Picornaviruses: â Enterovirus/Hepatovirus/Parechovirus/Kobuvirus (5 genera with countless serotypes). â Cosaviruses-A/B/C/D/E. (5 species >33 genotypes).
NGS and virus discovery Eric Delwart Blood Systems Research Institute UCSF Laboratory Medicine Brute force in the clinic Keen to document exactly which microbes are there, many researchers are using brute-force 'metagenomic' studies in which they extract microbial DNA from the body cavity of choice and hurl it all into a sequencing machine.
The discovery curve for human virus species Woolhouse M E et al. Proc. R. Soc. B 2008;275:2111-2115
Rapid pace of viral discovery is providing many “orphan viruses” as candidate pathogens
Some common diseases may be associated with still unknown viruses • • • • • • • •
Gastroenteritis (~50% unexplained in the US) Respiratory illness (15-25% unexplained) Encephalitis (~60-80% unexplained in CA) Hepatitis Chronic fatigue syndrome Non-polio acute flaccid paralysis Auto-immune diseases (diabetes, MS, Kawasaki) Cancers
Relative size of viruses and bacteria
Virus Size 400 nm filters used to purify viral particles
Chlamydia
Pox virus
Herpes virus Bacterium (Staphyllococcus aureus)
Influenza Virus Picornavirus (polio)
Random RT-PCR amplification Filtration and nuclease enriched viral nucleic acids RNA
Reverse transcription 5’GTCCATGCATGACTCGAGTCNNNNNNNN3’ Signature tag Randomized 3’
Melt/annneal and extend cDNA with Klenow DNA polymerase 5’GTCCATGCATGACTCGAGTC3’ 30-40 PCR rounds
DNA
Sequence data generation and analysis
Sequencing
data collecting and quality control
Raw reads
Bin and trim
Compiling of data into web-based format that is dynamic and searchable
Assembly
Blast search
Bioinformatics: the perception..
The reality..
Wide variety of viral genome types have been “re-discovered” Viruses detected: BLASTx E score 33 genotypes) – Salivirus/Klassevirus (1 species) – Cardioviruses (1 species ~8 genotypes) Astroviruses: – Human astrovirus (8 genotypes) – Human astroviruses MLB-1/2/3 (3 genotypes) – Human astroviruses VA1/2/3/4 (4 genotypes) Polyomaviruses: – BKV/JC -KIPyV -WUPyV – MCPyV -HPyV6 -HPyV7 – TSPyV -HPyV9 -HMWPyV
Issues in NGS for virus detection Sequence what? -Everything (total DNA and RNA of host and virus)
-Enrich viral NA by filtration and nuclease resistance -Enrich known pathogens NA with micro-array or beads
Issues in NGS for virus detection Quality controls -Reduce nucleic acid contamination -Sensitivity using standards (mixed /ss/ds/circular DNA/RNA viruses) -Effect of sample type (blood/respiratory/feces/biopsies) -Best method for unbiased amplification. Bioinformatics Speed De novo assembly? Curated viral database Report only known viruses? (what % nucleotide/protein similarity criteria?)
Blood Systems Research Institute and UCSF: Linlin Li Tung Phan Lark Coffey Terry Ng Xutao Feng Beatrix Kapuszinsky (Stanford) Tongling Shan (CAS Shanghai) Amit Kapoor (Columbia U) Joe Victoria (Boehringer-Ingelheim) Morris Jones (USDA) MANY MANY other collaborators for human, animal and environmental samples
Stanford University Chunlin Wang University of Edinburgh Peter Simmonds Paul Ehrlich Institut Sally Baylis WHO poliovirus eradicati Sohail Zaidi University of Helsinki Maria Söderlund-Venerm
NHLBI, USAIDS, and BSRI funding
High sero-prevalence Bocavirus sero-reactivity in European children and adults
