suffering from S. aureus infections, lead to acquisition of resistance to multiple antimicrobial agents. These antimicrobial agents include tertracyclines, gentamycin and β-lactams. The resistance to methicillin is the most common one which leads to emergence of the highly problematic public health pathogen MRSA (Ventola, 2015). MRSA strains were reported first only in the hospitals as a major nosocomial hospital pathogen, it has been responsible for many nosocomial infections (health care associated MRSA; HA-MRSA), but since the 1990s, it has been observed emerging in the community (community associated MRSA; CA-MRSA) with the capacity to infect otherwise healthy individuals (Huang et al., 2006). MRSA was first reported in 1961 to be resistant to penicillin-related antibiotics including methicillin, dicloxacillin, nafcillin, oxacillin and the cephalosporins (Liu et al., 2016).

15


Resistance of methicillin in staphylococci is due to the obsession of a mobile genetic element (MGE) called the staphylococcal cassette chromosome mec (SCCmec). SCCmec is a DNA fragment ranging from 21 to 67 kb in size, depending on the SCCmec type (Otto, 2012). Up to date, eleven SCCmec types have been established for MRSA (Liu et al., 2016). MRSA is a predominant pathogen, causing various infectious diseases, including impetigo, boils, abscesses, folliculitis, cellulitis and a number of rarer but more serious diseases such as necrotizing fasciitis and pyomyositis, necrotizing pneumonia and infective endocarditis). Therefore, it has been considered to be one of the most predominant nosocomial pathogens (Raygada and Levine, 2009). Also, MRSA has been lately regarded as an important foodborne microorganism, which may pose potential hazards to both food and occupational staff in the food industry (such as food handlers, asymptomatic carriers and uncolonized individuals) (Xu et al., 2012). MRSA is known for its ability to cause a wide domain of important infections in humans. This is due to expression a wide array of potential virulence factors that involved in the way the disease develops , giving this bacterium the chance to attache to surfaces or/and tissues, avoid or invade the immune system, and leading to harmful toxic effects to the human (Gordon and Lowy, 2008). Virulence factors are divided into cell-surface factors such as microbial surface components recognizing adhesive matrix molecules (MSCRAMMs), capsular polysaccharides, and staphyloxanthin (carotenoid pigment) and secreted factors as superantigens, pore-forming toxins and various exoenzymes such as lipases, nucleases, proteases, hyaluronidase, and staphylokinase (SAK) (Costa et al., 2013). Objective The aims of the current study were to reveal some of the virulence genes among MRSA and their relation with isolation sources and to investigate the virulence characteristics based on virulence gene profile.

MATERIALS AND METHODS 1. Isolation and identification of Staphylococcus aureus isolates In this study, bacterial specimens were collected from different clinical sources including burn, sputum, blood, wound, diabetic foot, abcess, urine, rectum, throat, endotracheal tube and prostate under medical attention with aseptic precautions. The specimens were collected from patients in different Mansoura Hospitals in the period from September 2014 to October 2015. S.aureus isolates were identified according to the biochemical standard methods (Vandepitte, 2003). 2. Detection of MRSA isolates and antibiotic susceptibility For detection of MRSA, all the identified S.aureus were tested for their susceptibility to oxacillin (1µg) and cefoxitin (30 µg) by agar diffution method as illustrated in clinical and laboratory standards institute guidelines (CLSI, 2014). The susceptibility of all the detected MRSA isolates to vancomycin (10 µg), linezolid (30 µg), cefotaxime (30 µg), imipenem (10 µg) and gentamicin (10 µg) was also evaluated by disc diffusion method (CLSI, 2014). The activity of the tested


16

antibiotics against MRSA isolates was investigated from the respective interpretation charts according to CLSI guidelines (CLSI, 2014). 3. DNA extraction Rapid DNA extraction method (colony PCR) was performed according to (Zhang et al., 2004). All MRSA isolates were streaked on mannitol salt agar for 24 hrs. Subsequently, single pure colony was streaked on nutrient agar plate and incubated for 24 hrs. One–two fresh pure colonies, were suspended in 100 μl of sterile nuclease free water in 0.2 ml sterile PCR tube. Heat block was performed in thermocycler at 95°C for 10 mins followed by centrifugation at 5000 rpm for 5 mins and the obtained supernatant containing the DNA was stored at -20°C. 4. Polymerase chain reaction for detection of virulence and toxin genes The virulence genes of mecA, Leukocidins ( Luk E, Luk D, Luk F and Luk S ), alpha hemolysin (hla), intercellular adhesion genes (icaA, icaD), lipase encoding gene (geh), collagen binding protein (cna) and toxic shock toxin (tsst-1) were detected and amplified using the following reaction: 12.5 μl DreamTaq Green PCR Master Mix (2X), 3 μl of bacterial DNA, 1 μl of each primer (Table 1), and 7.5 μl nuclease free water for a total of 25 μl per reaction. The reaction mixture was amplified according to the following program: one cycle of initial denaturation at 95°C for 5 mins, followed by 40 cycles of denaturation at 95°C for 30 sec, annealing for 30 sec at temperatures listed for each primer in (table 1) and then extension at 72°C for 1 min. A final extension at 72°C for 5 min (Moraveji et al., 2014). The reaction without DNA template was used as negative control. PCR products were visualized by UV illumination after electrophoresis using 1.5% agarose gel stained with ethidium bromide and compared by visual inspection with 100 base plus DNA marker. Table (1): The Oligonucleotide Sequences and Amplicon size of each gene used in this Study Gene name tsst-1

Type Fw Rv

CGTAAGCCCTTTGTTGCTTG TGTCAGACCCACTACTATACCA

lukE

Fw Rv

lukD lukF lukS hla icaA icaD cna

Sequence (5'-3')

Amplicon size (bp) 143

Temperature

Refrence

53

(Elbargisy et al., 2016)

TGCGTAAATACCAGTTCTAGGG TCCAACAGGTTCAGCAAGAG

199

52

Fw Rv

ACCAGCATTTGAACTACTTTGT TCTAATGGCTTATCAGGTGGAT

240

50

Fw Rv Fw Rv Fw Rv Fw Rv Fw Rv Fw Rv

TGTGCTTCTACTTTCCACCAT TGTGACTGACTTTGCACCA GGTCCATCAACAGGAGGTAAT AGGATTGAAACCACTGTGTACT GTAATAACTGTAGCGAAGTCTGGTGA AAACACATATAGTCAGCTCAGTAACA CTCAATCAAGGCATTAAACAGGC ACATGGCAAGCGGTTCATACT TGGTCAAGCCCAGACAGAGG TGATAATCGCGAAAATGCCC GTCAAGCAGTTATTAACACCAGAC AATCAGTAATTGCACTTTGTCCACTG

225

50

267

52

700

56

393

53

242

56

423

54

(Abdel-hamed et al., 2016)

(Hassan et al., 2012)


17

geh mecA

Fw Rv Fw Rv

GCGTGGTGTCAGTGTTAGCGG CGATTGTGACGTTGTCGATTGTGATC TGCTATCCACCCTCAAACAGG AACGTTGTAACCACCCCAAGA

Fw: Forward

450

58

286

50

Rv: Reverse

(Kondo et al., 2007)

bp: base pair

RESULTS 1. Isolation and identification of isolates A total of 220 clinical specimens were isolated from different clinical sources and 120 isolates were purified and recognized as S. aureus by biochemical standard assay methods. Eighty eight isolates were assured as MRSA by screening with the cefoxitin and oxacillin discs; where 88 S. aureus were resistant to cefoxitin and 85 isolates were resistant to oxacillin. The source of MRSA isolates were 29 from wound, 14 from burn, 13 from sputum, 9 from abcess, 5 from diabetic foot, 5 from blood, 4 from urine and 9 from other sources (figure 1). Regarding geographical source of isolation of MRSA isolates, 21 isolates were collected from MUH (Mansoura University Hospitals), 16 from MUCH (Mansoura University Children Hospital), 7 from CDH (Chest Diseases Hospital), 14 from BCC (Mansoura University Burns and Cosmetics Center), 17 from MIH (Mansoura International Hospital) and 13 from ICU (Microbiology diagnostic Infection Control Unit) as showed in (Figure 2). All the identified MRSA isolates by phenotypic methods were confirmed by PCR reaction for detection of mecA gene. The results revealed that 88 isolates harbored mecA gene and were confirmed as MRSA. 40

30

20

15.9

14.7 10.2

10

5.6

5.6 4.5

3.4 2.3

2.3

2.3

ou

nd Bu rn Sp ut um Ab ce D ia ss be tic fo ot Bl oo En d do U tra rin ch e ea lt R ub ec e ta ls Pr w os ab ta tic Th swa ro b at sw ab

0 W

Percent of MRSA isolates

32.9

Clinical specimens

18


Figure (1): Percentage distribution of MRSA isolates according to clinical sources of isolation

%15

%24

MUH MUCH CDH

%19

BCC

%18 %16

%8

MIH ICU

Figure (2): Prevalence of MRSA among six hospitals located in Mansoura city MUH: Mansoura University Hospitals MUCH: Mansoura University Children Hospital CDH: Chest Diseases Hospital BCC: Mansoura University Burns and Cosmetics Center MIH: Mansoura International Hospital ICU: Microbiology diagnostic Infection Control Unit

2. Antimicrobial susceptibility test In this study, antimicrobial susceptibility test was performed on 88 MRSA isolates. The isolates showed diverse resistance to the tested antimicrobial agents as illustrated in (figure 3). The most efficient antimicrobial agent was vancomycin where all isolates were sensitive followed by linezolid as only 4.5% of isolates were resistant. Cefotaxime was the least effective one where 78.4% of isolates were resistant. It was found that prevalence of MDR isolates (resistant to 3 or more classes of antimicrobial agents) was higher than NMDR isolates in all sources, where 86.36% of isolates were MDR.


19

100

percentage of resistant isolates

100

90.9

90

78.4

80 70 60

54.5

50 40 30 20

15.9 4.5

10

0

C

ef ox iti n O xa ci lli C n ef ot ax im G e en ta m ic in Im ip en em Li ne zo V lid an co m yc in

0

Antimicrobials

Figure (3): Antimicrobial resistance of MRSA isolates 3. Detection of virulence genes In the present study, amplification of genes coding for virulence factors revealed that 92% of MRSA isolates were carriers of at least three virulence genes. The most predominant genes revealed were LukE (89.74%) and LukD (87.18%). The frequency of other leukocidins was 59.06% for LukF and 60.19% for LukS. Regarding adhesion genes (icaA and icaD), it was found that icaD is more prevalent where it was detected among 81.78% of MRSA isolates. The least predominant gene was tst where it was revealed in 4.55% of the tested isolates. The frequency of distribution of other genes was 76.61%, 77.24% and 40.89% for hla, geh and cna respectively (Figure 4). The distribution of various virulence factors among different clinical sources was showed in (table 2). It was found that all virulence genes except tst were predominantly associated with wound isolates. Moreover, the frequency of distribution of all genes was higher among sputum and burn isolates than the other sources.


20

Percentage of prevalence

100

80

60

40

20

a cn

ge h

D ic a

A ic a

-1 ts

st

a hl

Lu kF

Lu kS

Lu kD

Lu kE

0

Virulence factors

Figure (4): The prevalence of virulence factors among MRSA isolates

Table (2): Percentage of virulence gene distribution among different clinical sources of MRSA Source Negative Wound Burn Sputum Abcess Diabetic foot Blood Urine Other

Percentage of isolates 32.95 15.9 14.77 10.23 4.5

LukE 10.26 28.4 13.63 14.77 9.09 4.54

LukF 40.94 17.04 10.22 12.5 6.81 2.27

LukD 12.82 28.4 14.77 13.36 6.81 4.54

LukS 39.81 21.59 7.95 9.09 3.4 2.27

5.68 4.5 10.23

5.68 4.54 9.09

2.27 1.14 6.81

5.68 3.4 10.22

3.4 3.4 9.09

Virulence genes hla Tst 23.39 95.45 44.8 0 7.95 1.14 7.95 1.14 1.14 0 1.14 0 2.27 1.14 10.22

0 0 2.27

cna 59.11 14.77 9.09 5.68 2.27 2.27

geh 22.76 23.86 11.36 14.77 6.81 3.4

icaA 28.45 22.72 12.5 12.5 6.81 3.4

icaD 18.22 26.14 13.63 12.5 6.81 3.4

2.27 0 4.54

5.68 2.27 9.09

3.4 2.27 7.95

4.54 4.54 10.22


21

Luk: Leukocidins genes hla: Alpha hemolysin protein geh: Lipase encoding gene adhesion genes tst: Toxic shock toxin

cna: Collagen binding icaA and icaD: intercellular

4. Virulence profile pattern associated with MRSA isolates A total of forty nine different profile patterns were observed among MRSA isolates (table 3). The most frequent profile associated with MRSA was P48 (LukE + LukD + LukS + Lukf + geh + cna + hla + icaA + icaD) it was exhibited by 11 isolates (12.5%). The second most common profile was P46 (LukE + LukD + LukS + Lukf + geh + hla + icaA + icaD) where it appeared in 6 (6.8%) of the isolates. Table (3): Distribution of toxin genes among methicillin-resistant S. aureus isolated from different specimens Pattern No. P1 P2 P3 P4 P5 P6

Toxin profile No toxin genes LukD LukE + LukD LukE + LukF LukE + icaA LukE + icaD

No. of isolates 1 1 1 1 1 2

P7 P8 P9 P10 P11 P12 P13

Luk E + geh + icaA LukD + LukF + icaA LukS + LukF + icaA LukD + icaA + icaD LukE + LukD + icaA LukE + LukD + icaD LukE + LukD + icaA + icaD

1 1 1 1 1 1 2

P14 P15 P16 P17

LukE + LukD + geh + icaD LukE + LukD + hla + icaD Luk E + LukD + cna + geh + icaA LukE + LukD + geh + hla + icaA + icaD

1 1 1 1

Clinical source Abscess Abscess Wound Abscess Abscess - Wound - Burn Sputum Wound Wound Burn D.F Burn - Wound - Urine Blood Wound Wound Wound

Continue table (3)…. Pattern Toxin profile No. LukE + LukD + LukF + geh + icaA + icaD P18

P19 P20 P21

LukE + LukD + LukF + geh + cna + icaA LukE + LukD + LukF + geh + hla + icaA + tst LukE + LukD + LukF + geh + cna + icaA + icaD

No. of isolates -1 -2 -1 1 1 3

Clinical source - Wound - Abscess - Blood Burn Sputum - Sputum - Abscess

22


-2 -1 -2 1

- D.F - Wound - Burn - Sputum Prostate

1

Burn

2

- Wound - Blood - Sputum - D.F Burn Urine - Urine - Endotracheal tube Wound - Wound - Rectum - Wound - Burn Wound - Wound - D.F - Blood - Throat Burn Wound Wound Wound Wound Rectum

P22

LukE + LukD + LukF + geh + hla + icaA + icaD

P23

P25

LukE + LukD + LukF + geh + hla + icaA + icaD + tst LukE + LukD + LukF + geh + cna + hla + icaA + icaD + tst LukS + LukE + LukD + geh

P26

LukS + LukE + LukD + geh + icaD

2

P27 P28 P29

LukS + LukE + LukD + geh + icaA + icaD LukS + LukE + LukD + icaA + icaD LukS + LukE + LukD + geh + hla + icaD

1 1 2

P30 P31

LukS + LukE + LukD + cna + icaA + icaD LukS + LukE + LukD + hla + icaA + icaD

1 2

P32

LukS + LukE + LukD + geh + hla + cna + icaD

P33 P34

LukS +LukE + LukD + geh +cna + icaA + icaD LukS + LukE + LukD + geh + cna + hla + icaA + icaD

-2 -1 1 4

P35 P36 P37 P38 P39

LukD + LukF + geh + cna + hla + icaA + icaD LukS + LukD + geh + icaD LukS + LukE + LukF + icaA LukS + LukE + LukF + geh + icaD LukS + LukD + LukF +cna + geh + icaA + icaD LukS + LukD + LukF + geh + cna + hla + icaA + icaD + tst LukE + LukD + LukS + Lukf + geh + icaD

1 1 1 1 1 1

LukE + LukD + LukS + Lukf + geh + icaA + icaD

1

P24

P40 P41

P42

3

- Sputum - Urine - Blood Sputum

Continue table (3)…. Pattern Toxin profile No. LukE + LukD + LukS + Lukf + geh + cna + P43 icaA LukE + LukD + LukS + Lukf + geh + cna + P44 icaD LukE + LukD + LukS + Lukf + cna + icaA + P45

No. of isolates 1

Clinical source Burn

1

Wound

1

Burn

23

P46

P47 P48

P49


icaD LukE + LukD + LukS + Lukf + geh + hla + icaA + icaD

LukE + LukD + LukS + Lukf + geh + cna + hla + icaD LukE + LukD + LukS + Lukf + geh + cna + hla + icaA + icaD

LukE + LukD + Luks + Lukf + geh + cna + icaA + icaD

6

1 -4 -2 -3 -1 3

- Wound - Burn - Sputum - Abscess - Throat - Prostate Endotracheal tube - Wound - Burn - Sputum - Endotracheal tube - Wound - Sputum - Abscess

D.F: Diabetic foot

DISCUSSION S. aureus clinical infection is influenced by the existence of antimicrobial resistance and virulence factors. Acquisition of antibiotic resistance in S. aureus, including changes in the secretion of virulence factor expression and resistance in order to survive with reduced expression poison, has been suggested (Alfatemi et al., 2014). MRSA is considered one of the most predominant bacterial pathogens that leading to serious community-acquired and nosocomial infections and widely spread all over the world in the last decades (Lim et al., 2012). It can cause a broad range of fatal infections and syndromes, as complicated skin and skin-structure infections (cSSSI) and serious hospital-acquired infections, especially bloodstream infections (BSIs) and ventilator-associated pneumonia (VAP) (Gould et al., 2012). In the present study, a total of 88 MRSA isolates were obtained from different clinical sources (wound, sputum, abscess, diabetic foot, blood, urine and miscellaneous sources), where our study showed that the prevalence of MRSA among S. aureus isolates was 73.3% which was in accordance with the (Sadaka et al., 2009) who reported MRSA prevalence of 71%. A higher percent (89.4%) were recorded by (Ahmed et al., 2011). In contrast, a lower prevalence was reported by (Mansour et al., 2009) in Mansoura University Hospitals, where only 47.2% of the isolates were identified as MRSA. In the present study the highest proportion of MRSA isolates belonged to wound with a rate of 32.95% (Figure.1). (Goudarzi et al., 2016) reported that the highest rate of MRSA isolates were recovered from wound was 30% which is consistent with our results and with (Fatholahzadeh et al., 2008) who reported that among the specimens isolated in their study, the highest proportion belonged to wound samples with a rate of 59.5%.

24


Mansoura University Hospital had the largest share of the collected MRSA isolates 24%. A quite similar prevalence was found in MIH (19%), MUCH (18%), BCC (16 %) and ICU (15%). The lowest prevalence was recorded in CDH (8%) (figure. 2). This diverse in propagation may be attributed to many factors like healthcare facilities allowed in the particular hospital, implementation and monitoring of infection control committee, rationale antibiotic usage which diverse from hospital to hospital (Alexander et al., 2011). MRSA isolates were identified based on the mecA gene and antimicrobial susceptibility. Our results revealed that the cefoxitin disc was the best predictor of methicillin resistance where 100% of cefoxitin resistant isolates harbored mecA gene as detected by PCR. Regarding oxacillin, it was less sensitive as it showed false negative results in 9% of MRSA isolates as illustrated in the study recorded by (Boutiba‐Ben Boubaker et al., 2004) where they concluded that the cefoxitin disk test (specificity 100%, sensitivity 96.5%) was better than the oxacillin disk methods (specificity 99.1%, sensitivity 90.4%). Testing with both cefoxitin and oxacillin disks would give sensitivity (100%) better than the cefoxitin test alone. Multidrug resistant (MDR) S. aureus is a serious problem for health. The emergence antibiotic resistant virulent isolates of S. aureus, especially MRSA is a major problem in the control and treatment of staphylococcal infections. The most critical situation is that MRSA isolates have protruded with co-resistance to most commonly used antimicrobials including aminoglycosides, other betalactam, fluoroquinolons, tetracyclines, chloramphenicol and macrolides (Kaur and Chate, 2015). This finding is supported by our result where 78.4% of MRSA isolates were resistant to cefotaxim and 54.5% of MRSA isolates were resistant to gentamicin (Figure.3). Nearly similar results were reported by (Elmakki et al., 2014) where their results revealed that 71.8% and 64.1% of MRSA were resistant to cefotaxim and gentamicin respectively. Indead, the most suitable antibiotic in our study for treatment of MRSA was vancomycin and linezolid where only 0% and 4.5% were resistant respectively. A quiet similar results were reported by (Rajaduraipandi et al., 2006) where 2.4% of MRSA isolates were resistant to linezolid. In fact, linezolid is currently the only authorized and well studied alternative to vancomycin in MRSA infections due to disadvantage and misuse of vancomycin as illustrated by (Pletz et al., 2010). Clinical activity of linezolid affirmed in many types of infections including, soft tissue infections, ventilator-associated pneumonia, complicated skin and nosocomial pneumonia (Shorr et al., 2005). The success of MRSA as a pathogen is attributed to its capacity to express a multitude of virulence factors that are responsible of host colonization, tissue invasion and dissemination. A higher mortality rate was observed among patients with invasive MRSA isolates than those with noninvasive isolates (Gordon and Lowy, 2008). In this respect, this study contributes to the recognition of virulence gene prevalence among well-characterized MRSA clinical isolates.

25


Our results revealed that the order of the prevalence of virulence genes among MRSA strains from highest to lowest was LukE, LukD, icaD, geh, hla, icaA, LukS, LukF, cna and tst (figure.4). Leukocidins are members of a toxin family known as synergohymenotropic toxins, as they act by the synergy of two proteins to form a pore on cell membranes (Abdel-hamed et al., 2016). In the current study, S. aureus isolates were inspected for their leukocidins genes (lukE, lukD, lukS and lukF). The frequency rates of LukE and LukD were 89.7% and 87.2% respectively that record little difference from results of (Nelson et al., 2015) who recorded the dispersal of LukE-LukD among MRSA isolates were 95%. Concerning lukF and lukS genes, they were revealed in 59.06% and 60.19% of isolates. The prevalence of lukF-lukS was variable in literatures. A lower prevalence were reported in the study of (Enany et al., 2010) where LukF-LukS were detected in 19.04% of isolates. (Marchese et al., 2009) reported that LukF were detected in 43% of isolates while LukS showed a lower prevalence (25%). Biofilm is the most important factor that participates in pathogenesis by acting as a barrier to antimicrobial agents and the host immune system that helps sustained bacterial colonization. Molecular studies confirm that during the late stages of attachment, organisms get attached to each other to form biofilms. This is achieved through polysaccharide intercellular adhesion (PIA), which is synthesized by products of the icaABCD operon (Moghadam et al., 2014). In this study, icaA and icaD strains were detected among 71.5% and 81.78% of isolates respectively. Our results regarding adhesion genes were approximately the same result as recorded by (Ghasemian et al., 2015) where prevalence of both genes was 73%. In another study conducted by (Rodrigues et al., 2013), prevalence of icaA is high where 94.8% of isolates harbored this gene. Hemolysin are pore-forming water soluble toxin known to be expressed by most S. aureus isolates and have strong affinity for epithelial cells, macrophages, monocytes, fibroblast and erythrocytes and known to be regulated by accessory gene regulator (Bitrus et al., 2016). We observed that 76.6% of our isolates were positive for the gene coding for alpha hemolysin. The high frequency of hla gene coincides with results of studies conducted by (Yu et al., 2012) and (Zarfel et al., 2013) where hla gene was detected among 78.4% and 78% of MRSA isolates in both studies respectively. Glycerol ester hydrolase (geh) is lipase secreted by MRSA can catalyze the hydrolysis of the ester bonds between glycerol and fatty acids, which form triglycerides and this is believed to aid the bacteria by contributing to the breakdown of host tissue, subsequently liberating nutrients and has been shown to interfere with the host granulocyte function, and increase survival of the bacteria against the host defense by inactivating bactericidal lipids (Vijayakumaran, 2013). The frequency of the geh gene in MRSA isolates from various specimens obtained in our study was 77.24% which is higher than that recorded by (Bitrus et al., 2016) in Malaysia where 28.5% of isolates harbored geh gene. The collagen-binding protein cna mediates bacterial adherence to collagen substrates and collagenous tissues and prevent the classical pathway of complement

26


activation that encoded by (cna) gene (Elasri et al., 2002). The frequency of the cna gene in this study was 40.89% which is slightly lower than the study performed by (Yu et al., 2012). Toxic shock syndrome toxin 1 (TSST-1) is a superantigenic toxin secreted by some MRSA isolates. TSST-1 is encoded by the tst gene, is a major virulence factor in toxic shock syndrome (TSS), staphylococcal scarlet fever, and neonatal toxic shock like exanthematous diseases (NTED) (Durand et al., 2006). In our study only 4.55% of our MRSA isolates were positive for tst gene. Low prevalence of tst gene was also reported by (Monecke et al., 2012) where 7.48% of MRSA isolates harbored tst gene and none of the isolates were positive for tst gene in the study by (Shukla et al., 2010). The presence of single virulence factor rarely renders the microorganism virulent. In fact, combination of various virulence factors is responsible for microbial pathogens. Our results revealed that 92% of MRSA isolates harbored three or more virulence genes. Analysis of virulence factors combination has brought out 49 profiles (Table 3). The most frequent profile associated with MRSA was P48 (LukE + LukD + LukS + Lukf + geh + cna + hla + icaA + icaD) it was exhibited by 11 isolates (12.5%). Among 49 profiles, thirty four patterns were exhibited by single isolate. These finding suggested that MRSA isolates genetically diverse. Analysis of virulence profiles did not allow clear relation between sources of isolation and the distribution of virulence genes. This finding was supported by the results reported by (El-baz et al., 2016). A direct relation between bacterial virulence factors and source of isolation did not detected in this study.

CONCLUSION MRSA infection is a significant problem in our country. This study analyzed the virulence characteristics of MRSA isolates from different clinical sources but the results did not report direct relation between the bacterial virulence and the source of isolation. The antimicrobial therapy should be based on in vitro susceptibility and the hospital-based antimicrobial policies should be followed to control the emergence and spread of further MRSA isolates However, the higher frequency of some virulence genes in this study may reflect the spread of isolates containing these genes in Mansoura Hospitals and the high prevalence of MRSA in wound samples indicate that MRSA is considered common cause of nosocomial wound infections. Therefore, we require permanent control of MRSA spread in the Mansoura hospitals, further efforts toward infection control and management strength should be made with more studies about MRSA infections.

REFERENCES Abdel-hamed, A.-H.A.; Abdel-Rhman, S.H. and El-Sokkary, M.A. (2016): Studies on leukocidins toxins and antimicrobial resistance in Staphylococcus aureus isolated from various clinical sources. African Journal of Microbiology Research; 10(17): 591-599.

27


Ahmed, S.; Ahmed, A.; Mohamed, W.; Feky, M.; Daef, E.; Badary, M. and Hetta, H. (2011): Nosocomial Vancomycin and Methicillin Resistant Staphylococcal Infections In Intensive Care Units In Assiut University Hospitals. Egyptian Journal of Medical Microbiology; 20(2): Alexander, J.W.; Solomkin, J.S. and Edwards, M.J. (2011): Updated recommendations for control of surgical site infections. Annals of surgery; 253(6): 1082-1093. Alfatemi, S.M.H.; Motamedifar, M.; Hadi, N. and Saraie, H.S.E. (2014): Analysis of virulence genes among methicillin resistant Staphylococcus aureus (MRSA) strains. Jundishapur journal of microbiology; 7(6): Bitrus, A.A.; Zakaria, Z.; Bejo, S.K. and Othman, S. (2016): Persistence of antibacterial resistance and virulence gene profile of methicillin resistant Staphylococcus aureus (MRSA) Isolated from humans and animals. Pakistan Veterinary Journal; 36(1): Boutiba‐Ben Boubaker, I.; Ben Abbes, R.; Ben Abdallah, H.; Mamlouk, K.; Mahjoubi, F.; Kammoun, A.; Hammami, A. and Ben Redjeb, S. (2004): Evaluation of a cefoxitin disk diffusion test for the routine detection of methicillin‐resistant Staphylococcus aureus. Clinical microbiology and infection; 10(8): 762-765. Costa, A.R.; Batistão, D.W.; Ribas, R.M.; Sousa, A.M.; Pereira, M.O. and Botelho, C.M. (2013): Staphylococcus aureus virulence factors and disease. Microbial pathogens and strategies for combating them: science, technology and education; 1: 702-710. Durand, G.; Bes, M.; Meugnier, H.; Enright, M.C.; Forey, F.; Liassine, N.; Wenger, A.; Kikuchi, K.; Lina, G. and Vandenesch, F. (2006): Detection of new methicillin-resistant Staphylococcus aureus clones containing the toxic shock syndrome toxin 1 gene responsible for hospital-and communityacquired infections in France. Journal of clinical microbiology; 44(3): 847853. El-baz, R.; Rizk, D.E.; Barwa, R. and Hassan, R. (2016): Virulence factors profile of Staphylococcus aureus isolated from different clinical sources. J. Microbiol; 43: Elasri, M.; Thomas, J.; Skinner, R.; Blevins, J.; Beenken, K.; Nelson, C. and Smelter, M. (2002): Staphylococcus aureus collagen adhesin contributes to the pathogenesis of osteomyelitis. Bone; 30(1): 275-280. Elbargisy, R.M.; Rizk, D.E. and Abdel-Rhman, S.H. (2016): Toxin gene profile and antibiotic resistance of Staphylococcus aureus isolated from clinical and food samples in Egypt. African Journal of Microbiology Research; 10(13): 428437. Elmakki, M.E.A.; Elemam, M.M.E.; Ahmed, O.B.A.B. and Omer, E.E. (2014): Molecular detection of Methicillin resistant Staphylococcus aureus in patients with urinary tract infections in Khartoum State. Journal of Science and Technology; 15(1):

28


Enany, S.; Yaoita, E.; Yoshida, Y.; Enany; M. and Yamamoto, T. (2010): Molecular characterization of Panton-Valentine leukocidin-positive communityacquired methicillin-resistant Staphylococcus aureus isolates in Egypt. Microbiological research; 165(2): 152-162. Fatholahzadeh, B.; Emaneini, M.; Gilbert, G.; Udo, E.; Aligholi, M.; Modarressi, M.H.; Nouri, K.; Sedaghat, H. and Feizabadi, M.M. (2008): Staphylococcal cassette chromosome mec (SCC mec) analysis and antimicrobial susceptibility patterns of methicillin-resistant Staphylococcus aureus (MRSA) isolates in Tehran, Iran. Microbial drug resistance; 14(3): 217-220. Ghasemian, A.; Najar-Peerayeh, S.; Bakhshi, B. and Mirzaee, M. (2015): High Prevalence of icaABCD Genes Responsible for biofilm formation in clinical isolates of Staphylococcus aureus from hospitalized children. Archives of Pediatric Infectious Diseases; 3(3): Gordon, R.J. and Lowy, F.D. (2008): Pathogenesis of methicillin-resistant Staphylococcus aureus infection. Clinical infectious diseases; 46(Supplement 5): S350-S359. Goudarzi, M.; Goudarzi, H.; Figueiredo, A.M.S.; Udo, E.E.; Fazeli, M.; Asadzadeh, M. and Seyedjavadi, S.S. (2016): Molecular characterization of methicillin resistant Staphylococcus aureus strains isolated from intensive care units in Iran: ST22-SCCmec IV/t790 emerges as the major clone. PLoS One; 11(5): e0155529. Gould, I.M.; David, M.Z.; Esposito, S.; Garau, J.; Lina, G.; Mazzei, T. and Peters, G. (2012): New insights into meticillin-resistant Staphylococcus aureus (MRSA) pathogenesis, treatment and resistance. International journal of antimicrobial agents; 39(2): 96-104. Hassan, R.; El-Naggar, W.; Habib, E. and El-Bargisy, R. (2012): Comparative studies on Staphylococcus aureus isolates associated with infections in diabetic and non-diabetic patients. Egypt. J. Med. Microbiol; 21(2): 71-78. Huang, H.; Flynn, N.M.; King, J.H.; Monchaud, C.; Morita, M. and Cohen, S.H. (2006): Comparisons of community-associated methicillin-resistant Staphylococcus aureus (MRSA) and hospital-associated MSRA infections in Sacramento, California. Journal of clinical microbiology; 44(7): 2423-2427. Kaur, D.C. and Chate, S.S. (2015): Study of antibiotic resistance pattern in methicillin resistant Staphylococcus aureus with special reference to newer antibiotic. Journal of global infectious diseases; 7(2): 78. Kondo, Y.; Ito, T.; Ma, X.X.; Watanabe, S.; Kreiswirth, B.N.; Etienne, J. and Hiramatsu, K. (2007): Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrobial Agents and Chemotherapy; 51(1): 264-274. Lim, K.T.; Hanifah, Y.A.; Yusof, M.Y.M.; Goering, R.V. and Thong, K.L. (2012): Temporal changes in the genotypes of methicillin-resistant Staphylococcus aureus strains isolated from a tertiary Malaysian hospital based on MLST,

29


spa, and mec-associated dru typing. Diagnostic microbiology and infectious disease; 74(2): 106-112. Liu, J.; Chen, D.; Peters, B.M.; Li, L.; Li, B.; Xu, Z. and Shirliff, M.E. (2016): Staphylococcal chromosomal cassettes mec (SCCmec): A mobile genetic element in methicillin-resistant Staphylococcus aureus. Microbial Pathogenesis; 101: 56-67. Mansour, F.A.; El-Zawahry, Y.A.; Abouelela, M.A. and Khashaba, M.M. (2009): Detection of mecA gene in methicillin-resistant Staphylococcus aureus strains responsible for wound infections and septicemia in Mansoura University Hospitals. The Egyptian journal of experimental biology (Botany); 5: 59-65. Marchese, A.; Gualco, L.; Maioli, E. and Debbia, E. (2009): Molecular analysis and susceptibility patterns of meticillin-resistant Staphylococcus aureus (MRSA) strains circulating in the community in the Ligurian area, a northern region of Italy: emergence of USA300 and EMRSA-15 clones. International journal of antimicrobial agents; 34(5): 424-428. Moghadam, S.O.; Pourmand, M.R. and Aminharati, F. (2014): Biofilm formation and antimicrobial resistance in methicillin-resistant Staphylococcus aureus isolated from burn patients, Iran. The Journal of Infection in Developing Countries; 8(12): 1511-1517. Monecke, S.; Skakni, L.; Hasan, R.; Ruppelt, A.; Ghazal, S.S.; Hakawi, A.; Slickers, P. and Ehricht, R. (2012): Characterisation of MRSA strains isolated from patients in a hospital in Riyadh, Kingdom of Saudi Arabia. BMC microbiology; 12(1): 146. Moraveji, Z.; Tabatabaei, M.; Aski, H.S. and Khoshbakht, R. (2014): Characterization of hemolysins of Staphylococcus strains isolated from human and bovine, southern Iran. Iranian journal of veterinary research; 15(4): 326. Nelson, M.U.; Bizzarro, M.J.; Baltimore, R.S.; Dembry, L.M. and Gallagher, P.G. (2015): Clinical and molecular epidemiology of methicillin-resistant Staphylococcus aureus in a neonatal intensive care unit in the decade following implementation of an active detection and isolation program. Journal of clinical microbiology; 53(8): 2492-2501. Otto, M. (2012): MRSA virulence and spread. Cellular microbiology; 14(10): 15131521. Pletz, M.W.; Burkhardt, O. and Welte, T. (2010): Nosocomial methicillin-resistant Staphylococcus aureus (MRSA) pneumonia: linezolid or vancomycin?Comparison of pharmacology and clinical efficacy. European journal of medical research; 15(12): 507. Rajaduraipandi, K.; Mani, K.; Panneerselvam, K.; Mani, M.; Bhaskar, M. and Manikandan, P. (2006): Prevalence and antimicrobial susceptibility pattern of methicillin resistant Staphylococcus aureus: A multicentre study. Indian journal of medical microbiology; 24(1): 34.

30


Raygada, J.L. and Levine, D.P. (2009): Managing CA-MRSA infections: current and emerging options. Infections in Medicine; 26(2): Rodrigues, M.V.P.; Fortaleza, C.M.C.B.; Riboli, D.F.M.; Rocha, R.S.; Rocha, C. and de Souza, M.d.L.R. (2013): Molecular epidemiology of methicillinresistant Staphylococcus aureus in a burn unit from Brazil. Burns; 39(6): 1242-1249. Sadaka, S.; El-Ghazzawy, E.; Harfoush, R. and Meheissen, M. (2009): Evaluation of different methods for the rapid diagnosis of methicillin-resistance in Staphylococcus aureus. African Journal of Microbiology Research; 3(2): 4955. Shorr, A.F.; Kunkel, M.J. and Kollef, M. (2005): Linezolid versus vancomycin for Staphylococcus aureus bacteraemia: pooled analysis of randomized studies. Journal of antimicrobial chemotherapy; 56(5): 923-929. Shukla, S.K.; Karow, M.E.; Brady, J.M.; Stemper, M.E.; Kislow, J.; Moore, N.; Wroblewski, K.; Chyou, P.-H.; Warshauer, D.M. and Reed, K.D. (2010): Virulence genes and genotypic associations in nasal carriage, communityassociated methicillin-susceptible and methicillin-resistant USA400 Staphylococcus aureus isolates. Journal of clinical microbiology; 48(10): 3582-3592. Vandepitte, J.; Verhaegen, J.; Engbaek, K.; Rohner, P.; Piot, P. and Hueck, C.C. (2003): Basic laboratory procedures in clinical bacteriology, 2nd edition. World Health Organization, Geneva. Ventola, C.L. (2015): The antibiotic resistance crisis: part 1: causes and threats. Pharmacy and Therapeutics; 40(4): 277. Vijayakumaran, V. (2013): Characterization of Staphylococcus aureus Lipase. Xu, Z.; Li, L.; Chu, J.; Peters, B.M.; Harris, M.L.; Li, B.; Shi, L. and Shirtliff, M.E. (2012): Development and application of loop-mediated isothermal amplification assays on rapid detection of various types of staphylococci strains. Food Research International; 47(2): 166-173. Yu, F.; Li, T.; Huang, X.; Xie, J.; Xu, Y.; Tu, J.; Qin, Z.; Parsons, C.; Wang, J. and Hu, L. (2012): Virulence gene profiling and molecular characterization of hospital-acquired Staphylococcus aureus isolates associated with bloodstream infection. Diagnostic microbiology and infectious disease; 74(4): 363-368. Zarfel, G.; Krziwanek, K.; Johler, S.; Hoenigl, M.; Leitner, E.; Kittinger, C.; Masoud, L.; Feierl, G. and Grisold, A. (2013): Virulence and antimicrobial resistance genes in human MRSA ST398 isolates in Austria. Epidemiology & Infection; 141(4): 888-892. Zhang, K.; Sparling, J.; Chow, B.L.; Elsayed, S.; Hussain, Z.; Church, D.L.; Gregson, D.B.; Louie, T. and Conly, J.M. (2004): New quadriplex PCR assay for detection of methicillin and mupirocin resistance and simultaneous discrimination of Staphylococcus aureus from coagulase-negative staphylococci. Journal of clinical microbiology; 42(11): 4947-4955.

‫‪N. Egypt. J. Microbiol. Vol. 48, September, 2017.‬‬

‫‪31‬‬

‫‪--------------------------------------------------------------------‬‬

‫السمات المميزة لعوامل ضراوة المكورات العنقودية الذهبية المعزولة من مصادر اكلينيكية‬ ‫مختلفة‬ ‫لمسادة الدكاترة‬ ‫دينا اشرف رمضان ‪ -‬محمد عادل السكرى ‪ -‬رشا بروه ‪ -‬رمضان حسن‬

‫مــــن‬ ‫قسم الميكروبيولجيا والمناعو ‪ -‬كمية الصيدلو ‪ -‬جامعة المنصورة – المنصورة ‪ -‬مصر‬ ‫تشير ىذه الدراسة إلى خصائص الضراوة من عزالت المكورات العنقودية الذىبية المقاومة لمميثيسيمين‬ ‫(مرسا) من مختمف مستشفيات المنصورة ‪ .‬قد تم التعرف عمي ‪ 88‬من عزالت المكورات العنقودية الذىبية‬ ‫المقاومة لمميثيسيمين (مرسا) من بين ‪ 120‬من عزالت المكورات العنقودية الذىبية عن طريق فحص الحساسيو‬ ‫ضد سيفوكسيتين و أوكساسيمين ‪ .‬واعتبرت الجروح المصدر األكثر انتشا ار لعزل عزالت المكورات العنقودية‬ ‫الذىبية المقاومة لمميثيسيمين (مرسا) في دراستنا ‪ .‬باإلضافة إلى ذلك‪ ،‬وجد أن أعمى معدل انتشار لعوامل‬ ‫الضراوة تم الكشف عنو في عزالت الجروح ‪ .‬أظور اختبار حساسية مضادات الميكروبات أن ‪ ٪78.4‬من‬ ‫عزالت المكورات العنقودية الذىبية المقاومة لمميثيسيمين (مرسا) كانت مقاومة لمسيفوتاكسيم و ‪ ٪54.5‬من‬ ‫عزالت المكورات العنقودية الذىبية المقاومة لمميثيسيمين (مرسا) كانت مقاومة لمجنتاميسين ‪ .‬وكانت المضادات‬ ‫الحيوية األنسب في الدراسة الحالية لعالج عزالت المكورات العنقودية الذىبية المقاومة لمميثيسيمين (مرسا) ىي‬ ‫فانكومايسين و لينزوليد حيث كانت نسبو مقاومتيم ‪ ٪0‬و ‪ ٪4.5‬فقط عمى التوالي‪ .‬تم الكشف عن عشر جينات‬ ‫لعوامل الضراوة بطريقو تفاعل البممرة المتسمسل و نسب تواجدىم‬

‫‪LukE, LukD, LukF, LukS, hla, geh, cna, icaA, icaD and tst 89.74%,‬‬

‫‪59.06%, 60.19%, 76.81%, 77.24%, 40.89%, 71.55%, 81.78% and 87.18%,‬‬ ‫‪ 4.55%‬عمى التوالي ‪.‬‬ ‫ومن بين جميع الجينات التي تم اختبارىا‪ ،‬أظيرت جينات (‪ )٪89.74‬و (‪ )٪4.55‬من الجينات أعمى‬ ‫وأدنى تردد‪ ،‬عمى التوالي ‪ .‬وتشير نتائج ىذه الدراسة إلى أن ‪ ٪92‬من عزالت مرسا تؤوي ثالثة أو أكثر من‬ ‫جينات عوامل الضراوة‪ ،‬وعينو واحده فقط كانت ال تحتوي عمي اي جين‪ .‬نتائجنا تشير إلى أن عدوى مرسا تبقى‬ ‫مشكمة كبيرة في مستشفيات المنصورة ولحل مشكمة عدوى مرسا بشكل فعال‪ ،‬ينبغي بذل المزيد من الجيود نحو‬ ‫مكافحة العدوى وقوة اإلدارة مع مزيد من الدراسات عن مرسا‪.‬‬