Conservation Genetics 3: 341–344, 2002. © 2002 Kluwer Academic Publishers. Printed in the Netherlands.
341
New DNA markers for penguins Amy D. Roeder, Peter A. Ritchie & David M. Lambert∗ Allan Wilson Centre for Molecular Ecology and Evolution, Institute of Molecular BioSciences, Massey University, Private Bag 11-222, Palmerston North, New Zealand (∗ Author for correspondence: E-mail:
[email protected]) Received 9 September 2001; accepted 24 January 2002
Key words: CA repeats, control region, microsatellite DNA, mitochondrial DNA
Penguins (Spheniscidae) represent a monophyletic group comprised of 17 species (Stonehouse 1975; Williams 1995). Found exclusively in the Southern Hemisphere, these flightless diving birds occupy a wide range of habitats from Antarctica to the Galápagos Islands (Williams 1995). Currently, ten species are listed on IUCN’s Red List (BirdLife International 2000) as either ‘endangered’ or ‘vulnerable’. Genetic markers would be useful for resolving issues relevant to the conservation of this group. The entire Adélie penguin mitochondrial (mt) DNA control region has been reported (Ritchie and Lambert 2000) but to date, no general spheniscid PCR-primers that target this useful hypervariable sequence exist. Here we report four novel polymerase chain reaction (PCR) primers designed for the mtDNA control region that amplify across a broad range of penguin species. In addition, we show cross-amplification of nuclear microsatellite loci isolated from Adélie penguins in other penguin species.
Mitochondrial DNA PCR primers were designed to amplify the hypervariable 5 end of the control region (hypervariable region I, HVRI) using conserved sequences in the flanking tRNAGlu and central conserved domain. First, primers to the nad6 Light (L)-strand (5 -ACTAAACCAATTACCCCATAATA, Ritchie and Lambert 2000) and the tRNAGlu Heavy (H)-strand (5 GTTCCTGTGGTTGAAGTAACA) designed from Adélie penguins, were used to amplify a 173-bp portion of nad6 and the tRNAGlu in 15 penguin species. King and emperor penguins did not amplify
with these primers. All PCRs contained 0.4 µm of each primer, 200 µm of each dNTP, 1.5 mM MgCl2 , 10 mM Tris-HCl pH 8.3, 50 mM KCl, and one unit of AmpliTaq DNA polymerase (Applied Biosystems). Thermal cycling conditions were 94 ◦ C 10s, 50 ◦ C 10s, and 72 ◦ C 25s for 30 cycles. PCR products were purified using High Pure PCR Product Purification columns (Roche), sequenced using the ABI PRISM BigDyeTM Terminator Cycle Sequencing Kit (Applied Biosystems) and analyzed on an ABI 377 automated sequencer. The resulting DNA sequences were aligned and conserved regions were used to design two penguin-specific PCR primers for tRNAGlu (Table 1). Second, a primer (5 -ATGCCGCGATCACGGACGAAAATGG) was designed to the H-strand of the central conserved domain of the Adélie penguin control region sequence (GenBank Acc. No. AF272143), and used in conjunction with each of the new tRNAGlu primers. Approximately 900 bp of the HVRI was amplified and sequenced (as above) from 15 penguin species (excluding emperor and king penguins). These sequences were aligned and two new primers, spanning a shorter region, were designed to the conserved D box (Table 1) which lies on the 5 end of the central domain. A 600–700 bp fragment of the HVRI could then be amplified from most penguin species with one of two combinations (primers A/B or C/D) from these four new primers (Table 1). The sizes of the HVRI for each species (except emperor and king penguins) are presented in Table 1. The majority of these fragments were approximately 660 bp long, although in Adélie and gentoo penguins the PCR fragments were 767 and 763 bp respectively. These two species differed from the others by a
342 Table 1. Details of mtDNA control region primers designed for penguins. The sample sizes(n), primer combinations, sizes of amplified fragments, and the presence/absence of suspected heteroplasmy are shown. Primer sequences: A (L-tRNAGlu , 5 -CCCGCTTGGCTTYTCTCCAAGGTC), B (H-Dbox, 5 -CTGACATAGGAACCAGAGGCGC), C (L-tRNAGlu , 5 -CCTGCTTGGCTTTTYTCCAAGACC), D (H-Dbox, 5 -CTGACCGAGGAACCAGAGGCGC) Penguin species
Scientific name
n
PCR Primer combinations
Size (bp)
Presumptive heteroplasmy
Ad´elie Chinstrap Gentoo Macaroni Royal Fiordland crested Snares crested Erect-crested Rockhopper Yellow-eyed Little/Fairy African Magellanic Humboldt Gal´apagos King Emperor
Pygoscelis adeliae P. antarctica P. papua Eudyptes chrysolophus E. schlegeli E. pachyrhynchus E. robustus E. sclateri E. chrysocome Megadyptes antipodes Eudyptula minor Spheniscus demersus S. magellanicus S. humboldti S. mendiculus Aptenodytes patagonicus A. forsteri
290∗∗ 3 1 1 4 6 1 5 4 3 1 1 1 6 1 1 5
A/B A/B A/B C/D C/D C/D C/D C/D C/D C/D C/D C/D C/D C/D C/D — —
767 662 763 658 659 662 662 660 663 670 655 653 654 657 655 — —
No Yes No No∗ No∗ Yes Yes Yes Yes Yes Yes No Yes Yes Yes — —
∗ There were 4–5 double peaks in these electropherograms. ∗∗ From Ritchie (2001).
∼100 bp insertion near the central conserved domain. DNA sequence alignment was partially confounded by the presence of small indels across all species. When all species are compared using unambiguous sites, sequence differences ranged from 3.8–37.8%. Ten of the species sequenced showed presumptive mitochondrial heteroplasmy (Table 1). In these species, sequencing with the L-strand primer resulted in two sequences appearing in electropherograms directly after a poly-C stretch. This interrupted polyC stretch is at positions 34–55 in the Adélie penguin control region sequence deposited in GenBank and is thought to be involved in the termination of the displacement loop (D-loop) during replication (Ritchie and Lambert 2000). Direct sequencing of the HVRI amplified using long-PCR templates from Fiordland crested penguins shows the same double sequence pattern (Ritchie 2001). This result reinforces the suggestion of heteroplasmy and excludes the possibility of preferential amplification of a nuclear mitochondrial segment. With the exception of the poly-C region, sequencing with the H-strand primer resulted in unambiguous electropherograms. The sequence directly after the poly-C region shows vari-
ation both within and between species (Ritchie 2001) making this location unsuitable for designing a general spheniscid primer. Hence, we suggest that mitochondrial DNA studies of penguins could circumvent the problem of heteroplasmy by sequencing amplicons with the H-strand primer.
Microsatellite DNA Seven nuclear microsatellite loci were tested for amplification in 17 penguin species (Table 2): FhU2 (FhU2 5 -GTGTTCTTAAAACATGCCTGGAGG, 5 GCACAGGTAAATATTTGCTGGGCC) was isolated from pied flycatcher, Ficedula hypoleuca, (Ellegren 1992; Primmer et al. 1996) and the remaining six loci (TP500 5 -GGGACACAGGCAGCCACG, 5 -GGGAGTGGTATGGCTGGGTT; RM6 5 -CAG GAGGCTTTGAGACAAGA, 5 -CTGTTTACATCC GATGCAGG; RM3 5 -AATCAGGCTCCAAGGT CAGT, 5 -ATGCAAGTGACACAAAGGCT; AM12 5 -AAAAACCCAACACAACAAAC, 5 -CCCAAGA AGAGATTTGTGAG; AM13 5 -TTTTCCCATCTC TCTCCTG, 5 -CAGTTTTCAACAATCCTTCC;
343 Table 2. Details of cross-species amplification of microsatellite DNA loci. M – monomorphic, P – polymorphic with number of alleles in parenthesis, NA – no amplification Penguin species
number sampled
FhU2
RM3
RM6
TP500
AM3
AM12
AM13
Ad´elie Chinstrap Gentoo Little/Fairy African Magellanic Gal´apagos Humboldt Royal Macaroni Erect-crested Snares crested Fiordland crested Rockhopper Yellow-eyed King Emperor
>175 5 3 3 1 1 1 6 6 1 6 1 6 5 6 1 6
P(2)∗ M∗∗ P(2) M M M M M∗∗ P(2) M M M M M P(2) M M
P(6) P(3)∗∗ P(4) M M M M M∗∗ M M M M M M M M M
P(6) M∗∗ M∗∗ P(3) M M M M∗∗ M∗∗ NA M M P(2) M P(2) NA M∗∗
P(19) P(5) M P(2) P(2) P(2) P(2) M P(4) M P(4) P(2) P(6) P(5) P(4) M P(2)
P(4) P(4) M M M M M P(2) P(2) M M M M M M M M
P(8) P(2) P(3) P(2) M M M M M M M M M P(2) M M P(3)
P(20) P(4) P(3) P(2) M M M M∗∗ P(3) P(2) P(6) M P(5) P(6) P(3) P(2) P(4)
∗ only one individual was sampled at this locus. ∗∗ some samples did not amplify.
AM3 5 -AGGAAAGAAGTAACTGAAGCAG, 5 -CA TCTTCCCACAGAAGAAAC) were isolated from Adélie penguin genomic libraries (Roeder et al. 2001). Microsatellite loci were amplified using a Hybaid OmniGene thermocycler. PCRs contained 25–100 ng of DNA, 0.3 units of Taq DNA Polymerase (Boehringer Mannheim), 200 µM of each dNTP, 8 µM of each primer with 0.3 µM of the reverse primer labeled with [γ 33 ] ATP, 1.5 mM MgCl2 , 10 mM Tris-HCl pH 8.3, and 50 mM KCl in a final volume of 10 µL. Thermal cycling conditions were 94 ◦ C for 4 min followed by 30 cycles of 94 ◦ C 45s, 52–56 ◦ C or 62 ◦ C (TP500) 50–60s, and 72 ◦ C 60s. Following amplification 4 µL of formamide loading buffer was added to each sample. Samples were denatured at 94 ◦ C for 5 min. prior to running 4 µL on 6% acrylamide/6 M urea gels. After electrophoresis, the gels were dried and then exposed to Kodak BioMax film. Alleles were identified based on size compared to M13 ladders. The seven microsatellite markers amplified across all penguins with the exception of the RM6 locus in Macaroni and king penguins (Table 2). However, based on our limited sample number, not all loci are useful for every species owing to monomorphism or inconsistent amplification. Species in the Pygoscelis
genus (Adélie, gentoo, and chinstrap) were the most polymorphic across all loci. Overall, the AM13 and TP500 loci were the most variable (polymorphic in all species where n > 1 with the exceptions of TP500 in gentoo penguins (n = 3) and AM13 in Humboldt penguins (n = 3)). The RM6 PCR primers amplified a 162–164 bp fragment in all species. However, a larger microsatellite fragment (>168 bp) present in Adélie penguins did not amplify in some species and amplified inconsistently in others (Table 2). Many conservation studies are limited by the availability of genetic markers that work consistently and reliably across the species of interest. Very few genetic markers are available for penguins. The markers presented here provide tools for examining conservation genetics issues of this avian group.
Acknowledgements This research is funded by a grant to D.M.L. from the Marsden Fund of New Zealand (96-MAU-ALS0030). A.D.R. is supported by a Massey University post-doctoral fellowship and P.A.R. acknowledges a Massey University doctoral scholarship. We are grateful to the following people who kindly assisted
344 us by providing samples: G. Elliot, K. Walker and P. Moore (Department of Conservation, New Zealand); B. Culik (Institut für Meereskunde an der Universität Kiel, Germany); K.-A. Edge (Otago University), A. Baker (Royal Ontario Museum), C. Hull (University of Tasmania), C. Bradshaw (Otago University), J. González, G. Kooyman (Scripps Institution of Oceanography), J. Darby (Otago Museum), I. Mclean (Otago Museum). We also thank Drs. J. Hay, L. Huynen, and S. Sarre for comments on the manuscript. Publication No. 3 from the Allan Wilson Centre for Molecular Ecology and Evolution.
References BirdLife International (2000) Threatened Birds of the World, Lynx Edicions and BirdLife International, Barcelona, Spain and Cambridge, UK.
Ellegren H (1992) Polymerase-chain-reaction (PCR) analysis of microsatellites – a new approach to studies of genetic relationships in birds. The Auk, 109, 886–895. Primmer CR, Moller AP, Ellegren H (1996) A wide-range survey of cross-species microsatellite amplification in birds. Mol. Ecol., 5, 365–378. Ritchie PA (2001) The Evolution of the Mitochondrial DNA Control Region in the Adélie Penguins of Antarctica. PhD thesis, Massey University, New Zealand. Ritchie PA, Lambert DM (2000) A repeat complex in the mitochondrial control region of Adélie penguins from Antarctica. Genome, 43, 613–618. Roeder AD, Marshall RK, Mitchelson AJ, et al. (2001) Gene flow on the ice: Genetic differentiation among Adélie penguin colonies around Antarctica. Mol. Ecol., 10, 1645–1656. Stonehouse B (1975) Introduction: the Spheniscidae. In: The Biology of Penguins (eds. Stonehouse B), pp. 1–15. Macmillan Press, London and Basingstoke. Williams TD (1995) The Penguins: Spheniscidae, Oxford University Press, Oxford.
