Supplementary Info
New molecular tools in Neospora caninum for studying apicomplexan parasite proteins
Caroline M. Motaa, Allan L. Chenb, Kevin Wangb, Santhosh Nadipuram b, Ajay A. Vashishtc, James A. Wohlschlegelc, Tiago W.P. Mineoa* and Peter J. Bradleyb,d* Peter Bradley:
[email protected], +1 310 825-8386 Tiago Mineo:
[email protected], +55 34 3225-8666
Table S1. Oligonucleotide Primers used in this study as discussed in text. Name
Primer Sequence
P1
CTACACAGTCATGGAACGTCG
P2
TAGACACAAGTGCGACTCTCG
P3
ATG CAT AAA GGA GAA GAA CTT TTC AC
P4
TTA ATT AAT TAT TTG TAT AGT TCA TCC AT
P5
ATG CAT GTG AGC AAG GGC GAG GAG GA
P6
TTA ATT AAC TAC TTG TAC AGC TCG TCC AT
P7
ATG CAT GTG ACA ACA ACC ACG CCA AC
P8
GCG GCC GCT GGA GTT ACC GCT GAT TGT GT
P9
ATG CAT ATG AAA GTG ACC ACG AAA GGG
P10
GCG GCC GCC ATC CGA TGT GAA GAA AGT TCG GTA GT
Table S2 - Comparative MS/MS hits obtained by NcLivΔhpt and NcLiv_GRA15_BioID (TGME49_275470). Rank 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54
Description Myosin-9 OS=Homo sapiens GN=MYH9 PE=1 SV=4 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 Keratin, type II cytoskeletal 1 OS=Homo sapiens GN=KRT1 PE=1... Keratin, type I cytoskeletal 9 OS=Homo sapiens GN=KRT9 PE=1 ... Elongation factor 1-alpha 1 OS=Homo sapiens GN=EEF1A1 PE=1 S... Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 Tubulin alpha-1C chain OS=Homo sapiens GN=TUBA1C PE=1 SV=1 Tubulin beta chain OS=Homo sapiens GN=TUBB PE=1 SV=2 Tubulin alpha-1A chain OS=Homo sapiens GN=TUBA1A PE=1 SV=1 Keratin, type I cytoskeletal 10 OS=Homo sapiens GN=KRT10 PE=... Tubulin alpha-4A chain OS=Homo sapiens GN=TUBA4A PE=1 SV=1 Myosin-10 OS=Homo sapiens GN=MYH10 PE=1 SV=3 Methylcrotonoyl-CoA carboxylase subunit alpha, mitochondrial... Actin, alpha cardiac muscle 1 OS=Homo sapiens GN=ACTC1 PE=1 ... Tubulin alpha-8 chain OS=Homo sapiens GN=TUBA8 PE=1 SV=1 Tubulin beta-2C chain OS=Homo sapiens GN=TUBB2C PE=1 SV=1 Histone H4 OS=Homo sapiens GN=HIST1H4A PE=1 SV=2 Tubulin beta-4 chain OS=Homo sapiens GN=TUBB4 PE=1 SV=2 Myosin-Ic OS=Homo sapiens GN=MYO1C PE=1 SV=3 Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 Keratin, type I cytoskeletal 14 OS=Homo sapiens GN=KRT14 PE=... Tubulin beta-2A chain OS=Homo sapiens GN=TUBB2A PE=1 SV=1 Keratin, type II cytoskeletal 2 epidermal OS=Homo sapiens GN... Actin, aortic smooth muscle OS=Homo sapiens GN=ACTA2 PE=1 SV... Ubiquitin OS=Homo sapiens GN=RPS27A PE=1 SV=1 Keratin, type II cytoskeletal 6B OS=Homo sapiens GN=KRT6B PE... Pyruvate carboxylase, mitochondrial OS=Homo sapiens GN=PC PE... Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=... Actin, alpha skeletal muscle OS=Homo sapiens GN=ACTA1 PE=1 S... Myosin-Id OS=Homo sapiens GN=MYO1D PE=1 SV=2 Propionyl-CoA carboxylase alpha chain, mitochondrial OS=Homo... 60S ribosomal protein L18 OS=Homo sapiens GN=RPL18 PE=1 SV=2... 40S ribosomal protein S8 OS=Homo sapiens GN=RPS8 PE=1 SV=2 Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM2 PE=1 ... Tubulin beta-6 chain OS=Homo sapiens GN=TUBB6 PE=1 SV=1 60S ribosomal protein L4 OS=Homo sapiens GN=RPL4 PE=1 SV=5 60S ribosomal protein L18a OS=Homo sapiens GN=RPL18A PE=1 SV... Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 60S ribosomal protein L3 OS=Homo sapiens GN=RPL3 PE=1 SV=2 60S ribosomal protein L28 OS=Homo sapiens GN=RPL28 PE=1 SV=3... 60S ribosomal protein L7 OS=Homo sapiens GN=RPL7 PE=1 SV=1 Annexin A2 OS=Homo sapiens GN=ANXA2 PE=1 SV=2 Keratin, type II cytoskeletal 6A OS=Homo sapiens GN=KRT6A PE... Keratin, type II cytoskeletal 6C OS=Homo sapiens GN=KRT6C PE... 60S ribosomal protein L6 OS=Homo sapiens GN=RPL6 PE=1 SV=3 Tropomyosin alpha-4 chain OS=Homo sapiens GN=TPM4 PE=1 SV=3 Keratin, type II cytoskeletal 5 OS=Homo sapiens GN=KRT5 PE=1... Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2... 60S ribosomal protein L36a-like OS=Homo sapiens GN=RPL36AL P... Actin-related protein 2/3 complex subunit 2 OS=Homo sapiens ... Profilin-1 OS=Homo sapiens GN=PFN1 PE=1 SV=2 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 60S ribosomal protein L36a OS=Homo sapiens GN=RPL36A PE=1 SV... 60S ribosomal protein L15 OS=Homo sapiens GN=RPL15 PE=1 SV=2...
NcLivΔhpt 1458,561 1726,589 1422,929 1658,304 1424,427 972,779 945,593 916,398 957,089 993,574 908,216 556,856 1439,638 497,398 772,234 644,012 515,256 613,588 482,619 523,881 644,653 540,652 609,061 422,319 465,539 671,234 949,098 528,074 0 383,352 910,946 414,032 442,262 446,426 428,379 314,865 301,542 440,296 324,837 309,906 413,729 386,164 457,945 451,671 270,271 256,797 425,771 421,759 433,917 235,873 353,809 471,746 400,539 346,872
NcLiv_GRA15_BioID 3814,362 2464,049 1743,118 1391,243 1429,781 1015,945 994,958 1014,762 973,614 908,798 826,721 1130,405 73,732 1002,673 671,809 772,232 778,48 679,375 786,64 639,108 517,73 609,205 537,783 698,832 653,123 419,738 139,376 501,503 992,545 588,3 54,314 548,367 495,639 488,967 470,861 581,234 585,756 441,221 549,526 557,41 446,49 473,059 379,118 379,118 543,571 554,263 375,354 379,297 324,192 509,101 381,826 254,551 324,192 374,339
55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111
60S ribosomal protein L17 OS=Homo sapiens GN=RPL17 PE=1 SV=3... Annexin A5 OS=Homo sapiens GN=ANXA5 PE=1 SV=2 Cofilin-1 OS=Homo sapiens GN=CFL1 PE=1 SV=3 40S ribosomal protein S16 OS=Homo sapiens GN=RPS16 PE=1 SV=2... Keratin, type I cytoskeletal 16 OS=Homo sapiens GN=KRT16 PE=... 40S ribosomal protein S24 OS=Homo sapiens GN=RPS24 PE=1 SV=1... 40S ribosomal protein S3 OS=Homo sapiens GN=RPS3 PE=1 SV=2 60S ribosomal protein L10 OS=Homo sapiens GN=RPL10 PE=1 SV=4... 60S ribosomal protein L35 OS=Homo sapiens GN=RPL35 PE=1 SV=2... Protein S100-A4 OS=Homo sapiens GN=S100A4 PE=1 SV=1 60S ribosomal protein L23a OS=Homo sapiens GN=RPL23A PE=1 SV... 60S ribosomal protein L13a OS=Homo sapiens GN=RPL13A PE=1 SV... 40S ribosomal protein S6 OS=Homo sapiens GN=RPS6 PE=1 SV=1 Alpha-enolase OS=Homo sapiens GN=ENO1 PE=1 SV=2 40S ribosomal protein S4, X isoform OS=Homo sapiens GN=RPS4X... Ras-related protein Rap-1b OS=Homo sapiens GN=RAP1B PE=1 SV=... 60S ribosomal protein L38 OS=Homo sapiens GN=RPL38 PE=1 SV=2... 60S ribosomal protein L13 OS=Homo sapiens GN=RPL13 PE=1 SV=4...
346,118 364,866 362,335 315,036 403,926 319,226 364,001 247,997 201,355 280,245 272,161 226,577 213,138 285,33 282,509 326,889 353,809 184,45
373,525 346,03 345,023 392,287 290,607 373,213 314,26 428,216 465,641 378,045 367,14 394,992 398,694 325,52 319,398 249,017 218,186 380,016
Peroxiredoxin-1 OS=Homo sapiens GN=PRDX1 PE=1 SV=1 40S ribosomal protein S14 OS=Homo sapiens GN=RPS14 PE=1 SV=3... Heat shock protein beta-1 OS=Homo sapiens GN=HSPB1 PE=1 SV=2... 60S ribosomal protein L7a OS=Homo sapiens GN=RPL7A PE=1 SV=2... 60S ribosomal protein L9 OS=Homo sapiens GN=RPL9 PE=1 SV=1 40S ribosomal protein S26 OS=Homo sapiens GN=RPS26 PE=1 SV=3... 60S ribosomal protein L27 OS=Homo sapiens GN=RPL27 PE=1 SV=2... Peptidyl-prolyl cis-trans isomerase A OS=Homo sapiens GN=PPI... Cofilin-2 OS=Homo sapiens GN=CFL2 PE=1 SV=1 40S ribosomal protein S3a OS=Homo sapiens GN=RPS3A PE=1 SV=2... Elongation factor 2 OS=Homo sapiens GN=EEF2 PE=1 SV=4 60S ribosomal protein L5 OS=Homo sapiens GN=RPL5 PE=1 SV=3 NADH-cytochrome b5 reductase 3 OS=Homo sapiens GN=CYB5R3 PE=... 40S ribosomal protein S9 OS=Homo sapiens GN=RPS9 PE=1 SV=3 60S ribosomal protein L23 OS=Homo sapiens GN=RPL23 PE=1 SV=1... 60S ribosomal protein L27a OS=Homo sapiens GN=RPL27A PE=1 SV... 40S ribosomal protein S23 OS=Homo sapiens GN=RPS23 PE=1 SV=3... 40S ribosomal protein S11 OS=Homo sapiens GN=RPS11 PE=1 SV=3... 40S ribosomal protein S28 OS=Homo sapiens GN=RPS28 PE=1 SV=1... 40S ribosomal protein S15a OS=Homo sapiens GN=RPS15A PE=1 SV... Myosin-Ib OS=Homo sapiens GN=MYO1B PE=1 SV=3 Actin-related protein 2 OS=Homo sapiens GN=ACTR2 PE=1 SV=1 Aldo-keto reductase family 1 member C1 OS=Homo sapiens GN=AK... Vesicle-trafficking protein SEC22b OS=Homo sapiens GN=SEC22B... Actin-related protein 2/3 complex subunit 4 OS=Homo sapiens ... Ras-related protein Rab-1B OS=Homo sapiens GN=RAB1B PE=1 SV=... Tropomyosin alpha-3 chain OS=Homo sapiens GN=TPM3 PE=1 SV=1 Phosphoglycerate mutase 1 OS=Homo sapiens GN=PGAM1 PE=1 SV=2... 60S ribosomal protein L24 OS=Homo sapiens GN=RPL24 PE=1 SV=1... 60S ribosomal protein L32 OS=Homo sapiens GN=RPL32 PE=1 SV=2... ADP-ribosylation factor 1 OS=Homo sapiens GN=ARF1 PE=1 SV=2 ... Beta-actin-like protein 2 OS=Homo sapiens GN=ACTBL2 PE=1 SV=... 60S ribosomal protein L35a OS=Homo sapiens GN=RPL35A PE=1 SV... 14-3-3 protein zeta/delta OS=Homo sapiens GN=YWHAZ PE=1 SV=1... Heterogeneous nuclear ribonucleoprotein K OS=Homo sapiens GN... Heat shock protein HSP 90-beta OS=Homo sapiens GN=HSP90AB1 P... Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 60S ribosomal protein L8 OS=Homo sapiens GN=RPL8 PE=1 SV=2 Ferritin heavy chain OS=Homo sapiens GN=FTH1 PE=1 SV=2
213,352 328,035 276,144 239,42 294,841 215,362 234,139 235,873 255,766 241,234 243,295 202,517 293,862 218,851 176,905 191,248 197,935 246,323 205,107 244,945 180,642 206,538 230,031 213,931 189,541 193,627 186,871 208,942 202,821 157,249 312,76 150,557 289,48 187,736 175,758 180,814 164,407 137,669 154,671
345,37 227,578 279,385 315,796 258,528 332,022 308,83 300,832 276,019 289,262 284,812 321,402 228,334 295,226 327,279 309,589 293,712 241,662 276,685 234,97 292,419 261,657 236,425 248,631 272,733 265,948 268,891 240,52 243,201 282,834 126,572 284,338 138,846 233,771 239,157 226,775 240,895 267,427 250,378
112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129
Actin-related protein 3 OS=Homo sapiens GN=ACTR3 PE=1 SV=3 Annexin A1 OS=Homo sapiens GN=ANXA1 PE=1 SV=2 Actin-related protein 2/3 complex subunit 3 OS=Homo sapiens ... Ras-related protein Rab-7a OS=Homo sapiens GN=RAB7A PE=1 SV=... Annexin A6 OS=Homo sapiens GN=ANXA6 PE=1 SV=3 GTP-binding protein SAR1a OS=Homo sapiens GN=SAR1A PE=1 SV=1... 40S ribosomal protein S4, Y isoform 1 OS=Homo sapiens GN=RPS... Barrier-to-autointegration factor OS=Homo sapiens GN=BANF1 P... Sequestosome-1 OS=Homo sapiens GN=SQSTM1 PE=1 SV=1 60S ribosomal protein L21 OS=Homo sapiens GN=RPL21 PE=1 SV=2... Ras-related protein Rab-1A OS=Homo sapiens GN=RAB1A PE=1 SV=... 14-3-3 protein beta/alpha OS=Homo sapiens GN=YWHAB PE=1 SV=3... Heat shock cognate 71 kDa protein OS=Homo sapiens GN=HSPA8 P... Keratin, type II cytoskeletal 75 OS=Homo sapiens GN=KRT75 PE... 40S ribosomal protein S2 OS=Homo sapiens GN=RPS2 PE=1 SV=2 60S ribosomal protein L34 OS=Homo sapiens GN=RPL34 PE=1 SV=3... Thioredoxin OS=Homo sapiens GN=TXN PE=1 SV=3 Transforming protein RhoA OS=Homo sapiens GN=RHOA PE=1 SV=1
143,894 173,837 218,646 222,199 184,002 285,907 161,434 119,262 144,74 199,018 138,072 158,207 147,877 173,373 169,056 120,96 202,177 146,657
255,768 220,709 171,607 166,011 198,572 96,421 217,771 257,411 225,624 167,049 223,508 201,778 206,872 180,172 182,442 228,443 145,457 197,837
130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168
60S ribosomal protein L14 OS=Homo sapiens GN=RPL14 PE=1 SV=4... Ras-related protein Rab-5C OS=Homo sapiens GN=RAB5C PE=1 SV=... 60S ribosomal protein L26 OS=Homo sapiens GN=RPL26 PE=1 SV=1... Protein disulfide-isomerase A3 OS=Homo sapiens GN=PDIA3 PE=1... Myosin-Va OS=Homo sapiens GN=MYO5A PE=1 SV=1 Tropomyosin beta chain OS=Homo sapiens GN=TPM2 PE=1 SV=1 Peroxiredoxin-6 OS=Homo sapiens GN=PRDX6 PE=1 SV=3 60S ribosomal protein L22 OS=Homo sapiens GN=RPL22 PE=1 SV=2... 40S ribosomal protein S18 OS=Homo sapiens GN=RPS18 PE=1 SV=3... 40S ribosomal protein S13 OS=Homo sapiens GN=RPS13 PE=1 SV=2... Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=2 LIM and SH3 domain protein 1 OS=Homo sapiens GN=LASP1 PE=1 S... 40S ribosomal protein S27 OS=Homo sapiens GN=RPS27 PE=1 SV=3... Peroxiredoxin-2 OS=Homo sapiens GN=PRDX2 PE=1 SV=5 EH domain-containing protein 2 OS=Homo sapiens GN=EHD2 PE=1 ... Fascin OS=Homo sapiens GN=FSCN1 PE=1 SV=3 Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 Myosin-11 OS=Homo sapiens GN=MYH11 PE=1 SV=3 Ras-related protein Rab-14 OS=Homo sapiens GN=RAB14 PE=1 SV=... Actin-related protein 2/3 complex subunit 1B OS=Homo sapiens... 40S ribosomal protein SA OS=Homo sapiens GN=RPSA PE=1 SV=4 Tropomodulin-1 OS=Homo sapiens GN=TMOD1 PE=1 SV=1 Eukaryotic translation initiation factor 5A-2 OS=Homo sapien... Myosin regulatory light chain 12B OS=Homo sapiens GN=MYL12B ... Protein S100-A11 OS=Homo sapiens GN=S100A11 PE=1 SV=2 Eukaryotic initiation factor 4A-I OS=Homo sapiens GN=EIF4A1 ... Ras-related protein Rab-2A OS=Homo sapiens GN=RAB2A PE=1 SV=... Long-chain-fatty-acid--CoA ligase 4 OS=Homo sapiens GN=ACSL4... Calcium/calmodulin-dependent protein kinase type II subunit ... Aldo-keto reductase family 1 member C3 OS=Homo sapiens GN=AK... Keratin, type II cytoskeletal 3 OS=Homo sapiens GN=KRT3 PE=1... Gelsolin OS=Homo sapiens GN=GSN PE=1 SV=1 Ras-related protein R-Ras OS=Homo sapiens GN=RRAS PE=1 SV=1 14-3-3 protein theta OS=Homo sapiens GN=YWHAQ PE=1 SV=1 Inosine-5'-monophosphate dehydrogenase 2 OS=Homo sapiens GN=... 60S ribosomal protein L19 OS=Homo sapiens GN=RPL19 PE=1 SV=1... Cystatin-B OS=Homo sapiens GN=CSTB PE=1 SV=2 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 Peroxiredoxin-5, mitochondrial OS=Homo sapiens GN=PRDX5 PE=1...
148,106 147,421 97,603 175,153 127,791 124,581 189,541 110,565 139,662 187,449 142,092 162,671 126,36 125,084 143,348 157,887 146,759 120,209 148,106 95,11 119,935 147,831 207,041 103,151 134,784 148,147 116,824 124,406 106,356 120,492 146,249 135,732 129,838 144,412 123,902 108,309 108,309 133,075 132,265
195,353 194,448 236,995 158,779 199,661 201,669 136,366 208,811 175,841 126,432 168,678 146,293 181,822 173,557 154,699 139,409 149,82 172,325 142,075 195,019 168,262 138,266 74,478 178,111 145,457 131,664 162,096 150,367 168,34 153,676 127,478 136,715 140,12 124,678 141,142 155,847 155,847 129,935 124,896
169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186
Plasminogen activator inhibitor 2 OS=Homo sapiens GN=SERPINB... Kinesin-1 heavy chain OS=Homo sapiens GN=KIF5B PE=1 SV=1 Ankycorbin OS=Homo sapiens GN=RAI14 PE=1 SV=2 Transgelin-2 OS=Homo sapiens GN=TAGLN2 PE=1 SV=3 Heat shock protein HSP 90-alpha OS=Homo sapiens GN=HSP90AA1 ... GTP-binding nuclear protein Ran OS=Homo sapiens GN=RAN PE=1 ... Protein S100-A6 OS=Homo sapiens GN=S100A6 PE=1 SV=1 6-phosphofructokinase type C OS=Homo sapiens GN=PFKP PE=1 SV... Hornerin OS=Homo sapiens GN=HRNR PE=1 SV=2 Plectin-1 OS=Homo sapiens GN=PLEC1 PE=1 SV=3 Alpha-actinin-4 OS=Homo sapiens GN=ACTN4 PE=1 SV=2 Keratin, type II cytoskeletal 79 OS=Homo sapiens GN=KRT79 PE... ATP-dependent RNA helicase DDX3X OS=Homo sapiens GN=DDX3X PE... Phosphoglycerate kinase 1 OS=Homo sapiens GN=PGK1 PE=1 SV=3 Probable ATP-dependent RNA helicase DDX5 OS=Homo sapiens GN=... Tropomodulin-3 OS=Homo sapiens GN=TMOD3 PE=1 SV=1 Serpin H1 OS=Homo sapiens GN=SERPINH1 PE=1 SV=2 Myosin-VI OS=Homo sapiens GN=MYO6 PE=1 SV=4
127,883 113,895 111,919 160,014 135,337 131,04 0 112,822 131,592 108,771 108,745 138,878 101,546 93,331 115,247 130,668 110,036 92,964
128,809 142,739 144,159 95,936 119,973 123,74 254,551 141,237 121,916 144,285 138,312 107,054 144,194 146,504 124,373 108,473 127,884 144,586
187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225
Acetyl-CoA carboxylase 1 OS=Homo sapiens GN=ACACA PE=1 SV=2 ADP-ribosylation factor 4 OS=Homo sapiens GN=ARF4 PE=1 SV=3 60S ribosomal protein L31 OS=Homo sapiens GN=RPL31 PE=1 SV=1... Heat shock-related 70 kDa protein 2 OS=Homo sapiens GN=HSPA2... Heat shock protein beta-6 OS=Homo sapiens GN=HSPB6 PE=1 SV=2... Rho-related GTP-binding protein RhoG OS=Homo sapiens GN=RHOG... 40S ribosomal protein S7 OS=Homo sapiens GN=RPS7 PE=1 SV=1 Cytoskeleton-associated protein 4 OS=Homo sapiens GN=CKAP4 P... T-complex protein 1 subunit beta OS=Homo sapiens GN=CCT2 PE=... Rho-related GTP-binding protein RhoC OS=Homo sapiens GN=RHOC... Dermcidin OS=Homo sapiens GN=DCD PE=1 SV=2 Heterogeneous nuclear ribonucleoprotein A3 OS=Homo sapiens G... Staphylococcal nuclease domain-containing protein 1 OS=Homo ... 14-3-3 protein gamma OS=Homo sapiens GN=YWHAG PE=1 SV=2 2',3'-cyclic-nucleotide 3'-phosphodiesterase OS=Homo sapiens... Destrin OS=Homo sapiens GN=DSTN PE=1 SV=3 Glycyl-tRNA synthetase OS=Homo sapiens GN=GARS PE=1 SV=2 Elongation factor Tu, mitochondrial OS=Homo sapiens GN=TUFM ... 40S ribosomal protein S17 OS=Homo sapiens GN=RPS17 PE=1 SV=2... 40S ribosomal protein S5 OS=Homo sapiens GN=RPS5 PE=1 SV=4 ADP/ATP translocase 3 OS=Homo sapiens GN=SLC25A6 PE=1 SV=4 Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=3 Chloride intracellular channel protein 1 OS=Homo sapiens GN=... Dynein light chain 1, cytoplasmic OS=Homo sapiens GN=DYNLL1 ... WD repeat-containing protein 1 OS=Homo sapiens GN=WDR1 PE=1 ... 26S protease regulatory subunit 7 OS=Homo sapiens GN=PSMC2 P... Glutathione S-transferase kappa 1 OS=Homo sapiens GN=GSTK1 P... Bifunctional purine biosynthesis protein PURH OS=Homo sapien... Heterogeneous nuclear ribonucleoprotein U OS=Homo sapiens GN... Tubulin beta-8 chain OS=Homo sapiens GN=TUBB8 PE=1 SV=2 Drebrin OS=Homo sapiens GN=DBN1 PE=1 SV=4 Histone H2B type 1-K OS=Homo sapiens GN=HIST1H2BK PE=1 SV=3 ... Keratin, type I cytoskeletal 17 OS=Homo sapiens GN=KRT17 PE=... Programmed cell death 6-interacting protein OS=Homo sapiens ... Ras-related protein Rab-5B OS=Homo sapiens GN=RAB5B PE=1 SV=... Adenine phosphoribosyltransferase OS=Homo sapiens GN=APRT PE... Polyadenylate-binding protein 1 OS=Homo sapiens GN=PABPC1 PE... UDP-glucose 6-dehydrogenase OS=Homo sapiens GN=UGDH PE=1 SV=... Talin-1 OS=Homo sapiens GN=TLN1 PE=1 SV=3
206,615 235,873 141,524 99,665 110,565 129,668 109,426 105,79 119,039 146,657 225,151 102,96 97,2 114,594 75,636 150,101 100,541 117,415 104,832 86,718 166,219 137,906 73,404 0 93,415 98,053 93,932 101,601 85,772 0 76,322 84,24 204,751 89,675 115,194 117,936 94,572 100,27 86,329
30,924 0 91,638 131,458 119,321 99,954 118,09 120,51 107,054 79,135 0 121,215 125,877 108,21 145,112 69,423 118,836 101,37 113,134 131,019 51,252 78,414 142,591 214,509 119,714 114,636 118,265 109,646 124,961 206,392 129,432 121,215 0 114,372 88,797 84,85 108,064 100,48 114,202
226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243
Heterogeneous nuclear ribonucleoprotein M OS=Homo sapiens GN... Coatomer subunit alpha OS=Homo sapiens GN=COPA PE=1 SV=2 ATP synthase subunit alpha, mitochondrial OS=Homo sapiens GN... Moesin OS=Homo sapiens GN=MSN PE=1 SV=3 26S protease regulatory subunit 8 OS=Homo sapiens GN=PSMC5 P... Glucose-6-phosphate isomerase OS=Homo sapiens GN=GPI PE=1 SV... 6-phosphofructokinase, liver type OS=Homo sapiens GN=PFKL PE... Coronin-1C OS=Homo sapiens GN=CORO1C PE=1 SV=1 ADP-ribosylation factor 5 OS=Homo sapiens GN=ARF5 PE=1 SV=2 ATP-citrate synthase OS=Homo sapiens GN=ACLY PE=1 SV=3 Endoplasmin OS=Homo sapiens GN=HSP90B1 PE=1 SV=1 Protein disulfide-isomerase OS=Homo sapiens GN=P4HB PE=1 SV=... L-lactate dehydrogenase A chain OS=Homo sapiens GN=LDHA PE=1... ADP-ribosylation factor-like protein 8B OS=Homo sapiens GN=A... DnaJ homolog subfamily A member 1 OS=Homo sapiens GN=DNAJA1 ... Integrin-linked protein kinase OS=Homo sapiens GN=ILK PE=1 S... Nicotinamide phosphoribosyltransferase OS=Homo sapiens GN=NA... X-ray repair cross-complementing protein 6 OS=Homo sapiens G...
116,321 83,827 108,766 85,846 113,289 95,11 99,792 52,25 196,561 106,046 105,746 90,542 149,197 133,154 98,033 109,587 122,5 104,574
83,688 115,421 89,76 112,496 84,641 102,641 97,904 144,997 0 90,168 90,345 105,228 46,003 61,585 96,178 84,475 69,988 87,776
244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282
Nucleoside diphosphate kinase B OS=Homo sapiens GN=NME2 PE=1... 26S protease regulatory subunit S10B OS=Homo sapiens GN=PSMC... Guanine nucleotide-binding protein G(i) subunit alpha-2 OS=H... Membrane-associated progesterone receptor component 1 OS=Hom... Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H... Ras GTPase-activating-like protein IQGAP1 OS=Homo sapiens GN... Aldo-keto reductase family 1 member C2 OS=Homo sapiens GN=AK... Guanine nucleotide-binding protein subunit beta-2-like 1 OS=... Junction plakoglobin OS=Homo sapiens GN=JUP PE=1 SV=3 Ras-related protein Rab-3B OS=Homo sapiens GN=RAB3B PE=1 SV=... Fatty acid synthase OS=Homo sapiens GN=FASN PE=1 SV=3 Splicing factor, arginine/serine-rich 3 OS=Homo sapiens GN=S... T-complex protein 1 subunit alpha OS=Homo sapiens GN=TCP1 PE... Nucleosome assembly protein 1-like 1 OS=Homo sapiens GN=NAP1... 1,4-alpha-glucan-branching enzyme OS=Homo sapiens GN=GBE1 PE... KN motif and ankyrin repeat domain-containing protein 2 OS=H... Alcohol dehydrogenase class-3 OS=Homo sapiens GN=ADH5 PE=1 S... Heterogeneous nuclear ribonucleoprotein A1 OS=Homo sapiens G... Aspartyl-tRNA synthetase, cytoplasmic OS=Homo sapiens GN=DAR... Tropomyosin alpha-1 chain OS=Homo sapiens GN=TPM1 PE=1 SV=2 Ras-related C3 botulinum toxin substrate 1 OS=Homo sapiens G... Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPY... Ras-related protein Rab-5A OS=Homo sapiens GN=RAB5A PE=1 SV=... Stress-70 protein, mitochondrial OS=Homo sapiens GN=HSPA9 PE... Glucose-6-phosphate 1-dehydrogenase OS=Homo sapiens GN=G6PD ... ADP/ATP translocase 2 OS=Homo sapiens GN=SLC25A5 PE=1 SV=6 Isocitrate dehydrogenase [NADP] cytoplasmic OS=Homo sapiens ... NADH-cytochrome b5 reductase 1 OS=Homo sapiens GN=CYB5R1 PE=... Peptidyl-prolyl cis-trans isomerase B OS=Homo sapiens GN=PPI... Elongation factor 1-gamma OS=Homo sapiens GN=EEF1G PE=1 SV=3... 60S ribosomal protein L36 OS=Homo sapiens GN=RPL36 PE=1 SV=3... Fatty acid-binding protein, heart OS=Homo sapiens GN=FABP3 P... Rho GTPase-activating protein 1 OS=Homo sapiens GN=ARHGAP1 P... Poly(rC)-binding protein 1 OS=Homo sapiens GN=PCBP1 PE=1 SV=... Keratin, type I cytoskeletal 15 OS=Homo sapiens GN=KRT15 PE=... Filamin-C OS=Homo sapiens GN=FLNC PE=1 SV=3 Ras-related protein Rab-10 OS=Homo sapiens GN=RAB10 PE=1 SV=... Peroxisomal multifunctional enzyme type 2 OS=Homo sapiens GN... UPF0568 protein C14orf166 OS=Homo sapiens GN=C14orf166 PE=1 ...
116,385 72,763 59,799 108,864 90,623 89,68 186,215 89,289 142,474 113,09 87,36 64,721 76,362 81,439 80,64 78,994 85,141 104,621 91,807 0 92,138 111,339 82,281 114,636 96,181 118,728 68,369 69,602 98,28 72,867 168,481 53,204 88,654 69,569 124,144 88,29 88,452 81,722 101,503
75,36 117,787 129,068 78,323 96,155 96,781 0 96,36 41,001 69,74 94,278 116,41 103,011 97,654 97,904 98,709 91,883 71,849 83,834 174,779 79,547 60,077 88,797 56,234 74,141 51,252 101,451 100,151 70,708 96,112 0 114,835 78,279 96,529 41,867 77,066 76,365 83,006 62,594
283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300
Transgelin OS=Homo sapiens GN=TAGLN PE=1 SV=4 Drebrin-like protein OS=Homo sapiens GN=DBNL PE=1 SV=1 Nucleophosmin OS=Homo sapiens GN=NPM1 PE=1 SV=2 Septin-2 OS=Homo sapiens GN=SEPT2 PE=1 SV=1 T-complex protein 1 subunit gamma OS=Homo sapiens GN=CCT3 PE... 60S ribosomal protein L29 OS=Homo sapiens GN=RPL29 PE=1 SV=2... Myosin-Ie OS=Homo sapiens GN=MYO1E PE=1 SV=2 Myosin phosphatase Rho-interacting protein OS=Homo sapiens G... Ras-related protein R-Ras2 OS=Homo sapiens GN=RRAS2 PE=1 SV=... Retinal dehydrogenase 1 OS=Homo sapiens GN=ALDH1A1 PE=1 SV=2... Poly(rC)-binding protein 2 OS=Homo sapiens GN=PCBP2 PE=1 SV=... Voltage-dependent anion-selective channel protein 2 OS=Homo ... C-1-tetrahydrofolate synthase, cytoplasmic OS=Homo sapiens G... Cellular retinoic acid-binding protein 2 OS=Homo sapiens GN=... 60S ribosomal protein L37a OS=Homo sapiens GN=RPL37A PE=1 SV... X-ray repair cross-complementing protein 5 OS=Homo sapiens G... Ras-related protein Rab-8A OS=Homo sapiens GN=RAB8A PE=1 SV=... D-3-phosphoglycerate dehydrogenase OS=Homo sapiens GN=PHGDH ...
88,012 65,825 72,206 78,406 64,919 66,756 76,637 62,132 86,718 77,683 77,547 96,275 83,249 76,915 76,915 96,669 85,461 73,019
75,985 97,676 90,911 84,615 98,084 96,057 86,152 100,579 74,868 83,834 83,688 64,936 77,59 83,006 83,006 62,594 73,783 85,965
301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339
14-3-3 protein epsilon OS=Homo sapiens GN=YWHAE PE=1 SV=1 Keratin, type I cytoskeletal 13 OS=Homo sapiens GN=KRT13 PE=... Signal transducer and activator of transcription 1-alpha/bet... cAMP-dependent protein kinase type I-alpha regulatory subuni... Histone H1.3 OS=Homo sapiens GN=HIST1H1D PE=1 SV=2 26S protease regulatory subunit 4 OS=Homo sapiens GN=PSMC1 P... Non-POU domain-containing octamer-binding protein OS=Homo sa... Rho GDP-dissociation inhibitor 1 OS=Homo sapiens GN=ARHGDIA ... Lamin-A/C OS=Homo sapiens GN=LMNA PE=1 SV=1 Ras-related protein Rab-13 OS=Homo sapiens GN=RAB13 PE=1 SV=... Actin-related protein 2/3 complex subunit 5 OS=Homo sapiens ... Leucyl-tRNA synthetase, cytoplasmic OS=Homo sapiens GN=LARS ... Heterogeneous nuclear ribonucleoprotein A0 OS=Homo sapiens G... Carbonyl reductase [NADPH] 1 OS=Homo sapiens GN=CBR1 PE=1 SV... Glutathione peroxidase 1 OS=Homo sapiens GN=GPX1 PE=1 SV=3 Ras-related protein Ral-A OS=Homo sapiens GN=RALA PE=1 SV=1 Ras-related protein Ral-B OS=Homo sapiens GN=RALB PE=1 SV=1 Protein-L-isoaspartate(D-aspartate) O-methyltransferase OS=H... Keratin, type II cytoskeletal 8 OS=Homo sapiens GN=KRT8 PE=1... Astrocytic phosphoprotein PEA-15 OS=Homo sapiens GN=PEA15 PE... BAG family molecular chaperone regulator 2 OS=Homo sapiens G... Transketolase OS=Homo sapiens GN=TKT PE=1 SV=3 Ras-related protein Rab-18 OS=Homo sapiens GN=RAB18 PE=1 SV=... Calreticulin OS=Homo sapiens GN=CALR PE=1 SV=1 Src substrate cortactin OS=Homo sapiens GN=CTTN PE=1 SV=2 Histone H3.2 OS=Homo sapiens GN=HIST2H3A PE=1 SV=3 Argininosuccinate synthase OS=Homo sapiens GN=ASS1 PE=1 SV=2... Splicing factor, arginine/serine-rich 7 OS=Homo sapiens GN=S... Caveolin-1 OS=Homo sapiens GN=CAV1 PE=1 SV=4 Prostacyclin synthase OS=Homo sapiens GN=PTGIS PE=1 SV=1 Glutathione S-transferase P OS=Homo sapiens GN=GSTP1 PE=1 SV... Desmoplakin OS=Homo sapiens GN=DSP PE=1 SV=3 Synaptic vesicle membrane protein VAT-1 homolog OS=Homo sapi... Calpain small subunit 1 OS=Homo sapiens GN=CAPNS1 PE=1 SV=1 Vesicle-fusing ATPase OS=Homo sapiens GN=NSF PE=1 SV=3 Polyadenylate-binding protein 4 OS=Homo sapiens GN=PABPC4 PE... cAMP-dependent protein kinase catalytic subunit beta OS=Homo... cAMP-dependent protein kinase catalytic subunit alpha OS=Hom... Serine/threonine-protein phosphatase 2A 65 kDa regulatory su...
83,249 115,876 70,762 83,577 81,112 72,37 82,631 34,687 111,898 52,287 70,293 87,249 58,002 76,637 88,012 51,526 51,526 93,518 87,903 54,432 33,536 68,149 85,876 67,877 64,329 0 103,051 59,464 139,138 77,838 84,24 80,103 90,028 52,807 76,088 60,433 50,4 50,4 66,076
74,868 41,684 86,547 70,152 70,028 78,101 64,854 112,302 34,502 94,046 75,859 58,443 87,632 68,922 56,989 92,676 92,676 50,462 55,337 88,114 108,576 73,546 55,606 73,252 76,365 140,377 37,07 80,216 0 61,092 54,547 58,517 48,578 85,483 61,585 77,077 87,026 87,026 71,309
340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357
Aldose reductase OS=Homo sapiens GN=AKR1B1 PE=1 SV=3 Atlastin-3 OS=Homo sapiens GN=ATL3 PE=1 SV=1 40S ribosomal protein S27-like OS=Homo sapiens GN=RPS27L PE=... Probable ATP-dependent RNA helicase DDX17 OS=Homo sapiens GN... Ubiquitin carboxyl-terminal hydrolase isozyme L1 OS=Homo sap... Programmed cell death protein 6 OS=Homo sapiens GN=PDCD6 PE=... Vigilin OS=Homo sapiens GN=HDLBP PE=1 SV=2 T-complex protein 1 subunit theta OS=Homo sapiens GN=CCT8 PE... Kinesin light chain 1 OS=Homo sapiens GN=KLC1 PE=1 SV=2 Leucine-rich repeat-containing protein 59 OS=Homo sapiens GN... F-actin-capping protein subunit beta OS=Homo sapiens GN=CAPZ... Caldesmon OS=Homo sapiens GN=CALD1 PE=1 SV=2 T-complex protein 1 subunit zeta OS=Homo sapiens GN=CCT6A PE... Sorting nexin-9 OS=Homo sapiens GN=SNX9 PE=1 SV=1 Coactosin-like protein OS=Homo sapiens GN=COTL1 PE=1 SV=3 Chloride intracellular channel protein 4 OS=Homo sapiens GN=... T-complex protein 1 subunit delta OS=Homo sapiens GN=CCT4 PE... Extended synaptotagmin-1 OS=Homo sapiens GN=ESYT1 PE=1 SV=1
100,768 58,859 0 70,762 31,732 74,096 58,596 77,476 92,62 57,624 76,637 49,078 73,294 53,517 49,832 69,923 59,078 67,301
36,249 77,636 136,366 64,617 102,733 59,973 75,281 55,741 39,982 74,624 55,137 81,854 57,526 77,007 80,667 60,368 70,84 62,254
358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396
Ras-related protein Rab-21 OS=Homo sapiens GN=RAB21 PE=1 SV=... 26S proteasome non-ATPase regulatory subunit 12 OS=Homo sapi... 60S acidic ribosomal protein P0 OS=Homo sapiens GN=RPLP0 PE=... Early endosome antigen 1 OS=Homo sapiens GN=EEA1 PE=1 SV=2 60S ribosomal protein L30 OS=Homo sapiens GN=RPL30 PE=1 SV=2... Collagen alpha-3(VI) chain OS=Homo sapiens GN=COL6A3 PE=1 SV... Septin-7 OS=Homo sapiens GN=SEPT7 PE=1 SV=2 26S protease regulatory subunit 6A OS=Homo sapiens GN=PSMC3 ... Translocon-associated protein subunit delta OS=Homo sapiens ... TAR DNA-binding protein 43 OS=Homo sapiens GN=TARDBP PE=1 SV... Myotrophin OS=Homo sapiens GN=MTPN PE=1 SV=2 Myosin-14 OS=Homo sapiens GN=MYH14 PE=1 SV=1 Guanine nucleotide-binding protein subunit alpha-11 OS=Homo ... EH domain-containing protein 1 OS=Homo sapiens GN=EHD1 PE=1 ... 40S ribosomal protein S20 OS=Homo sapiens GN=RPS20 PE=1 SV=1... SH3 domain-binding glutamic acid-rich-like protein 3 OS=Homo... NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 1... E3 ubiquitin/ISG15 ligase TRIM25 OS=Homo sapiens GN=TRIM25 P... Serine/threonine-protein phosphatase PP1-alpha catalytic sub... Insulin-like growth factor 2 mRNA-binding protein 2 OS=Homo ... Heat shock 70 kDa protein 1A/1B OS=Homo sapiens GN=HSPA1A PE... Actin-related protein 2/3 complex subunit 1A OS=Homo sapiens... 40S ribosomal protein S30 OS=Homo sapiens GN=FAU PE=1 SV=1 14-3-3 protein eta OS=Homo sapiens GN=YWHAH PE=1 SV=4 60S ribosomal protein L10a OS=Homo sapiens GN=RPL10A PE=1 SV... Ras-related protein Rap-2c OS=Homo sapiens GN=RAP2C PE=1 SV=... Ubiquitin-like modifier-activating enzyme 1 OS=Homo sapiens ... Alcohol dehydrogenase 1B OS=Homo sapiens GN=ADH1B PE=1 SV=2 AP-2 complex subunit mu OS=Homo sapiens GN=AP2M1 PE=1 SV=2 Heterogeneous nuclear ribonucleoproteins A2/B1 OS=Homo sapie... Heterogeneous nuclear ribonucleoprotein F OS=Homo sapiens GN... Calpain-2 catalytic subunit OS=Homo sapiens GN=CAPN2 PE=1 SV... RhoA activator C11orf59 OS=Homo sapiens GN=C11orf59 PE=1 SV=... Cytoplasmic aconitate hydratase OS=Homo sapiens GN=ACO1 PE=1... EH domain-containing protein 4 OS=Homo sapiens GN=EHD4 PE=1 ... 26S protease regulatory subunit 6B OS=Homo sapiens GN=PSMC4 ... Heterogeneous nuclear ribonucleoprotein H OS=Homo sapiens GN... Splicing factor, arginine/serine-rich 9 OS=Homo sapiens GN=S... rRNA 2'-O-methyltransferase fibrillarin OS=Homo sapiens GN=F...
78,624 62,072 55,806 57,673 61,532 61,251 48,578 48,357 81,806 51,277 59,968 46,11 39,422 59,631 59,464 0 79,732 61,776 64,329 70,88 49,677 47,812 119,935 57,53 48,914 77,335 60,194 56,609 81,335 40,092 51,153 60,653 43,951 67,658 65,399 50,786 55,16 80,047 55,11
50,91 66,987 72,27 70,358 66,404 66,101 78,637 78,279 44,142 73,783 64,716 78,47 85,087 64,353 64,172 123,17 43,023 60,607 57,852 50,995 71,481 72,237 0 62,085 70,383 41,73 57,743 61,092 35,11 75,716 64,404 54,547 71,148 47,245 49,404 63,942 59,527 34,554 59,474
397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414
26S proteasome non-ATPase regulatory subunit 13 OS=Homo sapi... Protein S100-A8 OS=Homo sapiens GN=S100A8 PE=1 SV=1 Dolichyl-diphosphooligosaccharide--protein glycosyltransfera... Histone H2A type 1-J OS=Homo sapiens GN=HIST1H2AJ PE=1 SV=3 ... Ras-related protein Rab-32 OS=Homo sapiens GN=RAB32 PE=1 SV=... Long-chain-fatty-acid--CoA ligase 3 OS=Homo sapiens GN=ACSL3... V-type proton ATPase catalytic subunit A OS=Homo sapiens GN=... Importin subunit beta-1 OS=Homo sapiens GN=KPNB1 PE=1 SV=2 Coronin-1B OS=Homo sapiens GN=CORO1B PE=1 SV=1 HLA class I histocompatibility antigen, Cw-14 alpha chain OS... Fragile X mental retardation syndrome-related protein 1 OS=H... Calcium/calmodulin-dependent protein kinase type II subunit ... Polymerase I and transcript release factor OS=Homo sapiens G... Keratin, type II cytoskeletal 78 OS=Homo sapiens GN=KRT78 PE... UPF0027 protein C22orf28 OS=Homo sapiens GN=C22orf28 PE=1 SV... Coatomer subunit gamma OS=Homo sapiens GN=COPG PE=1 SV=1 Ferritin light chain OS=Homo sapiens GN=FTL PE=1 SV=2 HLA class I histocompatibility antigen, A-31 alpha chain OS=...
94,098 114,132 69,946 54,812 62,899 39,312 57,343 60,584 65,118 38,668 68,369 63,407 81,648 81,648 42,037 44,53 0 77,547
20,31 0 44,033 59,152 50,91 74,244 55,696 52,305 46,85 73,027 43,04 47,899 29,371 29,371 68,048 65,531 109,093 31,383
415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453
Glia-derived nexin OS=Homo sapiens GN=SERPINE2 PE=1 SV=1 Ras-related protein Rab-35 OS=Homo sapiens GN=RAB35 PE=1 SV=... Coatomer subunit epsilon OS=Homo sapiens GN=COPE PE=1 SV=3 T-complex protein 1 subunit epsilon OS=Homo sapiens GN=CCT5 ... Translationally-controlled tumor protein OS=Homo sapiens GN=... Nucleosome assembly protein 1-like 4 OS=Homo sapiens GN=NAP1... Alanyl-tRNA synthetase, cytoplasmic OS=Homo sapiens GN=AARS ... 60S ribosomal protein L11 OS=Homo sapiens GN=RPL11 PE=1 SV=2... Estradiol 17-beta-dehydrogenase 12 OS=Homo sapiens GN=HSD17B... FERM domain-containing protein 6 OS=Homo sapiens GN=FRMD6 PE... 26S proteasome non-ATPase regulatory subunit 11 OS=Homo sapi... Propionyl-CoA carboxylase beta chain, mitochondrial OS=Homo ... Sulfide:quinone oxidoreductase, mitochondrial OS=Homo sapien... FYVE and coiled-coil domain-containing protein 1 OS=Homo sap... ATP-dependent RNA helicase DDX3Y OS=Homo sapiens GN=DDX3Y PE... Dolichyl-diphosphooligosaccharide--protein glycosyltransfera... Tax1-binding protein 1 OS=Homo sapiens GN=TAX1BP1 PE=1 SV=2 Translational activator GCN1 OS=Homo sapiens GN=GCN1L1 PE=1 ... Protein-glutamine gamma-glutamyltransferase 2 OS=Homo sapien... Keratin, type II cytoskeletal 4 OS=Homo sapiens GN=KRT4 PE=1... Spliceosome RNA helicase BAT1 OS=Homo sapiens GN=BAT1 PE=1 S... Serine/threonine-protein phosphatase PP1-beta catalytic subu... ADP-ribosylation factor-like protein 1 OS=Homo sapiens GN=AR... Lanosterol 14-alpha demethylase OS=Homo sapiens GN=CYP51A1 P... Membrane-associated progesterone receptor component 2 OS=Hom... Utrophin OS=Homo sapiens GN=UTRN PE=1 SV=2 Thioredoxin-dependent peroxide reductase, mitochondrial OS=H... GTP-binding protein Rheb OS=Homo sapiens GN=RHEB PE=1 SV=1 ADP-ribosylation factor-like protein 2 OS=Homo sapiens GN=AR... Heterogeneous nuclear ribonucleoprotein H2 OS=Homo sapiens G... Guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit ga... GTPase HRas OS=Homo sapiens GN=HRAS PE=1 SV=1 Beta-centractin OS=Homo sapiens GN=ACTR1B PE=1 SV=1 60S ribosomal protein L26-like 1 OS=Homo sapiens GN=RPL26L1 ... Nucleoside-triphosphatase C1orf57 OS=Homo sapiens GN=C1orf57... Nicotinamide N-methyltransferase OS=Homo sapiens GN=NNMT PE=... Syntenin-1 OS=Homo sapiens GN=SDCBP PE=1 SV=1 ATP synthase subunit beta, mitochondrial OS=Homo sapiens GN=... Zyxin OS=Homo sapiens GN=ZYX PE=1 SV=1
80,007 70,41 45,949 65,399 41,141 56,609 40,206 0 45,36 56,883 41,921 105,027 70,762 52,664 0 61,678 40,358 51,661 36,05 66,256 66,241 43,279 58,642 70,34 31,732 41,225 55,283 57,686 57,686 39,4 98,28 37,44 47,049 97,603 37,243 53,607 71,237 53,506 49,484
28,781 37,993 61,985 42,347 66,598 50,91 67,056 107,254 61,19 49,109 63,336 0 33,94 51,668 104,134 42,358 62,912 51,463 66,694 35,751 35,743 58,383 42,191 30,364 68,489 58,948 44,745 41,503 41,503 59,527 0 60,607 50,775 0 60,288 43,389 25,626 43,307 46,727
454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471
78 kDa glucose-regulated protein OS=Homo sapiens GN=HSPA5 PE... 40S ribosomal protein S27a OS=Homo sapiens GN=RPS27A PE=1 SV... Copine-3 OS=Homo sapiens GN=CPNE3 PE=1 SV=1 Dual specificity mitogen-activated protein kinase kinase 3 O... Septin-9 OS=Homo sapiens GN=SEPT9 PE=1 SV=2 Thioredoxin domain-containing protein 5 OS=Homo sapiens GN=T... Coatomer subunit delta OS=Homo sapiens GN=ARCN1 PE=1 SV=1 Ras-related protein Rab-23 OS=Homo sapiens GN=RAB23 PE=1 SV=... UMP-CMP kinase OS=Homo sapiens GN=CMPK1 PE=1 SV=3 RNA-binding protein with multiple splicing OS=Homo sapiens G... Guanine nucleotide-binding protein G(q) subunit alpha OS=Hom... Guanine nucleotide-binding protein G(s) subunit alpha isofor... Ubiquitin-conjugating enzyme E2 L3 OS=Homo sapiens GN=UBE2L3... Phosphate carrier protein, mitochondrial OS=Homo sapiens GN=... Bifunctional aminoacyl-tRNA synthetase OS=Homo sapiens GN=EP... Mitogen-activated protein kinase 1 OS=Homo sapiens GN=MAPK1 ... Ran-specific GTPase-activating protein OS=Homo sapiens GN=RA... Ras-related protein Rab-9A OS=Homo sapiens GN=RAB9A PE=1 SV=...
43,279 0 52,709 50,981 36,226 49,14 48,467 44,786 54,154 54,154 39,422 44,504 91,899 39,095 53,82 49,14 52,807 52,807
52,545 95,456 42,662 44,015 58,642 44,193 44,833 48,332 38,962 38,962 53,179 48,028 0 52,738 37,88 42,425 37,993 37,993
472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510
Protein disulfide-isomerase A6 OS=Homo sapiens GN=PDIA6 PE=1... Fructose-bisphosphate aldolase A OS=Homo sapiens GN=ALDOA PE... Serpin B8 OS=Homo sapiens GN=SERPINB8 PE=1 SV=2 6-phosphofructokinase, muscle type OS=Homo sapiens GN=PFKM P... Angiomotin-like protein 1 OS=Homo sapiens GN=AMOTL1 PE=1 SV=... ELAV-like protein 1 OS=Homo sapiens GN=ELAVL1 PE=1 SV=2 Glucosamine--fructose-6-phosphate aminotransferase [isomeriz... Arginyl-tRNA synthetase, cytoplasmic OS=Homo sapiens GN=RARS... Neutral alpha-glucosidase AB OS=Homo sapiens GN=GANAB PE=1 S... Methylcrotonoyl-CoA carboxylase beta chain, mitochondrial OS... 26S proteasome non-ATPase regulatory subunit 3 OS=Homo sapie... Serpin B6 OS=Homo sapiens GN=SERPINB6 PE=1 SV=3 ATP-binding cassette sub-family F member 2 OS=Homo sapiens G... Heterogeneous nuclear ribonucleoprotein L OS=Homo sapiens GN... Protein ETHE1, mitochondrial OS=Homo sapiens GN=ETHE1 PE=1 S... Alpha-soluble NSF attachment protein OS=Homo sapiens GN=NAPA... Desmoglein-1 OS=Homo sapiens GN=DSG1 PE=1 SV=2 AP-3 complex subunit mu-1 OS=Homo sapiens GN=AP3M1 PE=1 SV=1... Heat shock 70 kDa protein 1-like OS=Homo sapiens GN=HSPA1L P... Collagen alpha-1(VI) chain OS=Homo sapiens GN=COL6A1 PE=1 SV... 3-ketoacyl-CoA thiolase, peroxisomal OS=Homo sapiens GN=ACAA... 6-phosphogluconolactonase OS=Homo sapiens GN=PGLS PE=1 SV=2 Protein NOXP20 OS=Homo sapiens GN=FAM114A1 PE=1 SV=2 40S ribosomal protein S25 OS=Homo sapiens GN=RPS25 PE=1 SV=1... Cytosol aminopeptidase OS=Homo sapiens GN=LAP3 PE=1 SV=3 ATP-dependent RNA helicase DDX1 OS=Homo sapiens GN=DDX1 PE=1... Thrombospondin-1 OS=Homo sapiens GN=THBS1 PE=1 SV=2 Sarcoplasmic/endoplasmic reticulum calcium ATPase 2 OS=Homo ... Catenin delta-1 OS=Homo sapiens GN=CTNND1 PE=1 SV=1 Adenosylhomocysteinase OS=Homo sapiens GN=AHCY PE=1 SV=4 Far upstream element-binding protein 3 OS=Homo sapiens GN=FU... ATP-binding cassette sub-family D member 3 OS=Homo sapiens G... Calcium/calmodulin-dependent protein kinase type II subunit ... Splicing factor, proline- and glutamine-rich OS=Homo sapiens... Ras-related GTP-binding protein A OS=Homo sapiens GN=RRAGA P... Beta-2-syntrophin OS=Homo sapiens GN=SNTB2 PE=1 SV=1 EMILIN-1 OS=Homo sapiens GN=EMILIN1 PE=1 SV=2 Cytoplasmic FMR1-interacting protein 1 OS=Homo sapiens GN=CY... Ubiquitin thioesterase OTUB1 OS=Homo sapiens GN=OTUB1 PE=1 S...
64,329 58,32 28,38 45,36 33,308 65,118 55,678 53,607 59,968 87,981 66,256 47,049 56,791 48,056 41,788 47,974 53,965 59,25 38,638 37,859 50,067 41,141 37,706 84,914 47,72 43,031 48,384 47,537 36,551 57,33 37,113 42,951 37,299 45,039 33,911 32,76 55,718 45,179 39,167
26,034 31,469 61,255 44,057 55,916 23,425 32,775 34,711 28,313 0 21,451 40,62 30,644 38,896 45,098 38,83 32,759 27,404 47,654 48,285 36,021 44,398 47,474 0 36,785 41,278 35,898 36,644 47,334 26,516 46,727 40,558 46,003 37,805 48,796 49,496 26,307 36,568 42,269
511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528
Phosphatidylinositide phosphatase SAC1 OS=Homo sapiens GN=SA... Ras-related protein Rab-11B OS=Homo sapiens GN=RAB11B PE=1 S... A-kinase anchor protein 2 OS=Homo sapiens GN=AKAP2 PE=1 SV=3... Isocitrate dehydrogenase [NADP], mitochondrial OS=Homo sapie... Niban-like protein 1 OS=Homo sapiens GN=FAM129B PE=1 SV=2 Coatomer subunit beta OS=Homo sapiens GN=COPB1 PE=1 SV=3 Platelet-activating factor acetylhydrolase IB subunit beta O... Superoxide dismutase [Mn], mitochondrial OS=Homo sapiens GN=... Palladin OS=Homo sapiens GN=PALLD PE=1 SV=2 Putative basic leucine zipper and W2 domain-containing prote... Nuclear receptor coactivator 4 OS=Homo sapiens GN=NCOA4 PE=1... Adseverin OS=Homo sapiens GN=SCIN PE=1 SV=4 Isoleucyl-tRNA synthetase, cytoplasmic OS=Homo sapiens GN=IA... Peroxiredoxin-4 OS=Homo sapiens GN=PRDX4 PE=1 SV=1 Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase ... Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 Ras-related protein Rap-2a OS=Homo sapiens GN=RAP2A PE=1 SV=... Ras-related protein Rap-2b OS=Homo sapiens GN=RAP2B PE=1 SV=...
42,192 81,149 45,307 46,966 38,615 55,689 46,351 79,687 43,491 38,044 28,812 19,794 42,053 78,334 34,574 46,477 77,335 77,335
39,028 0 35,56 33,79 41,673 24,039 33,347 0 35,891 41,057 49,749 58,742 36,307 0 43,531 31,349 0 0
529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567
Coatomer subunit beta' OS=Homo sapiens GN=COPB2 PE=1 SV=2 Glycogen phosphorylase, brain form OS=Homo sapiens GN=PYGB P... Ubiquitin carboxyl-terminal hydrolase 5 OS=Homo sapiens GN=U... Perilipin-3 OS=Homo sapiens GN=PLIN3 PE=1 SV=2 Adenylyl cyclase-associated protein 1 OS=Homo sapiens GN=CAP... Methyltransferase-like protein 7A OS=Homo sapiens GN=METTL7A... Ras-related protein Rab-31 OS=Homo sapiens GN=RAB31 PE=1 SV=... L-lactate dehydrogenase B chain OS=Homo sapiens GN=LDHB PE=1... Trifunctional enzyme subunit alpha, mitochondrial OS=Homo sa... 26S proteasome non-ATPase regulatory subunit 2 OS=Homo sapie... ATP synthase subunit f, mitochondrial OS=Homo sapiens GN=ATP... T-complex protein 1 subunit eta OS=Homo sapiens GN=CCT7 PE=1... S-adenosylmethionine synthase isoform type-2 OS=Homo sapiens... Regulator of nonsense transcripts 1 OS=Homo sapiens GN=UPF1 ... Heterogeneous nuclear ribonucleoproteins C1/C2 OS=Homo sapie... FAS-associated factor 2 OS=Homo sapiens GN=FAF2 PE=1 SV=2 Erlin-1 OS=Homo sapiens GN=ERLIN1 PE=1 SV=1 Spermidine synthase OS=Homo sapiens GN=SRM PE=1 SV=1 Prohibitin-2 OS=Homo sapiens GN=PHB2 PE=1 SV=2 Non-specific lipid-transfer protein OS=Homo sapiens GN=SCP2 ... Myosin light chain 6B OS=Homo sapiens GN=MYL6B PE=1 SV=1 Transitional endoplasmic reticulum ATPase OS=Homo sapiens GN... Sorting nexin-6 OS=Homo sapiens GN=SNX6 PE=1 SV=1 Serine-threonine kinase receptor-associated protein OS=Homo ... Guanine nucleotide-binding protein G(k) subunit alpha OS=Hom... Transducin beta-like protein 2 OS=Homo sapiens GN=TBL2 PE=1 ... Cathepsin B OS=Homo sapiens GN=CTSB PE=1 SV=3 Ras-related GTP-binding protein C OS=Homo sapiens GN=RRAGC P... Keratin, type II cytoskeletal 80 OS=Homo sapiens GN=KRT80 PE... Cystatin-A OS=Homo sapiens GN=CSTA PE=1 SV=1 Heterogeneous nuclear ribonucleoprotein D0 OS=Homo sapiens G... Keratin, type II cytoskeletal 72 OS=Homo sapiens GN=KRT72 PE... DCC-interacting protein 13-beta OS=Homo sapiens GN=APPL2 PE=... Filamin-B OS=Homo sapiens GN=FLNB PE=1 SV=1 Protein tyrosine phosphatase-like protein PTPLAD1 OS=Homo sa... NADPH--cytochrome P450 reductase OS=Homo sapiens GN=POR PE=1... Ras-related protein Rab-6A OS=Homo sapiens GN=RAB6A PE=1 SV=... Signal recognition particle 72 kDa protein OS=Homo sapiens G... Ras-related protein Rab-34 OS=Homo sapiens GN=RAB34 PE=1 SV=...
39,052 58,758 41,237 32,609 52,14 29,001 36,475 52,965 55,645 54,552 75,279 32,579 35,829 43,874 23,454 39,754 40,903 23,431 35,499 38,809 0 30,728 26,144 40,435 29,984 47,491 73,058 53,204 46,966 72,206 39,866 34,619 37,299 39,433 29,321 31,357 34,02 42,183 40,982
37,93 18,117 35,601 43,989 24,115 46,946 39,363 22,864 20,017 21,026 0 42,191 38,666 30,438 50,623 34,321 33,106 50,573 38,31 34,902 73,428 42,636 47,023 32,728 43,144 25,626 0 19,139 25,342 0 32,267 37,361 34,502 32,284 42,191 39,48 36,714 28,452 29,485
568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585
Heterogeneous nuclear ribonucleoprotein Q OS=Homo sapiens GN... Myosin-IXb OS=Homo sapiens GN=MYO9B PE=1 SV=2 Eukaryotic translation initiation factor 2 subunit 1 OS=Homo... Keratin, type II cytoskeletal 73 OS=Homo sapiens GN=KRT73 PE... Nucleoside diphosphate kinase A OS=Homo sapiens GN=NME1 PE=1... Calcium-binding and coiled-coil domain-containing protein 1 ... Polypyrimidine tract-binding protein 1 OS=Homo sapiens GN=PT... Interferon-inducible double stranded RNA-dependent protein k... Importin-5 OS=Homo sapiens GN=IPO5 PE=1 SV=4 Heterogeneous nuclear ribonucleoprotein R OS=Homo sapiens GN... Serine/threonine-protein kinase OSR1 OS=Homo sapiens GN=OXSR... Protein S100-A16 OS=Homo sapiens GN=S100A16 PE=1 SV=1 ATP synthase subunit g, mitochondrial OS=Homo sapiens GN=ATP... Copine-1 OS=Homo sapiens GN=CPNE1 PE=1 SV=1 Hsp90 co-chaperone Cdc37 OS=Homo sapiens GN=CDC37 PE=1 SV=1 Keratin, type I cytoskeletal 24 OS=Homo sapiens GN=KRT24 PE=... Vasodilator-stimulated phosphoprotein OS=Homo sapiens GN=VAS... Sideroflexin-3 OS=Homo sapiens GN=SFXN3 PE=2 SV=1
39,754 31,151 33,696 26,698 69,831 25,601 26,652 45,215 45,153 39,126 40,282 68,701 68,701 32,943 28,08 53,914 27,932 44,088
30,644 38,926 36,364 43,217 0 44,206 43,144 24,398 24,364 30,16 28,981 0 0 35,552 40,405 14,546 40,192 23,79
586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624
NAD(P)H dehydrogenase [quinone] 1 OS=Homo sapiens GN=NQO1 PE... Cytosolic Fe-S cluster assembly factor NUBP2 OS=Homo sapiens... Catechol O-methyltransferase OS=Homo sapiens GN=COMT PE=1 SV... Glutaredoxin-1 OS=Homo sapiens GN=GLRX PE=1 SV=2 Interferon-induced, double-stranded RNA-activated protein ki... Microtubule-associated protein 4 OS=Homo sapiens GN=MAP4 PE=... Vacuolar protein sorting-associated protein 26A OS=Homo sapi... Plasma membrane calcium-transporting ATPase 1 OS=Homo sapien... DNA-dependent protein kinase catalytic subunit OS=Homo sapie... Annexin A11 OS=Homo sapiens GN=ANXA11 PE=1 SV=1 Eukaryotic initiation factor 4A-II OS=Homo sapiens GN=EIF4A2... DNA replication licensing factor MCM7 OS=Homo sapiens GN=MCM... ATP-binding cassette sub-family F member 1 OS=Homo sapiens G... Mitochondrial fission factor OS=Homo sapiens GN=MFF PE=1 SV=... Prohibitin OS=Homo sapiens GN=PHB PE=1 SV=1 Splicing factor, arginine/serine-rich 6 OS=Homo sapiens GN=S... CB1 cannabinoid receptor-interacting protein 1 OS=Homo sapie... Seryl-tRNA synthetase, cytoplasmic OS=Homo sapiens GN=SARS P... Putative pre-mRNA-splicing factor ATP-dependent RNA helicase... Protein flightless-1 homolog OS=Homo sapiens GN=FLII PE=1 SV... Electron transfer flavoprotein subunit alpha, mitochondrial ... Cytochrome b-c1 complex subunit 2, mitochondrial OS=Homo sap... Putative tropomyosin alpha-3 chain-like protein OS=Homo sapi... Keratin, type II cytoskeletal 7 OS=Homo sapiens GN=KRT7 PE=1... Dolichyl-diphosphooligosaccharide--protein glycosyltransfera... Protein S100-A9 OS=Homo sapiens GN=S100A9 PE=1 SV=1 Inositol 1,4,5-trisphosphate receptor type 3 OS=Homo sapiens... Calnexin OS=Homo sapiens GN=CANX PE=1 SV=2 Plasma membrane calcium-transporting ATPase 4 OS=Homo sapien... Serpin B12 OS=Homo sapiens GN=SERPINB12 PE=1 SV=1 CAD protein OS=Homo sapiens GN=CAD PE=1 SV=3 Vinexin OS=Homo sapiens GN=SORBS3 PE=1 SV=1 Spectrin beta chain, brain 1 OS=Homo sapiens GN=SPTBN1 PE=1 ... DnaJ homolog subfamily C member 13 OS=Homo sapiens GN=DNAJC1... Glutaminyl-tRNA synthetase OS=Homo sapiens GN=QARS PE=1 SV=1... Transmembrane protein 97 OS=Homo sapiens GN=TMEM97 PE=2 SV=1... Putative Ras-related protein Rab-12 OS=Homo sapiens GN=RAB12... Multifunctional protein ADE2 OS=Homo sapiens GN=PAICS PE=1 S... Monoglyceride lipase OS=Homo sapiens GN=MGLL PE=1 SV=2
25,825 39,167 39,167 66,756 32,106 36,855 43,279 42,187 41,141 28,024 0 44,288 29,31 20,691 65,038 20,57 64,721 34,417 40,054 30,669 63,749 46,862 63,464 30,176 35,13 62,072 29,142 35,859 39,914 61,152 31,803 21,091 28,436 28,393 45,653 60,308 29,001 33,3 35,031
41,806 28,179 28,179 0 34,648 29,83 23,353 24,281 24,974 37,805 65,67 21,242 36,149 44,658 0 44,398 0 29,714 24,014 33,098 0 16,858 0 32,565 27,08 0 32,879 25,799 21,537 0 29,173 39,833 32,303 32,344 14,78 0 31,297 26,952 25,203
625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642
Valyl-tRNA synthetase OS=Homo sapiens GN=VARS PE=1 SV=4 Myosin light chain kinase, smooth muscle OS=Homo sapiens GN=... EH domain-containing protein 3 OS=Homo sapiens GN=EHD3 PE=1 ... 5'-AMP-activated protein kinase catalytic subunit alpha-1 OS... Constitutive coactivator of PPAR-gamma-like protein 1 OS=Hom... Splicing factor U2AF 35 kDa subunit OS=Homo sapiens GN=U2AF1... Pyridoxal kinase OS=Homo sapiens GN=PDXK PE=1 SV=1 Ras GTPase-activating-like protein IQGAP3 OS=Homo sapiens GN... Ribose-phosphate pyrophosphokinase 1 OS=Homo sapiens GN=PRPS... Protein pelota homolog OS=Homo sapiens GN=PELO PE=1 SV=1 Emerin OS=Homo sapiens GN=EMD PE=1 SV=1 Filaggrin-2 OS=Homo sapiens GN=FLG2 PE=1 SV=1 Lactoylglutathione lyase OS=Homo sapiens GN=GLO1 PE=1 SV=4 Liprin-beta-1 OS=Homo sapiens GN=PPFIBP1 PE=1 SV=2 UDP-N-acetylhexosamine pyrophosphorylase-like protein 1 OS=H... Insulin-like growth factor 2 mRNA-binding protein 3 OS=Homo ... Fragile X mental retardation 1 protein OS=Homo sapiens GN=FM... Protein transport protein Sec31A OS=Homo sapiens GN=SEC31A P...
41,987 24,031 38,88 25,317 31,647 58,968 34,02 30,37 22,252 18,38 27,859 35,514 57,686 34,996 34,892 24,443 39,188 29,001
18,125 35,908 20,979 34,153 27,322 0 24,476 28,093 36,021 39,67 30,065 22,357 0 22,66 22,593 32,973 18,125 28,167
643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681
Tricarboxylate transport protein, mitochondrial OS=Homo sapi... Desmin OS=Homo sapiens GN=DES PE=1 SV=3 Vesicle-associated membrane protein-associated protein A OS=... Serine/threonine-protein phosphatase 2A 55 kDa regulatory su... Methionyl-tRNA synthetase, cytoplasmic OS=Homo sapiens GN=MA... Pyruvate dehydrogenase E1 component subunit alpha, somatic f... Mitogen-activated protein kinase kinase kinase kinase 4 OS=H... Myosin-XVIIIa OS=Homo sapiens GN=MYO18A PE=1 SV=3 Calumenin OS=Homo sapiens GN=CALU PE=1 SV=2 Histidine triad nucleotide-binding protein 1 OS=Homo sapiens... Small nuclear ribonucleoprotein Sm D3 OS=Homo sapiens GN=SNR... Heme-binding protein 1 OS=Homo sapiens GN=HEBP1 PE=1 SV=1 Zinc finger CCCH-type antiviral protein 1 OS=Homo sapiens GN... Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 Ubiquitin-like modifier-activating enzyme 6 OS=Homo sapiens ... Inverted formin-2 OS=Homo sapiens GN=INF2 PE=1 SV=2 FERM, RhoGEF and pleckstrin domain-containing protein 1 OS=H... CTP synthase 1 OS=Homo sapiens GN=CTPS PE=1 SV=2 Heterogeneous nuclear ribonucleoprotein G OS=Homo sapiens GN... RuvB-like 1 OS=Homo sapiens GN=RUVBL1 PE=1 SV=1 Alpha-adducin OS=Homo sapiens GN=ADD1 PE=1 SV=2 Sperm-specific antigen 2 OS=Homo sapiens GN=SSFA2 PE=1 SV=3 Protein Niban OS=Homo sapiens GN=FAM129A PE=1 SV=1 Retinol dehydrogenase 14 OS=Homo sapiens GN=RDH14 PE=1 SV=1 Carbonyl reductase [NADPH] 3 OS=Homo sapiens GN=CBR3 PE=1 SV... Phenylalanyl-tRNA synthetase beta chain OS=Homo sapiens GN=F... Adenylate kinase isoenzyme 1 OS=Homo sapiens GN=AK1 PE=1 SV=... Alkyldihydroxyacetonephosphate synthase, peroxisomal OS=Homo... ATP-binding cassette sub-family E member 1 OS=Homo sapiens G... Splicing factor U2AF 65 kDa subunit OS=Homo sapiens GN=U2AF2... Dolichol-phosphate mannosyltransferase OS=Homo sapiens GN=DP... Signal recognition particle receptor subunit beta OS=Homo sa... Toll-interacting protein OS=Homo sapiens GN=TOLLIP PE=1 SV=1... Asparaginyl-tRNA synthetase, cytoplasmic OS=Homo sapiens GN=... GTP-binding protein SAR1b OS=Homo sapiens GN=SAR1B PE=1 SV=1... Heat shock 70 kDa protein 6 OS=Homo sapiens GN=HSPA6 PE=1 SV... Beta-galactosidase OS=Homo sapiens GN=GLB1 PE=1 SV=2 Eukaryotic initiation factor 4A-III OS=Homo sapiens GN=EIF4A... Sorting nexin-18 OS=Homo sapiens GN=SNX18 PE=1 SV=2
56,883 0 56,837 39,576 35,381 27,216 25,7 15,503 56,16 56,16 56,16 56,16 39,225 23,024 26,906 28,327 33,857 29,933 36,195 38,795 19,203 28,102 30,501 21,06 0 42,049 54,713 43,016 35,44 22,346 54,432 26,111 25,825 25,825 53,607 0 41,809 34,434 22,536
0 56,868 0 17,084 21,213 29,371 30,817 40,897 0 0 0 0 16,932 33,13 29,036 27,513 21,923 25,843 19,531 16,747 36,266 27,295 24,687 34,092 55,137 12,965 0 11,606 19,123 32,154 0 28,179 27,87 27,87 0 53,444 11,28 18,58 30,4
682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699
Tensin-1 OS=Homo sapiens GN=TNS1 PE=1 SV=2 Ribosomal L1 domain-containing protein 1 OS=Homo sapiens GN=... Hydroxysteroid dehydrogenase-like protein 2 OS=Homo sapiens ... LIM domain only protein 7 OS=Homo sapiens GN=LMO7 PE=1 SV=2 Signal recognition particle 68 kDa protein OS=Homo sapiens G... Guanine nucleotide-binding protein G(i) subunit alpha-1 OS=H... S-formylglutathione hydrolase OS=Homo sapiens GN=ESD PE=1 SV... Twinfilin-1 OS=Homo sapiens GN=TWF1 PE=1 SV=3 Matrin-3 OS=Homo sapiens GN=MATR3 PE=1 SV=2 Guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit be... Voltage-dependent anion-selective channel protein 3 OS=Homo ... Testin OS=Homo sapiens GN=TES PE=1 SV=1 Dedicator of cytokinesis protein 7 OS=Homo sapiens GN=DOCK7 ... Adenylate kinase isoenzyme 5 OS=Homo sapiens GN=AK5 PE=1 SV=... Eukaryotic translation initiation factor 3 subunit C OS=Homo... Collagen alpha-2(VI) chain OS=Homo sapiens GN=COL6A2 PE=1 SV... Trifunctional purine biosynthetic protein adenosine-3 OS=Hom... Keratin, type II cytoskeletal 1b OS=Homo sapiens GN=KRT77 PE...
26,51 21,662 25,393 23,125 28,214 19,989 25,093 30,327 25,063 52,031 25,004 33,616 24,8 37,773 38,752 17,361 24,521 30,713
26,409 31,169 27,404 29,493 24,359 32,358 27,08 21,819 27,048 0 26,984 18,139 26,763 13,588 12,546 33,724 26,463 19,887
700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738
Talin-2 OS=Homo sapiens GN=TLN2 PE=1 SV=4 Thymidylate kinase OS=Homo sapiens GN=DTYMK PE=1 SV=4 Vacuolar protein sorting-associated protein 35 OS=Homo sapie... Fatty acid desaturase 2 OS=Homo sapiens GN=FADS2 PE=1 SV=1 Dynamin-1-like protein OS=Homo sapiens GN=DNM1L PE=1 SV=2 Cell division control protein 2 homolog OS=Homo sapiens GN=C... UBX domain-containing protein 1 OS=Homo sapiens GN=UBXN1 PE=... Calcium-binding and coiled-coil domain-containing protein 2 ... Sterol-4-alpha-carboxylate 3-dehydrogenase, decarboxylating ... PDZ and LIM domain protein 7 OS=Homo sapiens GN=PDLIM7 PE=1 ... HLA class I histocompatibility antigen, B-42 alpha chain OS=... HLA class I histocompatibility antigen, B-40 alpha chain OS=... HLA class I histocompatibility antigen, B-53 alpha chain OS=... Nucleoredoxin OS=Homo sapiens GN=NXN PE=1 SV=2 Eukaryotic translation initiation factor 4 gamma 1 OS=Homo s... Tyrosyl-tRNA synthetase, cytoplasmic OS=Homo sapiens GN=YARS... Transforming growth factor beta-1-induced transcript 1 prote... Vinculin OS=Homo sapiens GN=VCL PE=1 SV=4 Aspartyl/asparaginyl beta-hydroxylase OS=Homo sapiens GN=ASP... Calcium-regulated heat stable protein 1 OS=Homo sapiens GN=C... Cytosolic acyl coenzyme A thioester hydrolase OS=Homo sapien... Heat shock 70 kDa protein 4 OS=Homo sapiens GN=HSPA4 PE=1 SV... Gap junction alpha-1 protein OS=Homo sapiens GN=GJA1 PE=1 SV... Eukaryotic translation initiation factor 3 subunit E OS=Homo... Calponin-2 OS=Homo sapiens GN=CNN2 PE=1 SV=4 ATP synthase subunit gamma, mitochondrial OS=Homo sapiens GN... 26S proteasome non-ATPase regulatory subunit 14 OS=Homo sapi... Far upstream element-binding protein 2 OS=Homo sapiens GN=KH... Glutathione S-transferase Mu 3 OS=Homo sapiens GN=GSTM3 PE=1... GMP synthase [glutamine-hydrolyzing] OS=Homo sapiens GN=GMPS... Caprin-1 OS=Homo sapiens GN=CAPRIN1 PE=1 SV=2 Serpin B3 OS=Homo sapiens GN=SERPINB3 PE=1 SV=2 Eukaryotic translation initiation factor 2 subunit 3 OS=Homo... Plastin-3 OS=Homo sapiens GN=PLS3 PE=1 SV=4 Mitogen-activated protein kinase 3 OS=Homo sapiens GN=MAPK3 ... Dynamin-2 OS=Homo sapiens GN=DNM2 PE=1 SV=2 Tight junction protein ZO-1 OS=Homo sapiens GN=TJP1 PE=1 SV=... Dolichyl-diphosphooligosaccharide--protein glycosyltransfera... Vitronectin OS=Homo sapiens GN=VTN PE=1 SV=1
26,445 50,067 35,559 23,906 28,843 23,826 23,826 23,799 28,457 15,484 48,869 48,869 48,869 48,801 19,914 26,804 15,35 28,08 28,006 48,137 27,932 25,272 27,786 47,705 22,9 47,491 22,826 14,95 47,175 30,633 19,961 27,216 22,488 22,464 46,677 20,334 18,217 46,554 22,206
24,033 0 14,39 25,799 20,751 25,712 25,712 25,683 20,473 33,42 0 0 0 0 28,655 21,695 33,13 20,202 20,149 0 20,096 22,728 19,991 0 24,714 0 24,634 32,267 0 16,529 26,927 19,581 24,269 24,243 0 26,333 28,397 0 23,964
739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756
ELKS/Rab6-interacting/CAST family member 1 OS=Homo sapiens G... Aminoacyl tRNA synthase complex-interacting multifunctional ... Eukaryotic peptide chain release factor GTP-binding subunit ... Serine/threonine-protein phosphatase 2A catalytic subunit al... Putative heat shock protein HSP 90-alpha A5 OS=Homo sapiens ... Dual specificity mitogen-activated protein kinase kinase 2 O... ATP-dependent RNA helicase DDX19A OS=Homo sapiens GN=DDX19A ... Cold shock domain-containing protein E1 OS=Homo sapiens GN=C... Rab-like protein 3 OS=Homo sapiens GN=RABL3 PE=1 SV=1 Eukaryotic translation initiation factor 3 subunit B OS=Homo... Calponin-3 OS=Homo sapiens GN=CNN3 PE=1 SV=1 Proteasome activator complex subunit 2 OS=Homo sapiens GN=PS... Proto-oncogene tyrosine-protein kinase Src OS=Homo sapiens G... Xaa-Pro dipeptidase OS=Homo sapiens GN=PEPD PE=1 SV=3 Ubiquitin carboxyl-terminal hydrolase 14 OS=Homo sapiens GN=... WASH complex subunit 7 OS=Homo sapiens GN=KIAA1033 PE=1 SV=1... Caspase-14 OS=Homo sapiens GN=CASP14 PE=1 SV=2 Pericentriolar material 1 protein OS=Homo sapiens GN=PCM1 PE...
22,192 22,113 18,836 45,801 0 26,536 29,607 31,036 44,976 26,079 21,508 44,411 22,979 28,707 28,649 21,114 43,861 19,229
23,95 23,864 27,104 0 45,728 19,091 15,976 14,354 0 18,763 23,211 0 21,256 15,49 15,459 22,786 0 24,524
757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795
Splicing factor, arginine/serine-rich 13A OS=Homo sapiens GN... Hexokinase-1 OS=Homo sapiens GN=HK1 PE=1 SV=3 Rho-related GTP-binding protein RhoE OS=Homo sapiens GN=RND3... Phenylalanyl-tRNA synthetase alpha chain OS=Homo sapiens GN=... Protein Mpv17 OS=Homo sapiens GN=MPV17 PE=1 SV=1 Vacuolar protein sorting-associated protein 16 homolog OS=Ho... Suprabasin OS=Homo sapiens GN=SBSN PE=2 SV=1 Protein transport protein Sec23A OS=Homo sapiens GN=SEC23A P... Septin-11 OS=Homo sapiens GN=SEPT11 PE=1 SV=3 Insulin-like growth factor-binding protein 5 OS=Homo sapiens... Keratin, type I cytoskeletal 23 OS=Homo sapiens GN=KRT23 PE=... Vacuolar protein sorting-associated protein 4B OS=Homo sapie... Importin subunit alpha-2 OS=Homo sapiens GN=KPNA2 PE=1 SV=1 Ribosome biogenesis protein BRX1 homolog OS=Homo sapiens GN=... Electron transfer flavoprotein subunit beta OS=Homo sapiens ... Oxysterol-binding protein-related protein 3 OS=Homo sapiens ... Oxysterol-binding protein-related protein 8 OS=Homo sapiens ... Thioredoxin domain-containing protein 12 OS=Homo sapiens GN=... ADP-ribosylation factor-like protein 8A OS=Homo sapiens GN=A... Eukaryotic translation initiation factor 5 OS=Homo sapiens G... Mitochondrial Rho GTPase 2 OS=Homo sapiens GN=RHOT2 PE=1 SV=... Myoferlin OS=Homo sapiens GN=MYOF PE=1 SV=1 Uncharacterized protein KIAA1462 OS=Homo sapiens GN=KIAA1462... Dolichyl-diphosphooligosaccharide--protein glycosyltransfera... Developmentally-regulated GTP-binding protein 2 OS=Homo sapi... Signal recognition particle receptor subunit alpha OS=Homo s... Tripartite motif-containing protein 56 OS=Homo sapiens GN=TR... Optineurin OS=Homo sapiens GN=OPTN PE=1 SV=1 RAF proto-oncogene serine/threonine-protein kinase OS=Homo s... Ribosomal protein S6 kinase alpha-3 OS=Homo sapiens GN=RPS6K... E3 ubiquitin-protein ligase DTX3L OS=Homo sapiens GN=DTX3L P... HLA class I histocompatibility antigen, B-73 alpha chain OS=... Survival motor neuron protein OS=Homo sapiens GN=SMN1 PE=1 S... TRIO and F-actin-binding protein OS=Homo sapiens GN=TRIOBP P... Inhibitor of nuclear factor kappa-B kinase subunit beta OS=H... Vacuolar protein sorting-associated protein 29 OS=Homo sapie... Endophilin-B1 OS=Homo sapiens GN=SH3GLB1 PE=1 SV=1 Serine/threonine-protein kinase MRCK beta OS=Homo sapiens GN... HLA class I histocompatibility antigen, Cw-7 alpha chain OS=...
0 27,008 43,501 20,894 0 29,519 42,973 27,75 24,742 0 41,921 15,937 20,065 20,046 41,625 19,944 19,899 41,141 0 41,045 28,625 24,034 18,224 12,85 19,44 22,182 9,372 0 21,84 23,906 28,687 38,987 0 17,952 18,72 38,88 38,774 18,611 38,668
43,721 16,655 0 22,549 43,389 13,653 0 14,974 17,801 42,113 0 25,799 21,654 21,633 0 21,523 21,475 0 41,057 0 12,357 16,674 22,477 27,736 20,979 17,954 30,344 39,705 17,677 15,479 10,32 0 38,962 20,988 20,202 0 0 20,084 0
796 797 798 799 800 801 802 803 804 805 806 807 808 809 810 811 812 813
Nck-associated protein 1 OS=Homo sapiens GN=NCKAP1 PE=1 SV=1... Serine palmitoyltransferase 1 OS=Homo sapiens GN=SPTLC1 PE=1... Protein kinase C alpha type OS=Homo sapiens GN=PRKCA PE=1 SV... NEDD9-interacting protein with calponin homology and LIM dom... Four and a half LIM domains protein 2 OS=Homo sapiens GN=FHL... Serine/threonine-protein kinase Nek9 OS=Homo sapiens GN=NEK9... Tyrosine-protein kinase JAK1 OS=Homo sapiens GN=JAK1 PE=1 SV... Raftlin OS=Homo sapiens GN=RFTN1 PE=1 SV=4 tRNA (cytosine-5-)-methyltransferase NSUN2 OS=Homo sapiens G... Fragile X mental retardation syndrome-related protein 2 OS=H... Voltage-dependent anion-selective channel protein 1 OS=Homo ... GTPase KRas OS=Homo sapiens GN=KRAS PE=1 SV=1 AP-2 complex subunit alpha-1 OS=Homo sapiens GN=AP2A1 PE=1 S... Major vault protein OS=Homo sapiens GN=MVP PE=1 SV=4 Gamma-interferon-inducible protein 16 OS=Homo sapiens GN=IFI... Heparin-binding growth factor 2 OS=Homo sapiens GN=FGF2 PE=1... Syntaxin-binding protein 3 OS=Homo sapiens GN=STXBP3 PE=1 SV... Inorganic pyrophosphatase OS=Homo sapiens GN=PPA1 PE=1 SV=2
25,093 22,44 21,06 16,58 38,044 14,456 24,528 24,485 27,677 26,286 37,506 37,44 21,728 15,848 22,536 36,855 23,906 36,728
13,54 16,145 17,046 21,471 0 23,401 13,235 13,212 9,956 11,347 0 0 15,633 21,379 14,592 0 12,9 0
814 815 816 817 818 819 820 821 822 823 824 825 826 827 828 829 830 831 832 833 834 835 836 837 838 839 840 841 842 843 844 845 846 847 848 849 850 851 852
AP-3 complex subunit sigma-1 OS=Homo sapiens GN=AP3S1 PE=1 S... Melanoma-associated antigen D2 OS=Homo sapiens GN=MAGED2 PE=... Casein kinase II subunit alpha OS=Homo sapiens GN=CSNK2A1 PE... Phospholipid hydroperoxide glutathione peroxidase, mitochond... Biliverdin reductase A OS=Homo sapiens GN=BLVRA PE=1 SV=2 Nucleolin OS=Homo sapiens GN=NCL PE=1 SV=3 Polyadenylate-binding protein 1-like 2 OS=Homo sapiens GN=PA... 3,2-trans-enoyl-CoA isomerase, mitochondrial OS=Homo sapiens... Crk-like protein OS=Homo sapiens GN=CRKL PE=1 SV=1 Protein RCC2 OS=Homo sapiens GN=RCC2 PE=1 SV=2 Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase ... Ras-related protein Rab-7L1 OS=Homo sapiens GN=RAB7L1 PE=1 S... SAM domain and HD domain-containing protein 1 OS=Homo sapien... Aryl hydrocarbon receptor OS=Homo sapiens GN=AHR PE=1 SV=2 RNA-binding protein Raly OS=Homo sapiens GN=RALY PE=1 SV=1 UV excision repair protein RAD23 homolog B OS=Homo sapiens G... AP-2 complex subunit beta OS=Homo sapiens GN=AP2B1 PE=1 SV=1... Rho-related GTP-binding protein RhoQ OS=Homo sapiens GN=RHOQ... Fatty acid desaturase 1 OS=Homo sapiens GN=FADS1 PE=1 SV=1 Rab GDP dissociation inhibitor beta OS=Homo sapiens GN=GDI2 ... 28S ribosomal protein S5, mitochondrial OS=Homo sapiens GN=M... Tumor necrosis factor alpha-induced protein 2 OS=Homo sapien... Casein kinase I isoform delta OS=Homo sapiens GN=CSNK1D PE=1... Zymogen granule protein 16 homolog B OS=Homo sapiens GN=ZG16... Probable glutathione peroxidase 8 OS=Homo sapiens GN=GPX8 PE... Tyrosine-protein phosphatase non-receptor type 1 OS=Homo sap... Histone H1.5 OS=Homo sapiens GN=HIST1H1B PE=1 SV=3 Lon protease homolog, mitochondrial OS=Homo sapiens GN=LONP1... LIM domain and actin-binding protein 1 OS=Homo sapiens GN=LI... Glycogen synthase kinase-3 beta OS=Homo sapiens GN=GSK3B PE=... La-related protein 1 OS=Homo sapiens GN=LARP1 PE=1 SV=2 Phosphatidylinositol-binding clathrin assembly protein OS=Ho... Interferon-induced GTP-binding protein Mx1 OS=Homo sapiens G... CDP-diacylglycerol--inositol 3-phosphatidyltransferase OS=Ho... Golgin subfamily A member 2 OS=Homo sapiens GN=GOLGA2 PE=1 S... Acetyl-CoA acetyltransferase, mitochondrial OS=Homo sapiens ... Acetyl-CoA carboxylase 2 OS=Homo sapiens GN=ACACB PE=1 SV=2 Prolyl 4-hydroxylase subunit alpha-2 OS=Homo sapiens GN=P4HA... Osteoclast-stimulating factor 1 OS=Homo sapiens GN=OSTF1 PE=...
36,664 17,515 36,195 35,92 35,859 24,916 35,381 35,147 35,031 20,334 22,68 34,858 22,608 16,689 34,687 34,602 26,432 34,518 0 0 16,456 10,82 34,102 34,02 33,857 16,267 0 25,825 18,646 33,696 16,141 21,706 16,034 33,222 14,124 33,144 33,107 33,066 33,066
0 18,902 0 0 0 10,756 0 0 0 14,629 12,238 0 12,199 18,011 0 0 8,15 0 34,399 34,321 17,759 23,353 0 0 0 17,555 33,79 7,963 15,092 0 17,419 11,712 17,303 0 19,053 0 0 0 0
853 854 855 856 857 858 859 860 861 862 863 864 865 866 867 868 869 870
Arginase-1 OS=Homo sapiens GN=ARG1 PE=1 SV=2 Nascent polypeptide-associated complex subunit alpha OS=Homo... Alpha-aminoadipic semialdehyde dehydrogenase OS=Homo sapiens... Thyroid receptor-interacting protein 13 OS=Homo sapiens GN=T... Schlafen family member 5 OS=Homo sapiens GN=SLFN5 PE=1 SV=1 Pleckstrin homology-like domain family B member 1 OS=Homo sa... Translation initiation factor eIF-2B subunit gamma OS=Homo s... Catenin alpha-1 OS=Homo sapiens GN=CTNNA1 PE=1 SV=1 Mitotic checkpoint protein BUB3 OS=Homo sapiens GN=BUB3 PE=1... Bleomycin hydrolase OS=Homo sapiens GN=BLMH PE=1 SV=1 Desmocollin-1 OS=Homo sapiens GN=DSC1 PE=1 SV=2 TRAF2 and NCK-interacting protein kinase OS=Homo sapiens GN=... Antigen peptide transporter 1 OS=Homo sapiens GN=TAP1 PE=1 S... KH domain-containing, RNA-binding, signal transduction-assoc... Transmembrane glycoprotein NMB OS=Homo sapiens GN=GPNMB PE=1... PDZ domain-containing protein GIPC1 OS=Homo sapiens GN=GIPC1... C-terminal-binding protein 2 OS=Homo sapiens GN=CTBP2 PE=1 S... Eukaryotic translation initiation factor 3 subunit A OS=Homo...
32,964 32,912 32,821 32,76 19,855 7,708 15,655 15,621 32,361 15,552 23,746 18,211 13,136 31,947 18,556 31,875 31,803 17,921
0 0 0 0 12,856 24,956 16,895 16,858 0 16,784 8,542 14,038 18,902 0 13,351 0 0 13,814
871 872 873 874 875 876 877 878 879 880 881 882 883 884 885 886 887 888 889 890 891 892 893 894 895 896 897 898 899 900 901 902 903 904 905 906 907 908 909
YTH domain family protein 2 OS=Homo sapiens GN=YTHDF2 PE=1 S... Enhancer of mRNA-decapping protein 4 OS=Homo sapiens GN=EDC4... Elongation factor 1-beta OS=Homo sapiens GN=EEF1B2 PE=1 SV=3... ATP-dependent RNA helicase A OS=Homo sapiens GN=DHX9 PE=1 SV... Tryptophanyl-tRNA synthetase, cytoplasmic OS=Homo sapiens GN... Serine racemase OS=Homo sapiens GN=SRR PE=1 SV=1 DNA repair protein RAD50 OS=Homo sapiens GN=RAD50 PE=1 SV=1 Uveal autoantigen with coiled-coil domains and ankyrin repea... DNA mismatch repair protein Msh2 OS=Homo sapiens GN=MSH2 PE=... Interferon-induced GTP-binding protein Mx2 OS=Homo sapiens G... Ubiquitin carboxyl-terminal hydrolase isozyme L3 OS=Homo sap... Next to BRCA1 gene 1 protein OS=Homo sapiens GN=NBR1 PE=1 SV... PDZ and LIM domain protein 5 OS=Homo sapiens GN=PDLIM5 PE=1 ... Alpha-internexin OS=Homo sapiens GN=INA PE=1 SV=2 ATPase ASNA1 OS=Homo sapiens GN=ASNA1 PE=1 SV=2 Nuclear protein localization protein 4 homolog OS=Homo sapie... Twinfilin-2 OS=Homo sapiens GN=TWF2 PE=1 SV=2 Long-chain-fatty-acid--CoA ligase 1 OS=Homo sapiens GN=ACSL1... Spectrin alpha chain, brain OS=Homo sapiens GN=SPTAN1 PE=1 S... Casein kinase II subunit alpha' OS=Homo sapiens GN=CSNK2A2 P... Proteasome subunit alpha type-2 OS=Homo sapiens GN=PSMA2 PE=... Ezrin OS=Homo sapiens GN=EZR PE=1 SV=4 Serine/threonine-protein kinase 3 OS=Homo sapiens GN=STK3 PE... Glycogen phosphorylase, liver form OS=Homo sapiens GN=PYGL P... Trifunctional enzyme subunit beta, mitochondrial OS=Homo sap... Aflatoxin B1 aldehyde reductase member 2 OS=Homo sapiens GN=... Rho guanine nucleotide exchange factor 2 OS=Homo sapiens GN=... Small nuclear ribonucleoprotein-associated proteins B and B'... SEC23-interacting protein OS=Homo sapiens GN=SEC23IP PE=1 SV... ATP-binding cassette sub-family D member 1 OS=Homo sapiens G... HLA class I histocompatibility antigen, A-3 alpha chain OS=H... LIM and cysteine-rich domains protein 1 OS=Homo sapiens GN=L... Eukaryotic translation initiation factor 6 OS=Homo sapiens G... Tyrosine-protein kinase Lyn OS=Homo sapiens GN=LYN PE=1 SV=3... Transferrin receptor protein 1 OS=Homo sapiens GN=TFRC PE=1 ... DnaJ homolog subfamily C member 7 OS=Homo sapiens GN=DNAJC7 ... Cullin-4B OS=Homo sapiens GN=CUL4B PE=1 SV=3 Splicing factor, arginine/serine-rich 1 OS=Homo sapiens GN=S... Microtubule-associated protein RP/EB family member 1 OS=Homo...
18,332 15,152 31,45 22,287 15,024 31,218 10,787 17,491 22,729 14,845 30,766 10,988 17,809 0 30,501 11,638 30,413 30,413 7,156 30,327 30,24 30,189 14,412 20,886 29,857 29,566 17,942 29,484 14,152 18,996 29,08 29,08 28,882 13,821 18,622 28,649 15,813 28,533 0
13,189 16,352 0 9,02 16,213 0 20,372 13,483 8,176 16,021 0 19,763 12,813 30,607 0 18,84 0 0 23,169 0 0 0 15,553 9,016 0 0 11,617 0 15,273 10,25 0 0 0 14,915 10,048 0 12,799 0 28,494
910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927
Protein disulfide-isomerase A5 OS=Homo sapiens GN=PDIA5 PE=1... Galectin-3 OS=Homo sapiens GN=LGALS3 PE=1 SV=5 Hyccin OS=Homo sapiens GN=FAM126A PE=1 SV=2 COP9 signalosome complex subunit 4 OS=Homo sapiens GN=COPS4 ... Derlin-1 OS=Homo sapiens GN=DERL1 PE=1 SV=1 Guanine nucleotide-binding protein subunit alpha-13 OS=Homo ... Splicing factor, arginine/serine-rich 5 OS=Homo sapiens GN=S... Tumor protein p63-regulated gene 1-like protein OS=Homo sapi... Protein numb homolog OS=Homo sapiens GN=NUMB PE=1 SV=2 WASH complex subunit strumpellin OS=Homo sapiens GN=KIAA0196... Tubulin-specific chaperone E OS=Homo sapiens GN=TBCE PE=1 SV... Tyrosine-protein kinase-like 7 OS=Homo sapiens GN=PTK7 PE=1 ... Putative adenosylhomocysteinase 2 OS=Homo sapiens GN=AHCYL1 ... Delta-1-pyrroline-5-carboxylate synthase OS=Homo sapiens GN=... Synembryn-A OS=Homo sapiens GN=RIC8A PE=1 SV=2 Tensin-3 OS=Homo sapiens GN=TNS3 PE=1 SV=2 Nuclear receptor-binding protein OS=Homo sapiens GN=NRBP1 PE... 24-dehydrocholesterol reductase OS=Homo sapiens GN=DHCR24 PE...
13,634 28,305 13,582 0 28,192 28,155 0 0 16,305 21,369 13,427 9,92 13,351 13,351 13,351 17,14 13,227 27,427
14,714 0 14,657 28,214 0 0 28,075 28,075 11,73 6,589 14,491 17,842 14,409 14,409 14,409 10,57 14,274 0
928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966
Peroxisomal membrane protein 11B OS=Homo sapiens GN=PEX11B P... DNA replication licensing factor MCM3 OS=Homo sapiens GN=MCM... Sorting nexin-2 OS=Homo sapiens GN=SNX2 PE=1 SV=2 Cyclic AMP-responsive element-binding protein 3-like protein... Catenin beta-1 OS=Homo sapiens GN=CTNNB1 PE=1 SV=1 3-hydroxyacyl-CoA dehydrogenase type-2 OS=Homo sapiens GN=HS... Gamma-adducin OS=Homo sapiens GN=ADD3 PE=1 SV=1 Erythrocyte band 7 integral membrane protein OS=Homo sapiens... TBC1 domain family member 15 OS=Homo sapiens GN=TBC1D15 PE=1... Vacuolar protein sorting-associated protein 4A OS=Homo sapie... Probable fructose-2,6-bisphosphatase TIGAR OS=Homo sapiens G... Fermitin family homolog 2 OS=Homo sapiens GN=FERMT2 PE=1 SV=... Plasminogen activator inhibitor 1 RNA-binding protein OS=Hom... Peroxisomal acyl-coenzyme A oxidase 2 OS=Homo sapiens GN=ACO... Glutamate--cysteine ligase regulatory subunit OS=Homo sapien... Eukaryotic translation initiation factor 3 subunit D OS=Homo... Proline synthase co-transcribed bacterial homolog protein OS... Ras GTPase-activating protein 2 OS=Homo sapiens GN=RASA2 PE=... Calpain-1 catalytic subunit OS=Homo sapiens GN=CAPN1 PE=1 SV... Heat shock protein 105 kDa OS=Homo sapiens GN=HSPH1 PE=1 SV=... Nicotinamide mononucleotide adenylyltransferase 1 OS=Homo sa... Glycogen [starch] synthase, muscle OS=Homo sapiens GN=GYS1 P... Poly [ADP-ribose] polymerase 1 OS=Homo sapiens GN=PARP1 PE=1... Peflin OS=Homo sapiens GN=PEF1 PE=1 SV=1 Paxillin OS=Homo sapiens GN=PXN PE=1 SV=2 Dihydropyrimidinase-related protein 3 OS=Homo sapiens GN=DPY... N(G),N(G)-dimethylarginine dimethylaminohydrolase 2 OS=Homo ... Hypoxia up-regulated protein 1 OS=Homo sapiens GN=HYOU1 PE=1... Fibulin-2 OS=Homo sapiens GN=FBLN2 PE=1 SV=2 MMS19 nucleotide excision repair protein homolog OS=Homo sap... Transformer-2 protein homolog beta OS=Homo sapiens GN=TRA2B ... Nuclear factor NF-kappa-B p100 subunit OS=Homo sapiens GN=NF... Kin of IRRE-like protein 1 OS=Homo sapiens GN=KIRREL PE=1 SV... Endoplasmic reticulum-Golgi intermediate compartment protein... [Pyruvate dehydrogenase [lipoamide]] kinase isozyme 1, mitoc... Leucine-rich repeat-containing protein 47 OS=Homo sapiens GN... Malectin OS=Homo sapiens GN=MLEC PE=1 SV=1 Lipoma-preferred partner OS=Homo sapiens GN=LPP PE=1 SV=1 DNA mismatch repair protein Msh6 OS=Homo sapiens GN=MSH6 PE=...
27,321 13,136 27,269 27,216 27,181 27,112 0 0 15,361 0 26,208 26,015 26,015 25,977 25,825 25,825 25,732 16,669 14,866 16,495 25,363 9,601 17,446 24,916 11,973 24,829 24,829 24,791 14,941 17,175 24,57 11,794 9,348 24,401 24,345 24,275 24,234 11,562 15,609
0 14,177 0 0 0 0 27,041 26,516 11,051 26,212 0 0 0 0 0 0 0 8,995 10,695 8,9 0 15,542 7,531 0 12,921 0 0 0 9,675 7,414 0 12,728 15,132 0 0 0 0 12,478 8,423
967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984
Puromycin-sensitive aminopeptidase OS=Homo sapiens GN=NPEPPS... Exocyst complex component 2 OS=Homo sapiens GN=EXOC2 PE=1 SV... Band 4.1-like protein 3 OS=Homo sapiens GN=EPB41L3 PE=1 SV=2... Zinc-alpha-2-glycoprotein OS=Homo sapiens GN=AZGP1 PE=1 SV=2... Desmocollin-3 OS=Homo sapiens GN=DSC3 PE=1 SV=3 Xaa-Pro aminopeptidase 1 OS=Homo sapiens GN=XPNPEP1 PE=1 SV=... LanC-like protein 2 OS=Homo sapiens GN=LANCL2 PE=1 SV=1 Zinc finger CCCH-type antiviral protein 1-like OS=Homo sapie... E3 ubiquitin-protein ligase NEDD4-like OS=Homo sapiens GN=NE... Alcohol dehydrogenase [NADP+] OS=Homo sapiens GN=AKR1A1 PE=1... Hepatocyte growth factor-regulated tyrosine kinase substrate... Armadillo repeat-containing X-linked protein 1 OS=Homo sapie... Serine/threonine-protein kinase Nek7 OS=Homo sapiens GN=NEK7... Coproporphyrinogen-III oxidase, mitochondrial OS=Homo sapien... Cell division protein kinase 4 OS=Homo sapiens GN=CDK4 PE=1 ... Mitochondrial carrier homolog 2 OS=Homo sapiens GN=MTCH2 PE=... Nucleolar RNA helicase 2 OS=Homo sapiens GN=DDX21 PE=1 SV=5 Tetratricopeptide repeat protein 37 OS=Homo sapiens GN=TTC37...
11,55 11,487 9,765 23,746 23,693 11,358 23,587 23,587 0 0 13,661 23,431 23,431 23,379 23,354 23,354 13,556 15,835
12,464 12,397 14,051 0 0 12,258 0 0 23,497 23,497 9,828 0 0 0 0 0 9,753 7,324
985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000 1001 1002 1003 1004 1005 1006 1007 1008 1009 1010 1011 1012 1013 1014 1015 1016 1017 1018 1019 1020 1021 1022 1023
TNFAIP3-interacting protein 1 OS=Homo sapiens GN=TNIP1 PE=1 ... Structural maintenance of chromosomes protein 4 OS=Homo sapi... Phosphoenolpyruvate carboxykinase [GTP], mitochondrial OS=Ho... Maspardin OS=Homo sapiens GN=SPG21 PE=1 SV=1 Signal transducer and activator of transcription 3 OS=Homo s... General vesicular transport factor p115 OS=Homo sapiens GN=U... Sorting nexin-8 OS=Homo sapiens GN=SNX8 PE=1 SV=1 Syntaxin-18 OS=Homo sapiens GN=STX18 PE=1 SV=1 Autophagy-related protein 3 OS=Homo sapiens GN=ATG3 PE=1 SV=... Mitochondrial 2-oxoglutarate/malate carrier protein OS=Homo ... Calcineurin-like phosphoesterase domain-containing protein 1... Lysophospholipid acyltransferase 7 OS=Homo sapiens GN=MBOAT7... Actin-binding LIM protein 3 OS=Homo sapiens GN=ABLIM3 PE=1 S... Carbonic anhydrase 5B, mitochondrial OS=Homo sapiens GN=CA5B... WD repeat-containing protein 26 OS=Homo sapiens GN=WDR26 PE=... DNA-(apurinic or apyrimidinic site) lyase OS=Homo sapiens GN... Annexin A4 OS=Homo sapiens GN=ANXA4 PE=1 SV=4 ATP-dependent RNA helicase DDX19B OS=Homo sapiens GN=DDX19B ... Uridine 5'-monophosphate synthase OS=Homo sapiens GN=UMPS PE... Eukaryotic translation initiation factor 3 subunit G OS=Homo... Spartin OS=Homo sapiens GN=SPG20 PE=1 SV=1 RNA-binding protein 14 OS=Homo sapiens GN=RBM14 PE=1 SV=2 6-phosphogluconate dehydrogenase, decarboxylating OS=Homo sa... Tubulin--tyrosine ligase-like protein 12 OS=Homo sapiens GN=... UDP-N-acetylhexosamine pyrophosphorylase OS=Homo sapiens GN=... Four and a half LIM domains protein 1 OS=Homo sapiens GN=FHL... Fatty aldehyde dehydrogenase OS=Homo sapiens GN=ALDH3A2 PE=1... G-protein-signaling modulator 1 OS=Homo sapiens GN=GPSM1 PE=… Dehydrogenase/reductase SDR family member 7B OS=Homo sapiens... Eukaryotic translation initiation factor 3 subunit I OS=Homo... Monofunctional C1-tetrahydrofolate synthase, mitochondrial O... Protein phosphatase 1 regulatory subunit 12A OS=Homo sapiens... Plakophilin-4 OS=Homo sapiens GN=PKP4 PE=1 SV=1 Decorin OS=Homo sapiens GN=DCN PE=1 SV=1 Recombining binding protein suppressor of hairless OS=Homo s... DNA replication licensing factor MCM4 OS=Homo sapiens GN=MCM... Magnesium transporter protein 1 OS=Homo sapiens GN=MAGT1 PE=... Mesoderm-specific transcript homolog protein OS=Homo sapiens... 2,4-dienoyl-CoA reductase, mitochondrial OS=Homo sapiens GN=...
11,126 8,241 11,057 22,975 22,975 11,034 22,826 0 22,536 22,536 22,536 22,488 0 22,322 10,705 22,252 22,182 22,159 22,113 22,113 10,625 10,577 21,976 21,976 0 21,908 21,885 10,483 21,773 21,773 21,706 10,305 8,765 0 21,229 12,299 21,123 21,123 21,123
12,007 14,822 11,932 0 0 11,907 0 22,796 0 0 0 0 22,362 0 11,553 0 0 0 0 0 11,466 11,415 0 0 21,944 0 0 11,313 0 0 0 11,121 12,612 21,272 0 8,849 0 0 0
1024 1025 1026 1027 1028 1029 1030 1031 1032 1033 1034 1035 1036 1037 1038 1039 1040 1041
Glutaredoxin-3 OS=Homo sapiens GN=GLRX3 PE=1 SV=2 Cell division cycle protein 123 homolog OS=Homo sapiens GN=C... Vacuolar protein sorting-associated protein 26B OS=Homo sapi... Serine hydroxymethyltransferase, mitochondrial OS=Homo sapie... FK506-binding protein 15 OS=Homo sapiens GN=FKBP15 PE=1 SV=2... Apolipoprotein L2 OS=Homo sapiens GN=APOL2 PE=1 SV=1 Casein kinase I isoform alpha OS=Homo sapiens GN=CSNK1A1 PE=... Eukaryotic translation initiation factor 5B OS=Homo sapiens ... Alpha-taxilin OS=Homo sapiens GN=TXLNA PE=1 SV=3 Malate dehydrogenase, mitochondrial OS=Homo sapiens GN=MDH2 ... Activator of 90 kDa heat shock protein ATPase homolog 1 OS=H... Erlin-2 OS=Homo sapiens GN=ERLIN2 PE=1 SV=1 Dehydrogenase/reductase SDR family member 7 OS=Homo sapiens ... Guanine nucleotide-binding protein-like 3 OS=Homo sapiens GN... Lipase maturation factor 2 OS=Homo sapiens GN=LMF2 PE=1 SV=2... Double-stranded RNA-specific adenosine deaminase OS=Homo sap... Transmembrane protein C2orf18 OS=Homo sapiens GN=C2orf18 PE=... Aldehyde dehydrogenase X, mitochondrial OS=Homo sapiens GN=A...
21,123 21,06 21,06 21,06 11,61 20,998 20,998 11,6 0 20,935 20,935 20,874 20,874 0 10,009 14,429 0 20,531
0 0 0 0 9,397 0 0 9,389 20,979 0 0 0 0 20,865 10,801 6,229 20,584 0
1042 1043 1044 1045 1046 1047 1048 1049 1050 1051 1052 1053 1054 1055 1056 1057 1058 1059 1060 1061 1062 1063 1064 1065 1066 1067 1068 1069 1070 1071 1072 1073 1074 1075 1076 1077 1078 1079 1080
Aldehyde dehydrogenase, mitochondrial OS=Homo sapiens GN=ALD... SPATS2-like protein OS=Homo sapiens GN=SPATS2L PE=1 SV=2 Succinyl-CoA ligase [GDP-forming] subunit alpha, mitochondri... Protein-glutamine gamma-glutamyltransferase E OS=Homo sapien... Ig alpha-2 chain C region OS=Homo sapiens GN=IGHA2 PE=1 SV=3... Serine/threonine-protein phosphatase 2B catalytic subunit al... Nuclear mitotic apparatus protein 1 OS=Homo sapiens GN=NUMA1... UDP-glucose 4-epimerase OS=Homo sapiens GN=GALE PE=1 SV=2 Glutathione reductase, mitochondrial OS=Homo sapiens GN=GSR ... Transportin-1 OS=Homo sapiens GN=TNPO1 PE=1 SV=2 Protein transport protein Sec16A OS=Homo sapiens GN=SEC16A P... Protein scribble homolog OS=Homo sapiens GN=SCRIB PE=1 SV=4 Serine/threonine-protein kinase TBK1 OS=Homo sapiens GN=TBK1... RNA-binding protein FUS OS=Homo sapiens GN=FUS PE=1 SV=1 Leukocyte elastase inhibitor OS=Homo sapiens GN=SERPINB1 PE=... Catalase OS=Homo sapiens GN=CAT PE=1 SV=3 Kinesin-like protein KIF2A OS=Homo sapiens GN=KIF2A PE=1 SV=... SH3 and PX domain-containing protein 2B OS=Homo sapiens GN=S... Guanine nucleotide exchange factor for Rab-3A OS=Homo sapien... Replication factor C subunit 2 OS=Homo sapiens GN=RFC2 PE=1 ... Prolyl endopeptidase OS=Homo sapiens GN=PREP PE=1 SV=2 AP-3 complex subunit beta-1 OS=Homo sapiens GN=AP3B1 PE=1 SV... Eukaryotic translation initiation factor 3 subunit F OS=Homo... AP-2 complex subunit alpha-2 OS=Homo sapiens GN=AP2A2 PE=1 S... Elongation factor Tu GTP-binding domain-containing protein 1... Heterogeneous nuclear ribonucleoprotein U-like protein 2 OS=... Histone-arginine methyltransferase CARM1 OS=Homo sapiens GN=... Switch-associated protein 70 OS=Homo sapiens GN=SWAP70 PE=1 ... Threonyl-tRNA synthetase, cytoplasmic OS=Homo sapiens GN=TAR... Biotin--protein ligase OS=Homo sapiens GN=HLCS PE=1 SV=1 Rho guanine nucleotide exchange factor 1 OS=Homo sapiens GN=... Transcription factor p65 OS=Homo sapiens GN=RELA PE=1 SV=2 Endophilin-A2 OS=Homo sapiens GN=SH3GL1 PE=1 SV=1 Protein kinase C iota type OS=Homo sapiens GN=PRKCI PE=1 SV=... Serine/threonine-protein kinase DCLK1 OS=Homo sapiens GN=DCL... Phosphoserine aminotransferase OS=Homo sapiens GN=PSAT1 PE=1... Tyrosine-protein kinase SgK269 OS=Homo sapiens GN=SGK269 PE=... Alpha-parvin OS=Homo sapiens GN=PARVA PE=1 SV=1 Centromere/kinetochore protein zw10 homolog OS=Homo sapiens ...
20,531 0 20,451 20,422 20,422 20,373 16,729 20,334 20,334 11,82 9,742 10,853 9,707 20,179 0 20,141 20,046 11,651 0 19,989 19,933 12,936 19,821 7,536 9,477 9,473 0 0 19,575 19,494 19,397 19,264 19,229 0 19,125 19,125 8,106 19,022 9,084
0 20,528 0 0 0 0 3,611 0 0 8,504 10,514 9,37 10,475 0 20,149 0 0 8,383 19,991 0 0 6,98 0 12,199 10,227 10,223 19,581 19,581 0 0 0 0 0 19,219 0 0 10,934 0 9,803
1081 1082 1083 1084 1085 1086 1087 1088 1089 1090 1091 1092 1093 1094 1095 1096 1097 1098
Nucleolysin TIAR OS=Homo sapiens GN=TIAL1 PE=1 SV=1 Bifunctional coenzyme A synthase OS=Homo sapiens GN=COASY PE... Phosphatidylinositol-5-phosphate 4-kinase type-2 alpha OS=Ho... Ras and Rab interactor 1 OS=Homo sapiens GN=RIN1 PE=1 SV=4 Zinc-binding alcohol dehydrogenase domain-containing protein... Vacuolar protein sorting-associated protein 18 homolog OS=Ho... Dihydropyrimidinase-related protein 1 OS=Homo sapiens GN=CRM... Activating signal cointegrator 1 complex subunit 3 OS=Homo s... Rho guanine nucleotide exchange factor 7 OS=Homo sapiens GN=... Epidermal growth factor receptor OS=Homo sapiens GN=EGFR PE=... Fibronectin type III domain-containing protein 3B OS=Homo sa... Ran GTPase-activating protein 1 OS=Homo sapiens GN=RANGAP1 P... Neurofilament heavy polypeptide OS=Homo sapiens GN=NEFH PE=1... Putative RNA-binding protein Luc7-like 2 OS=Homo sapiens GN=... Galactokinase OS=Homo sapiens GN=GALK1 PE=1 SV=1 Transmembrane 9 superfamily member 3 OS=Homo sapiens GN=TM9S... Dual specificity mitogen-activated protein kinase kinase 1 O... Protein NDRG1 OS=Homo sapiens GN=NDRG1 PE=1 SV=1
18,87 18,82 0 9,037 18,77 10,909 18,556 8,034 8,812 8,772 11,754 18,082 6,897 18,051 18,051 18,021 18,006 17,96
0 0 18,809 9,753 0 7,848 0 10,404 9,51 9,467 6,343 0 11,164 0 0 0 0 0
1099 1100 1101 1102 1103 1104 1105 1106 1107 1108 1109 1110 1111 1112 1113 1114 1115 1116 1117 1118 1119 1120 1121 1122 1123 1124 1125 1126 1127 1128 1129 1130 1131 1132 1133 1134 1135 1136 1137
Peroxisomal 3,2-trans-enoyl-CoA isomerase OS=Homo sapiens GN... Obg-like ATPase 1 OS=Homo sapiens GN=OLA1 PE=1 SV=2 Probable ATP-dependent RNA helicase DDX20 OS=Homo sapiens GN... Merlin OS=Homo sapiens GN=NF2 PE=1 SV=1 Long-chain fatty acid transport protein 1 OS=Homo sapiens GN... Helicase SKI2W OS=Homo sapiens GN=SKIV2L PE=1 SV=2 N-alpha-acetyltransferase 15, NatA auxiliary subunit OS=Homo... cAMP-dependent protein kinase type II-alpha regulatory subun... Eukaryotic peptide chain release factor subunit 1 OS=Homo sa... DAZ-associated protein 1 OS=Homo sapiens GN=DAZAP1 PE=1 SV=1... UBX domain-containing protein 6 OS=Homo sapiens GN=UBXN6 PE=... WD repeat and FYVE domain-containing protein 1 OS=Homo sapie... Ataxin-2-like protein OS=Homo sapiens GN=ATXN2L PE=1 SV=2 DnaJ homolog subfamily A member 2 OS=Homo sapiens GN=DNAJA2 ... Ataxin-2 OS=Homo sapiens GN=ATXN2 PE=1 SV=2 Adipocyte plasma membrane-associated protein OS=Homo sapiens... Nexilin OS=Homo sapiens GN=NEXN PE=1 SV=1 Poly [ADP-ribose] polymerase 14 OS=Homo sapiens GN=PARP14 PE... Basic leucine zipper and W2 domain-containing protein 2 OS=H... NF-kappa-B essential modulator OS=Homo sapiens GN=IKBKG PE=1... Mannose-1-phosphate guanyltransferase alpha OS=Homo sapiens ... Serine/threonine-protein kinase MRCK alpha OS=Homo sapiens G... Protein phosphatase 1F OS=Homo sapiens GN=PPM1F PE=1 SV=3 Medium-chain specific acyl-CoA dehydrogenase, mitochondrial ... Filaggrin OS=Homo sapiens GN=FLG PE=1 SV=3 ATPase family AAA domain-containing protein 3A OS=Homo sapie... Supervillin OS=Homo sapiens GN=SVIL PE=1 SV=2 Torsin family protein C9orf167 OS=Homo sapiens GN=C9orf167 P... 182 kDa tankyrase-1-binding protein OS=Homo sapiens GN=TNKS1... Serine/threonine-protein kinase 25 OS=Homo sapiens GN=STK25 ... Microtubule-associated protein 1B OS=Homo sapiens GN=MAP1B P... Succinyl-CoA ligase [GDP-forming] subunit beta, mitochondria... Gamma-enolase OS=Homo sapiens GN=ENO2 PE=1 SV=3 Very long-chain specific acyl-CoA dehydrogenase, mitochondri... Acyl-coenzyme A thioesterase 9, mitochondrial OS=Homo sapien... Zinc finger protein 254 OS=Homo sapiens GN=ZNF254 PE=1 SV=3 Solute carrier family 12 member 9 OS=Homo sapiens GN=SLC12A9... UPF0364 protein C6orf211 OS=Homo sapiens GN=C6orf211 PE=1 SV... Thyroid receptor-interacting protein 6 OS=Homo sapiens GN=TR...
17,96 17,869 8,588 17,839 0 8,519 0 17,515 0 17,386 0 17,259 6,582 17,175 5,389 17,01 0 10,285 16,888 16,888 16,848 10,214 0 16,808 13,94 16,742 6,392 16,729 12,278 16,611 5,734 16,38 16,305 16,205 16,119 16,107 7,742 16,046 0
0 0 9,268 0 17,732 9,193 17,636 0 17,475 0 17,316 0 10,656 0 11,632 0 16,97 6,66 0 0 0 6,614 16,821 0 2,821 0 10,348 0 4,417 0 10,83 0 0 0 0 0 8,355 0 16,043
1138 1139 1140 1141 1142 1143 1144 1145 1146 1147 1148 1149 1150 1151 1152 1153 1154 1155
Centrosomal protein of 170 kDa OS=Homo sapiens GN=CEP170 PE=... Serine/threonine-protein kinase 24 OS=Homo sapiens GN=STK24 ... Probable ubiquitin carboxyl-terminal hydrolase FAF-X OS=Homo... Alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminylt... Interferon-induced protein with tetratricopeptide repeats 5 ... BAG family molecular chaperone regulator 5 OS=Homo sapiens G... AP-3 complex subunit delta-1 OS=Homo sapiens GN=AP3D1 PE=1 S... Septin-8 OS=Homo sapiens GN=SEPT8 PE=1 SV=4 Nuclear factor NF-kappa-B p105 subunit OS=Homo sapiens GN=NF... Calcium-binding mitochondrial carrier protein Aralar2 OS=Hom... Acyl-coenzyme A thioesterase 2, mitochondrial OS=Homo sapien... Vacuolar protein sorting-associated protein 11 homolog OS=Ho... Eukaryotic translation initiation factor 4 gamma 2 OS=Homo s... RuvB-like 2 OS=Homo sapiens GN=RUVBL2 PE=1 SV=3 Chitobiosyldiphosphodolichol beta-mannosyltransferase OS=Hom... Spermatogenesis-associated protein 5-like protein 1 OS=Homo ... Polycystin-2 OS=Homo sapiens GN=PKD2 PE=1 SV=3 Enhancer of mRNA-decapping protein 3 OS=Homo sapiens GN=EDC3...
11,168 15,973 6,946 15,902 0 15,83 9,206 0 0 15,725 15,655 7,52 15,603 15,283 15,25 0 7,31 0
4,821 0 8,995 0 15,843 0 6,623 15,811 15,778 0 0 8,115 0 0 0 15,212 7,889 15,033
1156 1157 1158 1159 1160 1161 1162 1163 1164 1165 1166 1167 1168 1169 1170 1171 1172 1173 1174 1175 1176 1177 1178 1179 1180 1181 1182 1183 1184 1185 1186 1187 1188 1189 1190 1191 1192 1193 1194
Double-strand break repair protein MRE11A OS=Homo sapiens GN... ATP-binding cassette sub-family F member 3 OS=Homo sapiens G... Phosphatidylserine synthase 1 OS=Homo sapiens GN=PTDSS1 PE=1... 7-dehydrocholesterol reductase OS=Homo sapiens GN=DHCR7 PE=1... Protein transport protein Sec61 subunit alpha isoform 1 OS=H... Interferon-induced protein with tetratricopeptide repeats 1 ... Protein Hook homolog 3 OS=Homo sapiens GN=HOOK3 PE=1 SV=2 Structural maintenance of chromosomes protein 2 OS=Homo sapi... Acyl-CoA dehydrogenase family member 11 OS=Homo sapiens GN=A... Probable ATP-dependent RNA helicase DDX6 OS=Homo sapiens GN=... Serine/threonine-protein kinase 4 OS=Homo sapiens GN=STK4 PE... Metalloreductase STEAP2 OS=Homo sapiens GN=STEAP2 PE=1 SV=2 Pleckstrin homology domain-containing family O member 2 OS=H... Cullin-associated NEDD8-dissociated protein 1 OS=Homo sapien... La-related protein 4B OS=Homo sapiens GN=LARP4B PE=1 SV=3 Solute carrier family 2, facilitated glucose transporter mem... Cytoplasmic dynein 1 light intermediate chain 2 OS=Homo sapi... General transcription factor II-I OS=Homo sapiens GN=GTF2I P... N-terminal kinase-like protein OS=Homo sapiens GN=SCYL1 PE=1... Neuroblast differentiation-associated protein AHNAK OS=Homo ... Solute carrier family 2, facilitated glucose transporter mem... Elongation factor G, mitochondrial OS=Homo sapiens GN=GFM1 P... Phosphoacetylglucosamine mutase OS=Homo sapiens GN=PGM3 PE=1... Stress-induced-phosphoprotein 1 OS=Homo sapiens GN=STIP1 PE=... 26S proteasome non-ATPase regulatory subunit 5 OS=Homo sapie... Cullin-4A OS=Homo sapiens GN=CUL4A PE=1 SV=3 25-hydroxycholesterol 7-alpha-hydroxylase OS=Homo sapiens GN... Abl interactor 1 OS=Homo sapiens GN=ABI1 PE=1 SV=4 A-kinase anchor protein 12 OS=Homo sapiens GN=AKAP12 PE=1 SV... RanBP-type and C3HC4-type zinc finger-containing protein 1 O... Dynactin subunit 1 OS=Homo sapiens GN=DCTN1 PE=1 SV=3 5'-AMP-activated protein kinase catalytic subunit alpha-2 OS... Rab11 family-interacting protein 2 OS=Homo sapiens GN=RAB11F... Heterochromatin protein 1-binding protein 3 OS=Homo sapiens ... PDZ domain-containing RING finger protein 3 OS=Homo sapiens ... Myosin-6 OS=Homo sapiens GN=MYH6 PE=1 SV=4 Myosin-1 OS=Homo sapiens GN=MYH1 PE=1 SV=3 Probable ATP-dependent RNA helicase DDX46 OS=Homo sapiens GN... Protein KIAA1199 OS=Homo sapiens GN=KIAA1199 PE=1 SV=2
14,992 14,971 14,96 14,897 14,866 14,804 14,783 14,779 0 14,65 14,53 14,441 14,441 14,382 14,382 14,382 14,382 14,181 0 9,611 0 14,134 0 0 14,04 13,985 13,985 13,929 13,898 13,875 13,842 0 13,821 0 6,638 0 0 13,727 5,199
0 0 0 0 0 0 0 0 14,686 0 0 0 0 0 0 0 0 0 14,177 4,538 14,142 0 14,09 14,064 0 0 0 0 0 0 0 13,834 0 13,809 7,164 13,784 13,784 0 8,416
1195 1196 1197 1198 1199 1200 1201 1202 1203 1204 1205 1206 1207 1208 1209 1210 1211 1212
Sorting nexin-1 OS=Homo sapiens GN=SNX1 PE=1 SV=3 Serine/threonine-protein phosphatase 6 regulatory ankyrin re... 2'-5'-oligoadenylate synthase 3 OS=Homo sapiens GN=OAS3 PE=1... Cytoplasmic dynein 1 light intermediate chain 1 OS=Homo sapi... Translation initiation factor eIF-2B subunit delta OS=Homo s... Arylsulfatase G OS=Homo sapiens GN=ARSG PE=1 SV=1 Tumor necrosis factor alpha-induced protein 3 OS=Homo sapien... Probable E3 ubiquitin-protein ligase HERC4 OS=Homo sapiens G... DnaJ homolog subfamily C member 10 OS=Homo sapiens GN=DNAJC1... E3 UFM1-protein ligase 1 OS=Homo sapiens GN=KIAA0776 PE=1 SV... YTH domain family protein 3 OS=Homo sapiens GN=YTHDF3 PE=1 S... Exportin-1 OS=Homo sapiens GN=XPO1 PE=1 SV=1 Dynamin-3 OS=Homo sapiens GN=DNM3 PE=1 SV=4 Coatomer subunit gamma-2 OS=Homo sapiens GN=COPG2 PE=1 SV=1 Peptidyl-prolyl cis-trans isomerase FKBP10 OS=Homo sapiens G... Liprin-beta-2 OS=Homo sapiens GN=PPFIBP2 PE=2 SV=2 Myosin-If OS=Homo sapiens GN=MYO1F PE=1 SV=3 Lysyl-tRNA synthetase OS=Homo sapiens GN=KARS PE=1 SV=3
13,556 6,516 6,51 13,53 13,53 13,478 13,436 13,389 13,385 13,368 0 13,214 0 0 0 0 12,889 0
0 7,032 7,025 0 0 0 0 0 0 0 13,351 0 13,182 13,151 13,121 13,076 0 12,791
1213 1214 1215 1216 1217 1218 1219 1220 1221 1222 1223 1224 1225 1226 1227 1228 1229 1230 1231 1232 1233 1234 1235 1236 1237 1238 1239 1240 1241 1242 1243 1244 1245 1246 1247 1248 1249 1250 1251
Rho-associated protein kinase 2 OS=Homo sapiens GN=ROCK2 PE=... Transcription intermediary factor 1-beta OS=Homo sapiens GN=... DnaJ homolog subfamily C member 11 OS=Homo sapiens GN=DNAJC1... Prostaglandin G/H synthase 2 OS=Homo sapiens GN=PTGS2 PE=1 S... Cytosolic purine 5'-nucleotidase OS=Homo sapiens GN=NT5C2 PE... Asparagine synthetase [glutamine-hydrolyzing] OS=Homo sapien... Eukaryotic translation initiation factor 3 subunit L OS=Homo... Signal transducer and activator of transcription 2 OS=Homo s... Vacuolar protein sorting-associated protein 41 homolog OS=Ho... Discoidin domain-containing receptor 2 OS=Homo sapiens GN=DD... CCR4-NOT transcription complex subunit 1 OS=Homo sapiens GN=... Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=2 60 kDa heat shock protein, mitochondrial OS=Homo sapiens GN=... Keratinocyte proline-rich protein OS=Homo sapiens GN=KPRP PE... Carnitine O-acetyltransferase OS=Homo sapiens GN=CRAT PE=1 S... Nuclear factor of activated T-cells, cytoplasmic 4 OS=Homo s... Rab11 family-interacting protein 5 OS=Homo sapiens GN=RAB11F... Serine/threonine-protein kinase A-Raf OS=Homo sapiens GN=ARA... Protein SOLO OS=Homo sapiens GN=SOLO PE=1 SV=2 Mitochondrial import receptor subunit TOM70 OS=Homo sapiens ... Peroxisomal acyl-coenzyme A oxidase 1 OS=Homo sapiens GN=ACO... 72 kDa type IV collagenase OS=Homo sapiens GN=MMP2 PE=1 SV=2... Extended synaptotagmin-2 OS=Homo sapiens GN=ESYT2 PE=1 SV=1 Probable 10-formyltetrahydrofolate dehydrogenase ALDH1L2 OS=... Disks large homolog 5 OS=Homo sapiens GN=DLG5 PE=1 SV=4 Kinesin light chain 4 OS=Homo sapiens GN=KLC4 PE=1 SV=3 DnaJ homolog subfamily C member 2 OS=Homo sapiens GN=DNAJC2 ... cGMP-dependent protein kinase 1 OS=Homo sapiens GN=PRKG1 PE=... Kelch-like ECH-associated protein 1 OS=Homo sapiens GN=KEAP1... Serine/threonine-protein kinase mTOR OS=Homo sapiens GN=FRAP... Dystrobrevin beta OS=Homo sapiens GN=DTNB PE=1 SV=1 Zinc finger protein 252 OS=Homo sapiens GN=ZNF252 PE=2 SV=2 Acetolactate synthase-like protein OS=Homo sapiens GN=ILVBL ... HBS1-like protein OS=Homo sapiens GN=HBS1L PE=1 SV=1 Nucleolar GTP-binding protein 1 OS=Homo sapiens GN=GTPBP4 PE... Bullous pemphigoid antigen 1 OS=Homo sapiens GN=DST PE=1 SV=... Exosome complex exonuclease RRP44 OS=Homo sapiens GN=DIS3 PE... Importin-7 OS=Homo sapiens GN=IPO7 PE=1 SV=1 Sec1 family domain-containing protein 1 OS=Homo sapiens GN=S...
12,745 12,712 12,659 0 12,614 12,614 12,546 12,473 12,429 12,414 5,956 7,201 12,349 12,221 0 11,767 0 11,677 11,646 11,638 0 0 11,525 11,5 5,531 11,432 11,395 0 11,34 8,328 11,286 0 11,196 0 11,161 5,609 11,08 0 11,022
0 0 0 12,643 0 0 0 0 0 0 6,428 5,181 0 0 12,199 0 11,695 0 0 0 11,57 11,57 0 0 5,969 0 0 11,381 0 2,996 0 11,197 0 11,164 0 5,548 0 11,035 0
1252 1253 1254 1255 1256 1257 1258 1259 1260 1261 1262 1263 1264 1265 1266 1267 1268 1269
Aminopeptidase N OS=Homo sapiens GN=ANPEP PE=1 SV=4 Endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-man... 116 kDa U5 small nuclear ribonucleoprotein component OS=Homo... Triple functional domain protein OS=Homo sapiens GN=TRIO PE=... E3 ubiquitin-protein ligase UBR4 OS=Homo sapiens GN=UBR4 PE=... Leucine zipper putative tumor suppressor 2 OS=Homo sapiens G... GTP-binding protein 1 OS=Homo sapiens GN=GTPBP1 PE=1 SV=3 Exocyst complex component 8 OS=Homo sapiens GN=EXOC8 PE=1 SV... MAGUK p55 subfamily member 5 OS=Homo sapiens GN=MPP5 PE=1 SV... Transcription factor 25 OS=Homo sapiens GN=TCF25 PE=1 SV=1 Actin filament-associated protein 1 OS=Homo sapiens GN=AFAP1... Antigen peptide transporter 2 OS=Homo sapiens GN=TAP2 PE=1 S... Myosin-Ia OS=Homo sapiens GN=MYO1A PE=1 SV=1 Rab3 GTPase-activating protein non-catalytic subunit OS=Homo... Leucine-rich PPR motif-containing protein, mitochondrial OS=... DNA mismatch repair protein Msh3 OS=Homo sapiens GN=MSH3 PE=... Autophagy-related protein 7 OS=Homo sapiens GN=ATG7 PE=1 SV=... Exocyst complex component 5 OS=Homo sapiens GN=EXOC5 PE=1 SV...
1270 1271 1272 1273 1274 1275 1276 1277 1278 1279 1280 1281 1282 1283 1284 1285 1286 1287 1288 1289 1290 1291 1292 1293 1294 1295 1296 1297 1298 1299 1300 1301 1302 1303 1304 1305 1306 1307 1308
Phospholipase DDHD2 OS=Homo sapiens GN=DDHD2 PE=1 SV=2 Cancer-associated gene 1 protein OS=Homo sapiens GN=CAGE1 PE... Ankyrin repeat and FYVE domain-containing protein 1 OS=Homo ... Alpha-catulin OS=Homo sapiens GN=CTNNAL1 PE=1 SV=2 Exocyst complex component 7 OS=Homo sapiens GN=EXOC7 PE=1 SV... Kinesin-like protein KIF1C OS=Homo sapiens GN=KIF1C PE=1 SV=... Prolyl 3-hydroxylase 1 OS=Homo sapiens GN=LEPRE1 PE=1 SV=2 Proteasome-associated protein ECM29 homolog OS=Homo sapiens ... Pleckstrin homology domain-containing family A member 5 OS=H... Kinesin-like protein KIF3B OS=Homo sapiens GN=KIF3B PE=1 SV=... Plakophilin-1 OS=Homo sapiens GN=PKP1 PE=1 SV=2 Protein IWS1 homolog OS=Homo sapiens GN=IWS1 PE=1 SV=2 ARF GTPase-activating protein GIT2 OS=Homo sapiens GN=GIT2 P... Tyrosine-protein kinase Fer OS=Homo sapiens GN=FER PE=1 SV=2... Rho guanine nucleotide exchange factor 6 OS=Homo sapiens GN=... Signal transducer and activator of transcription 6 OS=Homo s... Signal transducer and activator of transcription 5B OS=Homo ... Serine/threonine-protein kinase MARK2 OS=Homo sapiens GN=MAR... HEAT repeat-containing protein 7A OS=Homo sapiens GN=HEATR7A... RAD50-interacting protein 1 OS=Homo sapiens GN=RINT1 PE=1 SV... Phospholipase A-2-activating protein OS=Homo sapiens GN=PLAA... Putative ATP-dependent RNA helicase DHX30 OS=Homo sapiens GN... Probable cation-transporting ATPase 13A1 OS=Homo sapiens GN=... Pre-rRNA-processing protein TSR1 homolog OS=Homo sapiens GN=... H(+)/Cl(-) exchange transporter 7 OS=Homo sapiens GN=CLCN7 P... Protein-glutamine gamma-glutamyltransferase K OS=Homo sapien... Uncharacterized protein C10orf118 OS=Homo sapiens GN=C10orf1... Serine/threonine-protein kinase TAO3 OS=Homo sapiens GN=TAOK... Mitogen-activated protein kinase kinase kinase kinase 5 OS=H... Niemann-Pick C1 protein OS=Homo sapiens GN=NPC1 PE=1 SV=2 Pre-mRNA-splicing factor SYF1 OS=Homo sapiens GN=XAB2 PE=1 S... Probable E3 ubiquitin-protein ligase HECTD3 OS=Homo sapiens ... Serrate RNA effector molecule homolog OS=Homo sapiens GN=SRR... AMP deaminase 2 OS=Homo sapiens GN=AMPD2 PE=1 SV=2 Myb-binding protein 1A OS=Homo sapiens GN=MYBBP1A PE=1 SV=2 Vam6/Vps39-like protein OS=Homo sapiens GN=VPS39 PE=2 SV=2 ERC protein 2 OS=Homo sapiens GN=ERC2 PE=1 SV=3 Exocyst complex component 1 OS=Homo sapiens GN=EXOC1 PE=1 SV... Rho-associated protein kinase 1 OS=Homo sapiens GN=ROCK1 PE=...
10,977 0 10,92 5,712 5,461 10,577 10,577 0 10,483 10,468 0 10,315 10,177 10,16 10,152 0 10,066 9,995
0 10,925 0 4,932 5,157 0 0 10,533 0 0 10,461 0 0 0 0 10,075 0 0
9,952 0 0 9,641 9,627 9,623 9,614 9,588 9,511 9,473 9,473 0 9,323 0 9,119 0 8,991 8,98 4,312 8,935 8,901 8,89 8,816 8,801 8,79 8,661 0 0 8,364 8,305 8,276 8,219 8,078 8,05 7,993 7,987 0 7,915 7,839
0 9,828 9,799 0 0 0 0 0 0 0 0 9,324 0 9,29 0 9,016 0 0 4,654 0 0 0 0 0 0 0 8,504 8,504 0 0 0 0 0 0 0 0 7,98 0 0
1309 1310 1311 1312 1313 1314 1315 1316 1317 1318 1319 1320 1321 1322 1323 1324 1325 1326
Protein bicaudal C homolog 1 OS=Homo sapiens GN=BICC1 PE=1 S... DNA replication licensing factor MCM2 OS=Homo sapiens GN=MCM... Zinc finger protein 721 OS=Homo sapiens GN=ZNF721 PE=2 SV=2 Nuclear pore complex protein Nup155 OS=Homo sapiens GN=NUP15... Pre-mRNA-processing-splicing factor 8 OS=Homo sapiens GN=PRP... Oral-facial-digital syndrome 1 protein OS=Homo sapiens GN=OF... Pre-mRNA-processing factor 6 OS=Homo sapiens GN=PRPF6 PE=1 S... Protein LAP2 OS=Homo sapiens GN=ERBB2IP PE=1 SV=2 5'-3' exoribonuclease 2 OS=Homo sapiens GN=XRN2 PE=1 SV=1 Probable ATP-dependent RNA helicase YTHDC2 OS=Homo sapiens G... Exportin-T OS=Homo sapiens GN=XPOT PE=1 SV=2 SH3 domain-binding protein 4 OS=Homo sapiens GN=SH3BP4 PE=1 ... Importin-9 OS=Homo sapiens GN=IPO9 PE=1 SV=3 Arf-GAP with Rho-GAP domain, ANK repeat and PH domain-contai... Prolow-density lipoprotein receptor-related protein 1 OS=Hom... CAP-Gly domain-containing linker protein 2 OS=Homo sapiens G... Exocyst complex component 4 OS=Homo sapiens GN=EXOC4 PE=1 SV... Putative RNA-binding protein 15 OS=Homo sapiens GN=RBM15 PE=...
0 7,828 7,767 7,631 7,576 0 7,52 7,517 7,449 7,423 7,356 7,348 0 7,32 3,115 0 7,265 7,243
7,84 0 0 0 0 7,546 0 0 0 0 0 0 7,336 0 4,201 7,301 0 0
1327 1328 1329 1330 1331 1332 1333 1334 1335 1336 1337 1338 1339 1340 1341 1342 1343 1344 1345 1346 1347 1348 1349 1350 1351 1352 1353 1354 1355 1356 1357 1358 1359 1360 1361 1362 1363 1364 1365
Peroxisome assembly factor 2 OS=Homo sapiens GN=PEX6 PE=1 SV... DNA2-like helicase OS=Homo sapiens GN=DNA2 PE=1 SV=3 RING finger protein 31 OS=Homo sapiens GN=RNF31 PE=1 SV=1 Ubiquitin-associated protein 2-like OS=Homo sapiens GN=UBAP2... Cytospin-A OS=Homo sapiens GN=CYTSA PE=1 SV=1 Apoptosis-stimulating of p53 protein 2 OS=Homo sapiens GN=TP... Large proline-rich protein BAT3 OS=Homo sapiens GN=BAT3 PE=1... EMILIN-2 OS=Homo sapiens GN=EMILIN2 PE=1 SV=2 DNA damage-binding protein 1 OS=Homo sapiens GN=DDB1 PE=1 SV... Nuclear pore complex protein Nup133 OS=Homo sapiens GN=NUP13... Serologically defined colon cancer antigen 1 OS=Homo sapiens... Importin-4 OS=Homo sapiens GN=IPO4 PE=1 SV=2 NAD(P) transhydrogenase, mitochondrial OS=Homo sapiens GN=NN... TATA element modulatory factor OS=Homo sapiens GN=TMF1 PE=1 ... Leukemia inhibitory factor receptor OS=Homo sapiens GN=LIFR ... Ovostatin homolog 1 OS=Homo sapiens GN=OVOS1 PE=2 SV=2 Selenocysteine insertion sequence-binding protein 2-like OS=... Ubiquitin carboxyl-terminal hydrolase 7 OS=Homo sapiens GN=U... Partitioning defective 3 homolog B OS=Homo sapiens GN=PARD3B... Sodium bicarbonate cotransporter 3 OS=Homo sapiens GN=SLC4A7... EH domain-binding protein 1 OS=Homo sapiens GN=EHBP1 PE=1 SV... Chromosome-associated kinesin KIF4A OS=Homo sapiens GN=KIF4A... Microtubule-actin cross-linking factor 1, isoform 4 OS=Homo ... 1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase be... Tyrosine-protein phosphatase non-receptor type 13 OS=Homo sa... E3 ubiquitin-protein ligase HUWE1 OS=Homo sapiens GN=HUWE1 P... Pleckstrin homology-like domain family B member 2 OS=Homo sa... Leucine-rich repeat-containing protein 16B OS=Homo sapiens G... RING finger protein 213 OS=Homo sapiens GN=RNF213 PE=1 SV=2 UPF0493 protein KIAA1632 OS=Homo sapiens GN=KIAA1632 PE=2 SV... PERQ amino acid-rich with GYF domain-containing protein 2 OS... Tensin-like C1 domain-containing phosphatase OS=Homo sapiens... Aldehyde oxidase OS=Homo sapiens GN=AOX1 PE=2 SV=2 Multiple PDZ domain protein OS=Homo sapiens GN=MPDZ PE=1 SV=... Phosphatidylinositol 4-kinase alpha OS=Homo sapiens GN=PI4KA... Neuropathy target esterase OS=Homo sapiens GN=PNPLA6 PE=1 SV... Myosin-X OS=Homo sapiens GN=MYO10 PE=1 SV=3 Mitogen-activated protein kinase kinase kinase 1 OS=Homo sap... Cell division protein kinase 13 OS=Homo sapiens GN=CDK13 PE=...
7,221 0 0 0 0 0 0 6,72 0 0 6,576 6,546 6,516 6,474 6,45 0 6,427 6,421 0 0 0 0 2,979 5,971 2,848 2,427 5,647 0 3,236 5,488 5,447 0 5,289 5,198 5,193 5,18 5,158 0 0
0 7,204 7,124 7,025 6,837 6,77 6,746 0 6,699 6,606 0 0 0 0 0 6,444 0 0 6,337 6,29 6,204 6,198 3,215 0 3,073 3,492 0 5,566 2,328 0 0 5,42 0 0 0 0 0 5,051 5,051
1366 1367 1368 1369 1370 1371 1372 1373 1374 1375 1376 1377 1378 1379 1380 1381 1382 1383
Tenascin OS=Homo sapiens GN=TNC PE=1 SV=3 Centrosome-associated protein CEP250 OS=Homo sapiens GN=CEP2... UDP-glucose:glycoprotein glucosyltransferase 1 OS=Homo sapie... Golgin subfamily B member 1 OS=Homo sapiens GN=GOLGB1 PE=1 S... Ras GTPase-activating-like protein IQGAP2 OS=Homo sapiens GN... Neuroblastoma-amplified sequence OS=Homo sapiens GN=NBAS PE=... Nucleoporin NUP188 homolog OS=Homo sapiens GN=NUP188 PE=1 SV... Phosphatidylinositol-4-phosphate 3-kinase C2 domain-containi... Ankyrin repeat domain-containing protein 11 OS=Homo sapiens ... Sodium channel protein type 11 subunit alpha OS=Homo sapiens... Inositol 1,4,5-trisphosphate receptor type 1 OS=Homo sapiens... Rapamycin-insensitive companion of mTOR OS=Homo sapiens GN=R... Peripheral-type benzodiazepine receptor-associated protein 1... Microtubule-associated protein 1A OS=Homo sapiens GN=MAP1A P... Neuron navigator 1 OS=Homo sapiens GN=NAV1 PE=1 SV=2 A disintegrin and metalloproteinase with thrombospondin moti... Probable E3 ubiquitin-protein ligase MYCBP2 OS=Homo sapiens ... Retinoblastoma-binding protein 6 OS=Homo sapiens GN=RBBP6 PE...
4,822 0 4,551 2,171 4,493 4,477 0 4,331 0 0 0 4,143 0 0 0 0 1,525 3,949
0 4,691 0 2,343 0 0 4,366 0 4,301 4,264 4,153 0 4,112 4,084 4,068 3,998 2,469 0
1384 1385 1386 1387 1388 1389 1390 1391 1392 1393 1394 1395 1396 1397 1398 1399 1400 1401 1402 1403 1404 1405 1406 1407
Kinesin-like protein KIF13A OS=Homo sapiens GN=KIF13A PE=1 S... Thyroid receptor-interacting protein 11 OS=Homo sapiens GN=T... Rootletin OS=Homo sapiens GN=CROCC PE=1 SV=1 Matrix-remodeling-associated protein 5 OS=Homo sapiens GN=MX... Myosin-13 OS=Homo sapiens GN=MYH13 PE=1 SV=1 Myosin-3 OS=Homo sapiens GN=MYH3 PE=1 SV=3 Chromodomain-helicase-DNA-binding protein 4 OS=Homo sapiens ... Pecanex-like protein 2 OS=Homo sapiens GN=PCNXL2 PE=1 SV=3 Uncharacterized protein C2orf16 OS=Homo sapiens GN=C2orf16 P... Structural maintenance of chromosomes flexible hinge domain-... PHD finger protein 3 OS=Homo sapiens GN=PHF3 PE=1 SV=3 Dedicator of cytokinesis protein 11 OS=Homo sapiens GN=DOCK1... Adenomatous polyposis coli protein 2 OS=Homo sapiens GN=APC2... Myosin-VIIa OS=Homo sapiens GN=MYO7A PE=1 SV=1 Microtubule-actin cross-linking factor 1, isoforms 1/2/3/5 O... Epiplakin OS=Homo sapiens GN=EPPK1 PE=1 SV=1 Neurogenic locus notch homolog protein 1 OS=Homo sapiens GN=... Inositol 1,4,5-trisphosphate receptor type 2 OS=Homo sapiens... Kalirin OS=Homo sapiens GN=KALRN PE=1 SV=2 Fibrillin-1 OS=Homo sapiens GN=FBN1 PE=1 SV=2 Dystrophin OS=Homo sapiens GN=DMD PE=1 SV=2 Protein AHNAK2 OS=Homo sapiens GN=AHNAK2 PE=1 SV=2 G-protein coupled receptor 98 OS=Homo sapiens GN=GPR98 PE=1 ... Titin OS=Homo sapiens GN=TTN PE=1 SV=2
3,898 0 0 3,753 3,651 3,648 3,619 0 3,567 3,529 3,47 3,414 0 3,195 0 2,794 2,77 2,62 0 2,465 1,92 0 0 0,309
0 3,859 3,786 0 0 0 0 3,573 0 0 0 0 3,316 0 2,813 0 0 0 2,558 0 0 1,318 1,211 0,333