NGS and virus discovery

6 downloads 0 Views 5MB Size Report
Rapid pace of viral discovery is providing many “orphan viruses” ... Healthy. Co-infections in high density farm piglets. Number of mammalian viruses per feces.
NGS and virus discovery Eric Delwart Blood Systems Research Institute UCSF Laboratory Medicine Brute force in the clinic Keen to document exactly which microbes are there, many researchers are using brute-force 'metagenomic' studies in which they extract microbial DNA from the body cavity of choice and hurl it all into a sequencing machine.

The discovery curve for human virus species Woolhouse M E et al. Proc. R. Soc. B 2008;275:2111-2115

Rapid pace of viral discovery is providing many “orphan viruses” as candidate pathogens

Some common diseases may be associated with still unknown viruses • • • • • • • •

Gastroenteritis (~50% unexplained in the US) Respiratory illness (15-25% unexplained) Encephalitis (~60-80% unexplained in CA) Hepatitis Chronic fatigue syndrome Non-polio acute flaccid paralysis Auto-immune diseases (diabetes, MS, Kawasaki) Cancers

Relative size of viruses and bacteria

Virus Size 400 nm filters used to purify viral particles

Chlamydia

Pox virus

Herpes virus Bacterium (Staphyllococcus aureus)

Influenza Virus Picornavirus (polio)

Random RT-PCR amplification Filtration and nuclease enriched viral nucleic acids RNA

Reverse transcription 5’GTCCATGCATGACTCGAGTCNNNNNNNN3’ Signature tag Randomized 3’

Melt/annneal and extend cDNA with Klenow DNA polymerase 5’GTCCATGCATGACTCGAGTC3’ 30-40 PCR rounds

DNA

Sequence data generation and analysis

Sequencing

data collecting and quality control

Raw reads

Bin and trim

Compiling of data into web-based format that is dynamic and searchable

Assembly

Blast search

Bioinformatics: the perception..

The reality..

Wide variety of viral genome types have been “re-discovered” Viruses detected: BLASTx E score 33 genotypes) – Salivirus/Klassevirus (1 species) – Cardioviruses (1 species ~8 genotypes) Astroviruses: – Human astrovirus (8 genotypes) – Human astroviruses MLB-1/2/3 (3 genotypes) – Human astroviruses VA1/2/3/4 (4 genotypes) Polyomaviruses: – BKV/JC -KIPyV -WUPyV – MCPyV -HPyV6 -HPyV7 – TSPyV -HPyV9 -HMWPyV

Practical uses for virus NGS (beside virus discovery) DIAGNOSTICS Target anti-viral Detect minority drug resistance mutations (HIV/HCV/HBV) Avoid unneeded antibiotic therapies Understand transmission networks BIOLOGICS QUALITY CONTROL Serum, cell supernatants, mAb. VETERINARY MEDICINE Diagnostics Vaccine ENVIRONMENTAL QC Agricultural products (plants-animals-etc) Sewage

Issues in NGS for virus detection Sequence what? -Everything (total DNA and RNA of host and virus)

-Enrich viral NA by filtration and nuclease resistance -Enrich known pathogens NA with micro-array or beads

Issues in NGS for virus detection Quality controls -Reduce nucleic acid contamination -Sensitivity using standards (mixed /ss/ds/circular DNA/RNA viruses) -Effect of sample type (blood/respiratory/feces/biopsies) -Best method for unbiased amplification. Bioinformatics Speed De novo assembly? Curated viral database Report only known viruses? (what % nucleotide/protein similarity criteria?)

Blood Systems Research Institute and UCSF: Linlin Li Tung Phan Lark Coffey Terry Ng Xutao Feng Beatrix Kapuszinsky (Stanford) Tongling Shan (CAS Shanghai) Amit Kapoor (Columbia U) Joe Victoria (Boehringer-Ingelheim) Morris Jones (USDA) MANY MANY other collaborators for human, animal and environmental samples

Stanford University Chunlin Wang University of Edinburgh Peter Simmonds Paul Ehrlich Institut Sally Baylis WHO poliovirus eradicati Sohail Zaidi University of Helsinki Maria Söderlund-Venerm

NHLBI, USAIDS, and BSRI funding

High sero-prevalence Bocavirus sero-reactivity in European children and adults

!

Children: Adults:

HBoV1 26% 59%

HBoV2 25% 34%

Kantola K,et al. J Infect Dis. 2011 Nov;204(9):1403-12.

HBoV3 11% 15%

HBoV4 3% 2%