The FASEB Journal • Research Communication
Nitric oxide production is a proximal signaling event controlling exercise-induced mRNA expression in human skeletal muscle Adam Steensberg, Charlotte Keller, Thore Hillig, Christian Frøsig, Jørgen F. P. Wojtaszewski, Bente Klarlund Pedersen, Henriette Pilegaard, and Mikael Sander1 Centre of Inflammation and Metabolism, Department of Infectious Diseases, Copenhagen Muscle Research Centre and Aviation Medicine, Department of Cardiology, National Hospital, and Departments of Molecular Biology and Exercise and Sport Sciences, University of Copenhagen, Copenhagen, Denmark Previous studies have described the magnitude and time course by which several genes are regulated within exercising skeletal muscle. These include interleukin-6 (IL-6), interleukin-8 (IL-8), heme oxygenase-1 (HO-1), and heat shock protein-72 (HSP72), which are involved in secondary signaling and preservation of intracellular environment. However, the primary signaling mechanisms coupling contraction to transcription are unknown. We hypothesized that exercise-induced nitric oxide (NO) production is an important signaling event for IL-6, IL-8, HO-1, and HSP72 expression in muscle. Twenty healthy males participated in the study. By realtime PCR, mRNA levels for 11 genes were determined in thigh muscle biopsies obtained 1) before and after 2 h knee extensor exercise without (control) and with concomitant NO synthase inhibition (nitro-L-arginine methyl ester, L-NAME, 5 mg䡠kgⴚ1); or 2) before and after 2 h femoral artery infusion of the NO donor nitroglycerin (NTG, 1.5 g䡠kgⴚ1䡠minⴚ1). L-NAME caused marked reductions in exercise-induced expression of 4 of 11 mRNAs including IL-6, IL-8, and HO-1. IL-6 protein release from the study leg to the circulation increased in the control but not in the L-NAME trial. NTG infusion significantly augmented expression of the mRNAs attenuated by L-NAME. These findings advance the novel concept that NO production contributes to regulation of gene expression in muscle during exercise. Subsequently, we sought evidence for involvement of AMP-activated kinase or nuclear factor kappa B, but found none.— Steensberg, A., Keller, C., Hillig, T., Frøsig, C., Wojtaszewski, J. F. P., Pedersen, B. K., Pilegaard, H., Sander, M. Nitric oxide production is a proximal signaling event controlling exercise-induced mRNA expression in human skeletal muscle. FASEB J. 21, 2683–2694 (2007) ABSTRACT
Key Words: interleukin 䡠 NO 䡠 AMP-activated kinase 䡠 nuclear factor kappa B
Physical inactivity is accompanied by a substantially increased risk of early onset cardiovascular disease 0892-6638/07/0021-2683 © FASEB
through development of conditions such as type 2 diabetes mellitus, obesity, hypertension, and dyslipidemia (1, 2). Conversely, regular physical activity is associated with health. A pivotal factor in this link between physical activity and health is exercise-induced regulation of gene expression within skeletal muscle itself and/or within other organs influenced by skeletal muscle signaling (3, 4). An increasing body of literature describes the magnitude and time course by which a variety of genes are regulated by exercise. Recently, the in vivo exercise-induced expression of cytokines in human skeletal muscle was identified and characterized (5). Though almost quiescent in resting myocytes, the mRNA levels of several cytokines increase quickly and robustly with exercise (6). The cytokines undoubtedly have local paracrine effects, but at least one—interleukin-6 (IL-6)—is secreted from the contracting myocytes and appears in the circulating blood, with up to 100-fold elevation after strenuous exercise (4, 7, 8). By this mechanism IL-6 serves as a myocytederived signaling molecule, a myokine, which changes the behavior of cells in other areas such as fat and liver. Moreover, muscle-derived IL-6 induces an anti-inflammatory environment in physically active humans (9, 10), and plays a central role in glucose (11) and fatty acid (12) metabolism during and in the hours after exercise. Skeletal muscle contractions also initiate the regulation of genes with intrinsic effects in the myocytes. These include heme oxygenase-1 (HO-1) (3) and heat shock protein 72 (HSP72) (13), which are thought to be important for preservation of the intracellular environment during the oxidative and thermal stress of myocyte contraction (14). Despite these and other recent advances in describing exercise-induced gene expression in humans, the 1 Correspondence: Copenhagen Muscle Research Centre, and Aviation Medicine, Department of Cardiology, National Hospital, Section 7522, Blegdamsvej 9, DK-2100 Copenhagen O, Denmark, Copenhagen. E-mail:
[email protected] doi: 10.1096/fj.06-7477com
2683
upstream signaling events are largely unknown (15). The present study probes the potential role of nitric oxide (NO) as such a signaling event. In vitro studies have provided evidence that NO may be involved in transcriptional control through several potential mechanisms (16). Thus, NO may directly alter signaling networks by redox-sensitive modification or by nitrosation of proteins within the cytoplasm or nucleus (17). In addition, the NO-induced increase in cyclic guanosine monophosphate (cGMP) may also exert effects on transcription (18). The neuronal NO synthase isoform (nNOS) is abundantly expressed in human skeletal muscle (19), and a number of observations provide evidence that NO production is significantly increased within contracting muscle (20 – 25). We hypothesized that local NO production is an important signaling event in pretranslational regulation of the expression of IL-6, interleukin-8 (IL-8), HSP72, and HO-1 in contracting human skeletal muscle. We tested this hypothesis by examining mRNA levels of these genes in thigh muscle biopsies from humans performing fatiguing knee extensor exercise with and without concomitant administration of an exogenous NOS inhibitor. We also studied the same mRNA levels in thigh muscle before and after prolonged femoral artery infusion of an exogenous NO donor in resting humans. Selected genes activated early during exercise and the NOS isoforms were studied for comparison. Because the data supported an important regulatory role for NO in skeletal muscle gene expression, we developed and tested two additional hypotheses: this novel NO-dependent mechanism is related to 1) AMP-activated protein kinase (AMPK) activation or 2) nuclear factor kappa B (NF-B) translocation, as tested by measurements of the alpha subunit of inhibitor of nuclear factor kappa B (IB␣).
arterial blood sampling, and intra-arterial infusion of drugs. In protocol 1, the femoral vein catheter (18G custom-made; Cook Biotech Inc., W. Lafayette, IN, USA) was used for thermodilution flow measurements (thermistor model 94 – 030-2.5-Fr, Baxter, Morton Grove, IL, USA; signal processor, FBJ Industries, Copenhagen, Denmark) and femoral venous sampling. In protocol 2, the femoral vein catheter (20G; Arrow) was used for femoral venous sampling. Thermodilution and ultrasound imaging and Doppler (7.5 MHz probe, VingMed CFM 800) measurements of leg blood flow were performed as described previously (26). During each trial, blood pressure and ECG were recorded continuously (PowerLab, ADIstruments, Castle Hill, Australia). Before and after exercise, muscle biopsies were obtained from vastus lateralis of the study leg through short skin and fascia incisions (under local anesthesia, lidocaine, 20 mg䡠ml⫺1⫹adrenaline, 5 g䡠ml⫺1). Only one biopsy was obtained from each incision. Exercise model The one-legged knee extensor (KE) exercise model has been described in detail (26, 27). Briefly, subjects are semirecumbent on a comfortable chair and kick-drive a cycle ergometer (modified Monark) with one leg strapped to an extension arm passing under the chair (the other leg is resting on a stool). The kick frequency is 60 rpm, and a load of 1 kg on the ergometer resistance scale is equivalent to a workload of 60 W (in addition to the 7 W workload of the unloaded ergometer). Before entering the experimental protocol 1, subjects performed two exercise tests. First, the subjects were familiarized with the exercise model during warm-up, then proceeded to a max test. In the max test the workload was increased every 2 min, initially by 10 W and subsequently by 5 W increments, until exhaustion (i.e., when cadence dropped below 50 rpm despite verbal encouragement to continue). The purpose was to obtain a measure of their maximum work capacity [Wmax, median 86 (63–99) W]. Second, on a different test day the subjects performed a 2 h trial using the workload intended for the experimental days [the aim was 55% of Wmax; the actual was median 54 (51–58) % of Wmax]. Drugs
MATERIALS AND METHODS Subjects Twenty healthy males who were physically active participated in the study. The medians (and ranges) for age and body mass index were 24 (20 – 40) years and 23 (18 –26) kg䡠m2. The study was approved by the Ethical Committee for Copenhagen and Frederiksberg Communities and was performed according to The Declaration of Helsinki. Subjects were informed about the possible risks and discomforts involved before giving their informed written consent to participate. Four subjects completed both protocols 1 and 2. Experimental procedure and hemodynamic measurements Subjects reported to the laboratory at 09:00 AM after an overnight fast, voided, changed into exercise attire, and remained supine during catheterization. The femoral artery and vein of the study leg were cannulated under local anesthesia (lidocaine, 20 mg䡠ml⫺1). The arterial catheter (20G, Arrow Therapeutics, London, UK) was used for direct measurement of blood pressure (Spectramed transducer), 2684
Vol. 21
September 2007
Nitro-l-arginine methyl ester (L-NAME, Clinalfa, Novabiochem, Nottingham, UK) was used as a pharmacological inhibitor of NOS. L-NAME (5 mg䡠kg⫺1 body weight) was infused into the femoral artery of the exercising leg during the first 30 min of exercise. This dose (25% higher than previously reported; refs. 28, 29) and mode of administration were chosen to maximize the concentration of L-NAME and the active metabolite L-NA within the exercising muscle (which in the KE exercise model at 55% of Wmax receives ⬃ 50% of cardiac output) while keeping the systemic effects at acceptable levels. At the end of each study day involving L-NAME, we administered l-arginine (200 mg䡠kg⫺1 body weight over 15 min, Clinalfa, Novabiochem) to reverse the effects of L-NAME (28, 29). L-NAME and l-arginine were tolerated well, and the only side effect was sleepiness after the study (noted by half of the subjects), which had resolved by the next morning. Nitroglycerin (NTG, Danish Hospital Pharmacy Distribution) was used as a pharmacological NO donor. NTG was infused into the femoral artery of the study leg at a constant rate [1.5 g䡠kg⫺1䡠min⫺1 (body weight)] for 120 min (Fig. 1). In one subject the dose was reduced from 1.5 to 1.0 g䡠kg⫺1䡠min⫺1 during the last 60 min due to a larger than expected drop in blood pressure. NTG was tolerated well, as
The FASEB Journal
STEENSBERG ET AL.
were lost to analysis. Thus, the blood sample data from protocol 1 are from 11 subjects. Protocol 2: effect of prolonged administration of a pharmacological NO donor on gene expression in the resting leg (Fig. 1) Each subject (n⫽10) participated on one study day and received a 2 h continuous infusion of the NO donor NTG into the femoral artery of the resting study leg [1.5 g䡠kg⫺1䡠min⫺1 (body weight)]. The timing of protocol 2 mimicked protocol 1 (Fig. 1). The only notable difference is the inclusion of a third biopsy taken at the 1 h recovery time point. The purpose of this biopsy was to increase the likelihood of detecting small changes in mRNA levels, which for some of the target genes might occur within the first hour after exercise rather than during exercise. In protocol 2, biopsy data are available from all 10 subjects and blood sample data are from 9 subjects. Plasma IL-6 determination
Figure 1. Outline of protocols. In protocol 1, subjects were studied twice. In a random and balanced order, each subject completed 2 h of knee extensor exercise with no infusion and with infusion of nitro-l-arginine methyl ester (L-NAME, total dose 5 mg䡠kg⫺1) given intra-arterially into the femoral artery of the exercising leg during the first 30 min of exercise. In protocol 2, subjects were studied once. Samples were obtained before, during, and after 2 h of continuous intraarterial infusion of nitroglycerin (NTG, 1.5 g䡠kg⫺1䡠min⫺1) into the femoral artery of the study leg. the subjects reported no symptoms from the increased blood flow in the resting leg or the decrease in blood pressure. Protocols Protocol 1: effects of pharmacological NOS inhibition on exerciseinduced gene expression (Fig. 1) Each subject (n⫽14) participated in two 2 h KE exercise trials with or without pharmacological inhibition of NOS by intraarterial infusion of L-NAME. In each trial the individual ergometer workload was aimed to be 55% of the individual Wmax (see above). More important, each individual subject used the same leg and performed exactly the same amount of work in both trials. The study days were at least 14 days apart to allow for healing of the catheterization site, and the order of L-NAME and control (no infusion) was random and balanced. The subjects rested in a supine position for at least 30 min after catheter insertion, whereupon baseline hemodynamic measurements including femoral blood flow by ultrasound imaging and Doppler, as well as femoral arterial and venous blood samples, and a muscle biopsy, were obtained. Thereafter, subjects exercised for 2 h. Before cessation of exercise, blood samples and hemodynamic values, including blood flow by both thermodilution and ultrasound, were obtained again and a biopsy was obtained immediately after the end of exercise. The subjects thereafter rested supine for 1 h before recovery blood samples and hemodynamic values were obtained. One subject did not wish to have biopsies taken after the first trial. Thus, the biopsy data from protocol 1 are from 13 subjects. In three other subjects, femoral venous samples NITRIC OXIDE CONTROL OF MYOKINE PRODUCTION
Arterial and venous blood samples for IL-6 measurement were drawn into precooled glass tubes containing EDTA. The tubes were spun immediately at 2200 g for 15 min at 4°C. The plasma was stored at ⫺80°C until analysis. Enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN, USA) were used to measure total IL-6 in plasma (i.e., soluble and receptor-bound). The intra-assay coefficient of variation for the kit is 5.9%. The net IL-6 release from the study leg was calculated by multiplying the femoral venoarterial difference with the plasma flow. Muscle biopsy mRNA analysis Muscle biopsies were freeze-dried immediately using liquid nitrogen and stored at ⫺80°C. Before analysis, each biopsy underwent manual dissection using a microscope located in a cold room to remove visual blood, fat, and connective tissue. Thus, the vast majority of both mRNA and protein content in all biopsy samples is derived from skeletal muscle myocytes. Twenty milligrams of muscle tissue was used for RNA extraction using the Trizol method (Invitrogen, Carlsbad, CA, USA). In short, 1 ml of Trizol was added to the sample and homogenized for 15–20 s. One hundred microliters of chloroform/isoamyl alcohol (24:1) was added and samples were thoroughly shaken, followed by centrifugation at 12,000 g for 15 min at 4°C. The upper aqueous layer was transferred to a fresh tube and the same volume of ice-cold isopropanol was added. The samples were subsequently stored at ⫺20°C for 1 h and spun at 12,000 g for 15 min at 4°C. The resulting pellet was washed with 0.5 ml of 75% ethanol in DEPC-treated water and centrifuged at 6000 g for 10 min. Pellets were redissolved in 15 l of DEPC-treated water and allowed to dissolve on ice, after which samples were ready for reverse transcription. RNA (2 g) was reverse transcribed (Applied Biosystems Taqman RT-Kit; Applied Biosystems, Foster City, CA, USA). The cDNA was prepared using random hexamers. The mRNA content of a given gene was determined by real-time PCR with Taqman probes (ABIPRISM 7900 Sequence Detection System, Applied Biosytems). Commercially available primers and probes (Applied Biosystems) were used to identify 18S, IL-6, IL-8, TNF-␣, HSP 72, while primers and probes to amplify a fragment of HO-1, VEGF, HIF1␣, PDK4, eNOS, nNOS, and iNOS mRNAs were designed and optimized as described earlier (28). The primer sequences have been given before (30 –33) except for eNOS, iNOS, and nNOS mRNA (Table 1). mRNA levels were determined from individual Ct’s by the standard curve method. 2685
TABLE 1. Probes and primers for nNOS, iNOS, and eNOS Gene
iNOS nNOS eNOS
Forward primer
Reverse primer
TaqMan probe
5⬘AGCGGGATGACTTTCCAAGA3⬘ 5⬘GCGAGCCATTGGCTTCAA3 5⬘CGGCATCACCAGGAAGAAGA3⬘
5⬘TAATGGACCCCAGGCAAGATT3⬘ 5⬘CCATAGCCTGCCCCATCA3⬘ 5⬘CATGAGCGAGGCGGAGAT3⬘
5⬘CCTGCAAGTTAAAATCCCTTTGGCCTTATG3⬘ 5⬘AGCAGAAGCTGTCAAGTTCTCGGCCAA3⬘ 5⬘TTCACGGCGTTGGCCACTTCTTTAAAG3⬘
As the 18S rRNA level did not change in either of the two protocols, 18S rRNA was suitable as endogenous control in the present study. Thus, the level of mRNA for each target gene was normalized to the level of 18S rRNA in the same biopsy. Because RT-PCR data and their ratios typically are not distributed normally, all mRNA data were logarithmically transformed before submission to parametric statistical testing; logarithmic y-axes were used for mRNA data presentation. Muscle biopsy protein analysis Muscle tissue was homogenized as described (34). The homogenate was rotated end-over-end at 4°C for 1 h, then centrifuged for 30 min (17,500 g, 4°C). The supernatant (lysate) was harvested and total protein content was determined using the bicinchoninic acid spectrophotometry detection method (Pierce, Rockford, IL, USA). Muscle content of the phosphorylated ␣-(Thr172) AMPK (pAMPK), phosphorylated (Ser221) acetyl-CoA carboxylase-beta (pACC), a downstream target of AMPK, and IB␣ was estimated by Western blot. The standard normalization procedure for Western blot analysis of muscle biopsies was utilized by loading the same total lysate protein amount and concentration from all samples onto the gels. In brief, lysate protein was separated using 7.5% Bis-Tris gels (Invitrogen) and transferred (semidry) to PVDF membranes (Immobilon Transfer Membrane; Millipore, Billerica, MA, USA). After blocking [10 mM Tris base (pH 7.4), 0.9% NaCl, 1% Tween 20 (TBST) ⫹ 2% skimmed milk], the membrane was incubated with a primary antibody—the antiphospho-specific AMPK (Thr172) (Cell Signaling Technology), the antiphospho-specific-ACC(Ser221) (Upstate Biotechnology, Lake Placid, NY, USA), or the anti-IB␣ (Santa Cruz Biotechnologies, Santa Cruz, CA, USA)—in TBST ⫹ 2% skimmed milk, followed by incubation in horseradish peroxidase-conjugated secondary antibody (TBST⫹2% skimmed milk; Amersham Pharmacia Biotech, Arlington Heights, IL, USA). After detection and quantification (Kodak Image Station 2000MM; Kodak, Rochester, NY, USA), the protein content was finally expressed in arbitrary units with the use of internal standards. In addition, lysate contents of IB␣ and Ser-32 phosphorylated IB␣ (pIB␣) were determined using ELISA (BioSource International, Camarillo, CA, USA). In brief, a monoclonal antibody specific for IB␣ (independent of the phosphorylation status) is coated onto 96-well strips, and IB␣ in samples binds to this capture antibody. In the second step, a detection antibody specific for either IB␣ or pIB␣ binds to the captured antigen; finally, horseradish peroxidase-labeled anti-rabbit IgG is used to target the detection antibody. The sample contents are expressed against a standard curve constructed using known amounts of IB␣ or pIB␣ peptide standards. Data analysis and statistics All hemodynamic data sampling underwent analog-to-digital conversion and was sampled at 400 Hz, recorded on a PC, and analyzed offline with signal processing software (PowerLab, ADInstruments). Heart rate (HR) was derived from the ECG, 2686
Vol. 21
September 2007
and the average systolic (SBP), diastolic (DBP), and mean arterial pressures (MAP) were derived from the arterial pressure waveform. The femoral blood flow data analysis was performed as described previously in detail (26). A change in mRNA level was determined as a significant change in the ratio between target gene and 18S mRNA levels from baseline to intervention. Within-group differences were tested using 1or 2-way ANOVA for repeated measures (i.e., repeated measures for both drug and exercise). Post hoc analysis was performed by Dunnett’s procedure for 1-way ANOVA and by Tukey’s HSD procedure for 2-way ANOVA. Data are expressed as mean ⫾ se. Statistical significance was set at P ⬍ 0.05.
RESULTS Effects of L-NAME on exercise-induced gene expression (protocol 1) L-NAME caused a significant reduction in the exerciseinduced increase in the expression of IL-6, HO-1, and PDK4 mRNAs and tended to reduce IL-8 mRNA compared with the control trial (Fig. 2). Thus, the exerciseinduced IL-6 mRNA increase was more than halved by L-NAME compared with control, and PDK4 mRNA failed to increase significantly during the L-NAME trial. In addition, L-NAME induced a significant decrease in the mRNA level of HIF1␣ and iNOS compared with baseline and the control trial (Fig. 2). In the control trial, there was a significant increase in the release of IL-6 protein from the study leg from baseline to postexercise. In contrast, in the L-NAME trial there was not a significant increase in the IL-6 release from baseline to postexercise (Fig. 3). The difference in release between the control and L-NAME trials was almost 2-fold but did not reach statistical significance. Exercise caused the expected increase in phosphorylation of both AMPK and ACC, and L-NAME caused no significant change in this response (Fig. 4). Exercise caused no change in the IB␣ protein content evaluated either by Western blot (Fig. 4) or ELISA (54⫾3 at rest vs. 52⫾4 pg/100 g protein after exercise). Phosphorylation of IB␣ was at low levels at rest and after exercise (11⫾1 at rest vs. 12⫾2 AU after exercise); L-NAME did not cause any difference compared with control. L-NAME had the expected hemodynamic effects within the study leg, where it tended to decrease flow during exercise at the 2 h time point and caused a robust decrease in blood flow at the 1 h recovery time point (Fig. 3). Baseline MAP (83⫾3 vs. 84⫾3 mmHg) and HR (61⫾3 vs. 58⫾3 beats䡠min⫺1) were similar in
The FASEB Journal
STEENSBERG ET AL.
Figure 2. Changes in target mRNA levels relative to baseline accompanied by 2 h of knee extensor exercise (54% of Wmax) with (white squares) and without (black squares) concomitant intra-arterial infusion of nitro-l-arginine methyl ester (LNAME, 5 mg䡠kg⫺1) given during the first 30 min of exercise. The target mRNA level was normalized to the 18S rRNA level. Each logarithmic Y-scale shows the change in mRNA level as: (target mRNA/ 18S rRNA for intervention)/(targetmRNA/18S rRNA for baseline). IL-6, interleukin-6 mRNA; IL-8, interleukin-8 mRNA, TNF-␣, tumor necrosis factor ␣ mR⌵〈; HO-1, heme oxygenase-1 mRNA; HSP72; heat shock protein 72 mRNA; VEGF, vascular endothelial growth factor mRNA; HIF1␣, hypoxia-inducible factor 1␣ mRNA; PDK4, pyruvate dehydrogenase kinase 4 mRNA; NOS, nitric oxide synthase; eNOS, endothelial NOS mRNA; nNOS, neuronal NOS mRNA; iNOS, inducible NOS mRNA. ␦P ⬍ 0.05 for changes compared with baseline; *P ⬍ 0.05 for differences in the responses between L-NAME and control. Statistical significance was tested on logarithmically transformed data.
both trials. L-NAME was accompanied by increased MAP during exercise (109⫾2 vs. 103⫾3 mmHg, P⬍0.05), and recovery (97⫾2 vs. 82⫾3 mmHg, P⬍0.05); and decreased HR during exercise (90⫾3 vs. 112⫾5 beats䡠min⫺1, P⬍0.05) and recovery (55⫾2 vs. 64⫾3 beats䡠min⫺1, P⬍0.05). Effect of NTG on gene expression in resting muscle (protocol 2) NTG infusion caused a significant increase in levels of IL-6, IL-8, and HO-1 mRNA. In addition, HSP72 mRNA levels significantly decreased (Fig. 5). These NTGmediated IL-6, HO-1, and HSP72 mRNA changes remained present 1 h after NTG infusion stopped, while the IL-8 mRNA levels were similar to baseline 1 h after the end of infusion. NTG infusion caused a significant increase in IL-6 release from the study leg (Fig. 6). NTG did not significantly change the phosphorylation of AMPK, but was accompanied by a significant decrease in the phosporylation of ACC (13⫾3 at baseline, to 10⫾2 (p⫽ns) after 2 h of infusion, to 7⫾1 NITRIC OXIDE CONTROL OF MYOKINE PRODUCTION
(P⬍0.05) AU at the 1 h recovery time point). NTG caused no change in IB␣ protein content or the phosporylation state of IB␣ as evaluated by a combination of Western blot and ELISA. NTG was accompanied by an expected increase in femoral blood flow (Fig. 6), and also by a decrease in MAP (from 89⫾3 to 77⫾3 mmHg, P⬎0.05), chiefly due to a decrease in SBP (from 126⫾4 to 101⫾4 mmHg, P ⬎ 0.05), which was accompanied by an increase in HR (from 62⫾3 to 69⫾2 beats䡠min⫺1, P⬍0.05).
DISCUSSION The proximal signaling events leading to exerciseinduced changes in gene expression within skeletal muscle are poorly understood. The present study advances the novel concept that NO production within contracting skeletal muscles is a key regulator of pretranslational signaling events. The first major finding is that pharmacological inhibition of NO production during exercise significantly attenuates the increases in 2687
endothelial NO production is ongoing, but evidence strongly suggests a substantial myocyte NO production (20 –25). The abundantly expressed myocyte nNOS has mainly a subsarcolemmal localization, and thereby is in the proximity of the small resistance vessels. Thus, NO produced in myocytes may also exert effects on vascular smooth muscle and thereby blood flow. Indeed, several lines of evidence support this concept (22–24, 37, 38). However, in humans it has been difficult to attenuate blood flow to exercising muscle by pharmacological inhibition of NO alone (29, 35, 36). In the present study there was an average nonsignificant decrease of 15% in exercise blood flow at the 2 h time point of exercise. In agreement with previous studies on this
Figure 3. Femoral plasma flow, IL-6 veno-arterial difference, and IL-6 release before and during the last minutes of 2 h knee extensor exercise (54% of Wmax) and 1 h after exercise with (white squares) and without (black squares) concomitant intraarterial infusion of nitro-l-arginine methyl ester (L-NAME, 5 mg䡠kg⫺1) given during the first 30 min of exercise. IL-6, interleukin-6 protein; VA-diff, femoral veno-arterial difference. ␦P ⬍ 0.05 for changes compared with baseline; *P ⬍ 0.05 for differences between L-NAME and control.
specific mRNA levels in human skeletal muscle. This interpretation is strongly supported by the second major finding that prolonged intra-arterial infusion of an NO donor is accompanied by increases in the mRNA content of the same specific genes in resting skeletal muscle that were attenuated by inhibition of NO production during exercise. It is noteworthy that the drug-induced changes of IL-6 mRNA expression are accompanied by similar alterations in IL-6 protein release supporting the functional significance of the IL-6 mRNA change. In addition to these findings, we sought evidence for involvement of AMPK or NF-B signaling in this NO-related mechanism, but found none. NO effects in skeletal muscle The classical effect of NO within skeletal muscle plays an important role for blood flow regulation (35, 36). In resting skeletal muscle, NO production is thought to occur mainly in the endothelium, and pharmacological inhibition of NO production in resting humans reduces muscle blood flow by up to 50%. In exercising muscle, 2688
Vol. 21
September 2007
Figure 4. Protein content in muscle biopsies before and immediately after 2 h knee extensor exercise (54% of Wmax) determined by Western blot for pAMPK and pACC (A) and for IB␣ (B) with (white) and without (black) concomitant intra-arterial infusion of nitro-l-arginine methyl ester (LNAME, 5 mg䡠kg⫺1) given during the first 30 min of exercise. pAMPK, phosphorylated (Thr172) AMP-activated kinase; pACC, phosphorylated (Ser221) acetyl coenzyme-A carboxylase; IB␣, inhibitor of nuclear kappa factor B alpha subunit. ␦P ⬍ 0.05 for changes compared with baseline.
The FASEB Journal
STEENSBERG ET AL.
Figure 5. Changes in mRNA levels relative to baseline immediately after 2 h continuous femoral arterial infusion of the NO donor, nitroglycerin (NTG, 1.5 g䡠kg⫺1䡠min⫺1), and 1 h into recovery (Rec). The target mRNA level was normalized to the 18S rRNA level. Each logarithmic Y-scale shows the change in mRNA level as: (target-mRNA/18S rRNA for intervention)/(target-mRNA/18S rRNA for baseline). IL-6, interleukin-6 mRNA; IL-8, interleukin-8 mRNA, TNF-␣, tumor necrosis factor ␣ mR⌵〈; HO-1, heme oxygenase-1 mRNA; HSP72; heat shock protein 72 mRNA; VEGF, vascular endothelial growth factor mRNA; HIF1␣, hypoxia-inducible factor 1␣ mRNA; PDK4, pyruvate dehydrogenase kinase 4 mRNA; NOS, nitric oxide synthase; eNOS, endothelial NOS mRNA; nNOS, neuronal NOS mRNA; iNOS, inducible NOS mRNA. ␦P ⬍ 0.05 for changes compared with baseline. Statistical significance was tested on logarithmically transformed data.
issue, blood flow at the 1 h recovery time point was significantly decreased (by ⬎40%) in the L-NAME trial compared with the control trial. The latter finding validates that the dose of L-NAME used in the present study produces a biologically significant NO inhibition at least in the resting skeletal muscle. The extent to which NOS activity is inhibited in vivo by pharmacological means is difficult to determine. A previous study using a smaller dose of L-NAME infused intravenously concluded that NOS activity was reduced by 60 –70% in skeletal muscle biopsies (29). In the present study, L-NAME was accompanied by decreased NOS mRNA levels compared with control. Thus, it is unlikely that NOS protein levels increase to compensate for the L-NAME inhibition of NOS within the 2 h exercise period. NITRIC OXIDE CONTROL OF MYOKINE PRODUCTION
The proposed novel effect of NO in skeletal muscle plays an important role in regulating gene expression. Although NO has been suggested as a signaling molecule for gene expression in several cells, including macrophages, lymphocytes, fibroblasts, endothelial cells, smooth muscle cells and cardiac cells (16), the present study is the first to focus on this hypothesis in skeletal muscle. Using L-NAME-induced attenuation of local NO production in human subjects during exercise, the contraction-induced IL-6 and HO-1 mRNA expression in skeletal muscle was halved, and IL-8 mRNA expression tended to be lower. In addition, expression of PDK4 mRNA was completely inhibited. The specificity of these findings is underscored by the failure of L-NAME to change contraction-induced changes in TNF-␣ and VEGF mRNA. The interpreta2689
Figure 6. Femoral plasma flow, IL-6 veno-arterial difference, and IL-6 release before and during the last minutes of a 2 h continuous femoral arterial infusion of the NO donor, nitroglycerin (NTG, 1.5 g䡠kg⫺1䡠min⫺1), and 1 h into recovery. IL-6, interleukin-6 protein; VA-diff, femoral veno-arterial concentration difference. ␦P ⬍ 0.05 for changes compared with baseline.
tion that these effects of L-NAME-administration are indeed related to inhibition of NO-synthesis is strongly supported by the finding that 2 h intra-arterial infusion of the NO donor, NTG, is accompanied by increases in the IL-6, IL-8, and HO-1 mRNA levels, and a nonsignificant 2.5-fold increase in the average PDK4 mRNA level. The functional significance of changes in mRNA levels is difficult to determine without measures of protein content. However, because the IL-6 protein is released from myocytes and reaches the circulation during and after strenuous exercise (4), a functional consequence is easily detectable for changes in IL-6 mRNA levels. Thus, in several previous studies IL-6 was released from the contracting muscles during several forms of exercise (7, 39, 40). In the present study this was confirmed in the control trial, whereas no significant increase in IL-6 protein levels was evident in the L-NAME trial. Control of myocyte gene expression In the present study, we report on the exercise-induced changes in mRNA levels in homogenized human biopsies. In these homogenates the vast majority of mRNA 2690
Vol. 21
September 2007
and protein is derived from the myocytes; for the cytokines, however, including IL-6, IL-8, and TNF-␣, the possibility has been raised that the levels could be derived in part from immunocompetent cells. To address this issue, previous studies using in situ hybridization and immunohistochemistry have demonstrated that the contraction-induced increases in IL-6, IL-8, and TNF-␣ mRNA and protein in biopsies taken immediately after cessation of exercise compared with preexercise control are all related to augmented expression within the myocytes themselves, and not to activation of immunocompetent cells within the muscle (41– 44). Myocyte gene expression changes in the course of exercise and recovery. The control of the integrated response to exercise is influenced by the level and duration of exercise, as well as energy substrate availability. However, the molecular mechanisms linking exercise or substrate availability to transcription are poorly understood. Undoubtedly, several transcription factors are activated during exercise and recovery, but the precise nature and time course for these factors have yet to be studied in vivo (15). The role of NO would logically be proximal to activation of the transcription factors. It is conceivable that NO, peroxynitrite, or cGMP could contribute to the activation of one or more transcription factors through actions in either the cytoplasm or nucleus. Below we briefly present the current knowledge of the transcriptional control of the myocyte genes studied herein. For myocyte IL-6 expression and release, previous studies have described the importance of two factors. First, the intensity and duration of exercise are paramount (41). If the exercise is not fatiguing, the increases in both IL-6 mRNA and protein release are difficult to detect. Second, and likely related to the first factor, IL-6 release is dependent on glycogen and glucose levels within the contracting muscle. Prior glycogen depletion strengthens (45, 46), whereas glucose ingestion during exercise attenuates, the release of IL-6 protein from the active leg (47). Previous cell studies have reported NO-related stimulation of IL-6 transcription in cardiac myocytes (48). IL-8, TNF-␣, HO-1, and HSP72 are all known to increase relatively early after exercise. Again, the intensity and duration of exercise are important factors. Previous studies have found a stimulatory effect of NO on IL-8 and TNF-␣ gene expression in endothelial cells and cardiac myocytes (49 –51). Our findings are consistent with an NO-related stimulation of IL-8 transcription in myocytes, but we could not find support for any role of NO in regulating TNF-␣ expression. In vitro cell and in vivo animal studies suggest a role for NO in regulating both HO-1 (52) and HSP72 mRNA content (53). However, of the two, only HO-1 mRNA expression was dependent on NO signaling in contracting as well as resting human skeletal muscle in the present study. Indeed, HSP72 mRNA was increased to the same extent during control and L-NAME exercise, and HSP72 mRNA was decreased (not increased) by NTG infusion
The FASEB Journal
STEENSBERG ET AL.
in the resting muscle. HO-1 has also been identified as a heat shock protein (HSP32), which makes the differential effect of NO on these two hyperthermia-induced genes noteworthy. Of the six remaining genes studied, only PDK4 and VEGF increased significantly within the time frame of the present study. This is consistent with previous studies for these genes (3, 54). PDK4 mRNA expression has been modulated by changes in substrate intake (55, 56). The present study strongly indicates that NO exerts an important regulatory effect on the exercise-induced increases in PDK4 mRNA levels. In contrast, the data suggest that NO does not regulate VEGF mRNA levels in exercising muscle. The eNOS, iNOS, and HIF1␣ mRNA levels were not significantly changed after control exercise, but were significantly lower after the L-NAME compared with control exercise. Because neither of these mRNAs was induced by NTG in the resting muscle, we cannot readily propose that NO is involved in this up-regulation. Linking NO signaling to gene expression To probe the additional molecular signaling involved in this novel NO-dependent mechanism for pretranslational control of gene expression in skeletal muscle, we tested two add-on hypotheses: first, that production of NO and specifically peroxynitrite in exercising skeletal muscle is an important signal for increasing AMPK activity, which in turn is involved in the transcriptional control; and second, that NO signaling in skeletal muscle is involved in the nuclear translocation of NF-B, which in turn is involved in the transcriptional control of myokines—specifically, IL-6. The rationale for choosing to test these mechanisms and a brief discussion of the results are outlined below. During moderate to strenuous exercise, skeletal muscle AMPK activity increases and is emerging as an important regulator of substrate utilization (57). However, AMPK has also been implicated in myocyte transcriptional control (58, 59). In one recent study, IL-6 protein release from cultured mouse cardiac fibroblasts was dose-dependently induced by the AMPK activator 5-aminoimidazole-4-carboxamide-1– 4-ribofuranoside (AICAR) (60), and a previous study from our own center found a correlation between AMPK activity in and IL-6 release from human skeletal muscle (61). Peroxynitrite, a by-product of NO production particularly in energy-depleted cells, has been shown to increase AMPK activity and NOS inhibition to block both the hypoxia-reoxygenation- and metformin-induced peroxynitrite-mediated AMPK activation (62, 63). In incubated skeletal muscle, the exogenous NO donor, nitroprusside, increased AMPK activity (64), whereas in mice hearts in vivo, NTG decreased AMPK activity (65). In the present study, we found the expected exerciseinduced increase in both pAMPK and pACC, the latter an AMPK-induced deactivation, which more accurately reflects total AMPK activity in vivo (58, 66). L-NAME NITRIC OXIDE CONTROL OF MYOKINE PRODUCTION
did not change this effect of exercise compared with control. NTG (especially the 1 h recovery time point) was accompanied by a tendency for a decrease in pAMPK (P⫽0.1 for the 1 h recovery compared with baseline) and a significant decrease in pACC. These findings agree with previous mouse heart NTG effects (65), and in that study L-NAME did not significantly change ischemia-induced AMPK activation. However, the present data do not support NO or peroxynitrite as important mediators of AMPK activation during knee extensor exercise. NF-B has been identified as an important transcription factor for the expression of cytokines in many models of inflammation. For example, the TNF-␣induced increase in IL-8 in endothelial cells is dependent on nuclear translocation of NF-B (and accompanied by degradation of IB␣) (67), and NF-B seems to regulate IL-6 expression in myoblasts and monocytes (68, 69). In skeletal muscle, both in vivo and in vitro, NF-B signaling has been reported to increase with exercise or contraction through inactivation (phosphorylation) and degradation of IB␣ (70, 71). Such activation could be related to both NO signaling and AMPK activation. Thus, NO signaling is accompanied by increased NF-B activity in endothelial cells and fibroblasts (72, 73); in endothelial cells, AICAR induced NF-B translocation through IB␣ degradation (74). In the present study, the content and phosporylation of IB␣ did not change significantly during exercise (during either the L-NAME or control trials) or during administration of NTG. These result indicate that NF-B translocation is not increased during exercise in our human model. This interpretation is in accordance with another recent human study that found no increase in skeletal muscle nuclear content of NF-B immediately after 60 min of ergometer cycle exercise (75). Whether NF-B translocation increases in human skeletal muscle in the recovery phase after exercise is unknown, but the results herein dissociate NF-B signaling and the exercise-induced increases in IL-6, IL-8, TNF-␣, HO-1, HSP72, VEGF, and PDK4 mRNA in skeletal muscle.
CONCLUSIONS The present study demonstrates that NO regulates expression of several genes at the pretranslational level within human skeletal muscle. Specifically, endogenously produced NO seems to exert important selective regulatory effects on gene expression during and immediately after exercise. We have probed but not yet identified the transcription factor (or factors) involved in the transduction of this novel NO-driven mechanism. At the present time, contraction-induced activation of transcription factors is poorly understood. Muscle NO production likely does not influence all of these factors, and it should be noted that each induced transcription factor may respond to several cellular events. However, the present study identifies NO as one 2691
of the functionally significant signaling molecules for in vivo pretranslational control in human skeletal muscle. This finding may have important implications for the future development of pharmacological treatment, which could supplement exercise training and thereby improve the risk profile in inactivity-related diseases. Thus, future compounds increasing nNOS or eNOS expression or compounds optimizing NO production from existing NOS such as administration of the substrate, l-arginine, might also be associated with an improved profile of increases in specific mRNA levels after each exercise bout. The excellent technical assistance of Kristina Møller Kristensen, Ruth Rousing, Hanne Villumsen, and Carsten Nielsen (recently deceased) is highly appreciated. A.S.’s work was supported by the A. P. Moller Foundation and the Copenhagen Hospital Corporation. M.S.’s work was supported by the Danish Heart Association, the Danish National Research Foundation, the Novo Nordisk Foundation, the Michaelsen Foundation, the Kaj Hansen Foundation, and the Danish Physicians Foundation. the Centre of Inflammation and Metabolism is supported by a grant from the Danish National Research Foundation, DG 02–512-555; the Copenhagen Muscle Research Centre has received support from the University of Copenhagen, the Faculties of Science and of Health Sciences; the Copenhagen Hospital Corporation, the Danish National Research Foundation (Grant 504 –14), the Commission of the European Communities (contract no. LSHM-CT2004 – 005272 EXGENESIS).
10.
11.
12.
13.
14.
15. 16. 17. 18. 19. 20. 21.
REFERENCES 1.
2. 3.
4.
5. 6.
7.
8.
9.
2692
Haapanen, N., Miilunpalo, S., Vuori, I., Oja, P., and Pasanen, M. (1997) Association of leisure time physical activity with the risk of coronary heart disease, hypertension and diabetes in middleaged men and women. Int. J. Epidemiol. 26, 739 –747 Pedersen, B. K., and Saltin, B. (2006) Evidence for prescribing exercise as therapy in chronic disease. Scand. J. Med. Sci. Sports 16 Suppl. 1, 3– 63 Pilegaard, H., Ordway, G. A., Saltin, B., and Neufer, P. D. (2000) Transcriptional regulation of gene expression in human skeletal muscle during recovery from exercise. Am. J. Physiol. 279, E806 –E814 Steensberg, A., van Hall, G., Osada, T., Sacchetti, M., Saltin, B., and Pedersen, B. K. (2000) Production of interleukin-6 in contracting human skeletal muscles can account for the exercise-induced increase in plasma interleukin-6. J. Physiol. 529, 237–242 Febbraio, M. A., and Pedersen, B. K. (2002) Muscle-derived interleukin-6: mechanisms for activation and possible biological roles. FASEB J. 16, 1335–1347 Nieman, D. C., Davis, J. M., Henson, D. A., Gross, S. J., Dumke, C. L., Utter, A. C., Vinci, D. M., Carson, J. A., Brown, A., McAnulty, S. R., et al. (2005) Muscle cytokine mRNA changes after 2.5 h of cycling: influence of carbohydrate. Med. Sci. Sports. Exerc. 37, 1283–1290 Ostrowski, K., Hermann, C., Bangash, A., Schjerling, P., Nielsen, J. N., and Pedersen, B. K. (1998) A trauma-like elevation of plasma cytokines in humans in response to treadmill running. J. Physiol. 513, 889 – 894 Penkowa, M., Keller, C., Keller, P., Jauffred, S., and Pedersen, B. K. (2003) Immunohistochemical detection of interleukin-6 in human skeletal muscle fibers following exercise. FASEB J. 17, 2166 –2168 Steensberg, A., Fischer, C. P., Keller, C., Moller, K., and Pedersen, B. K. (2003) IL-6 enhances plasma IL-1ra, IL-10, and cortisol in humans. Am. J. Physiol. 285, E433–E437
Vol. 21
September 2007
22.
23.
24.
25.
26. 27.
28. 29.
30.
Starkie, R., Ostrowski, S. R., Jauffred, S., Febbraio, M., and Pedersen, B. K. (2003) Exercise and IL-6 infusion inhibit endotoxin-induced TNF-alpha production in humans. FASEB J. 17, 884 – 886 Febbraio, M., Hiscock, N., Sacchetti, M., Fischer, C., and Pedersen, B. K. (2004) Interleukin-6 is a novel factor mediating glucose homeostasis during skeletal muscle contraction. Diabetes 53, 1643–1648 Van Hall, G., Steensberg, A., Sacchetti, M., Fischer, C., Keller, C., Schjerling, P., Hiscock, N., Moller, K., Saltin, B., Febbraio, M. A., and Pedersen, B. K. (2003) Interleukin-6 stimulates lipolysis and fat oxidation in humans. J. Clin. Endocrinol. Metab. 88, 3005–3010 Febbraio, M. A., and Koukoulas, I. (2000) HSP72 gene expression progressively increases in human skeletal muscle during prolonged, exhaustive exercise. J. Appl. Physiol. 89, 1055–1060 Smolka, M. B., Zoppi, C. C., Alves, A. A., Silveira, L. R., Marangoni, S., Pereira-Da-Silva, L., Novello, J. C., and Macedo, D. V. (2000) HSP72 as a complementary protection against oxidative stress induced by exercise in the soleus muscle of rats. Am. J. Physiol. 279, R1539 –R1545 Koulmann, N., and Bigard, A. X. (2006) Interaction between signalling pathways involved in skeletal muscle responses to endurance exercise. Plu¨gers Arch. 452, 125–139 Bogdan, C. (2001) Nitric oxide and the regulation of gene expression. Trends Cell Biol. 11, 66 –75 Hemish, J., Nakaya, N., Mittal, V., and Enikolopov, G. (2003) Nitric oxide activates diverse signalling pathways to regulate gene expression. J. Biol. Chem. 278, 42321– 42329 Pilz, R. B., and Broderick, K. E. (2005) Role of cyclic GMP in gene regulation. Front. Biosci. 10, 1239 –1268 Frandsen, U., Lopez-Figueroa, M., and Hellsten, Y. (1996) Localization of nitric oxide synthase in human skeletal muscle. Biochem. Biophys. Res. Commun. 227, 88 –93 Balon, T. W., and Nadler, J. L. (1994) Nitric oxide release is present from incubated skeletal muscle preparations. J. Appl. Physiol. 77, 2519 –2521 Roberts, C. K., Barnard, R. J., Jasman, A., and Balon, T. W. (1999) Acute exercise increases nitric oxide synthase activity in skeletal muscle. Am. J. Physiol. 277, E390 –E394 Lau, K. S., Grange, R. W., Chang, W. J., Kamm, K. E., Sarelius, I., and Stull, J. T. (1998) Skeletal muscle contractions stimulate cGMP formation and attenuate vascular smooth muscle myosin phosphorylation via nitric oxide. FEBS Lett. 431, 71–74 Lau, K. S., Grange, R. W., Isotani, E., Sarelius, I. H., Kamm, K. E., Huang, P. L., and Stull, J. T. (2000) nNOS and eNOS modulate cGMP formation and vascular response in contracting fast-twitch skeletal muscle. Physiol. Genomics 2, 21–27 Grange, R. W., Isotani, E., Lau, K. S., Kamm, K. E., Huang, P. L., and Stull, J. T. (2001) Nitric oxide contributes to vascular smooth muscle relaxation in contracting fast-twitch muscles. Physiol. Genomics 5, 35– 44 Silveira, L. R., Pereira-Da-Silva, L., Juel, C., and Hellsten, Y. (2003) Formation of hydrogen peroxide and nitric oxide in rat skeletal muscle cells during contractions. Free. Radic. Biol. Med. 35, 455– 464 Wray, D. W., Fadel, P. J., Smith, M. L., Raven, P., and Sander, M. (2004) Inhibition of alpha-adrenergic vasoconstriction in exercising human thigh muscles. J. Physiol. 555, 545–563 Andersen, P., Adams, R. P., Sjogaard, G., Thorboe, A., and Saltin, B. (1985) Dynamic knee extension as model for study of isolated exercising muscle in humans. J. Appl. Physiol. 59, 1647–1653 Sander, M., Chavoshan, B., and Victor, R. G. (1999) A large blood pressure-raising effect of nitric oxide synthase inhibition in humans. Hypertension 33, 937–942 Frandsen, U., Bangsbo, J., Sander, M., Hoffner, L., Betak, A., Saltin, B., and Hellsten, Y. (2001) Exercise-induced hyperaemia and leg oxygen uptake are not altered during effective inhibition of nitric oxide synthase with N(G)-nitro-l-arginine methyl ester in humans. J. Physiol. 531, 257–264 Pilegaard, H., Saltin, B., and Neufer, P. D. (2003) Effect of short-term fasting and refeeding on transcriptional regulation of metabolic genes in human skeletal muscle. Diabetes 52, 657– 662
The FASEB Journal
STEENSBERG ET AL.
31.
32.
33.
34. 35. 36. 37.
38.
39. 40.
41. 42.
43. 44. 45.
46.
47.
48. 49. 50.
Jensen, L., Pilegaard, H., Neufer, P. D., and Hellsten, Y. (2004) Effect of acute exercise and exercise training on VEGF splice variants in human skeletal muscle. Am. J. Physiol. 287, R397– R402 Lundby, C., Pilegaard, H., van Hall, G., Sander, M., Calbet, J., Loft, S., and Moller, P. (2003) Oxidative DNA damage and repair in skeletal muscle of humans exposed to high-altitude hypoxia. Toxicology 192, 229 –236 Lundby, C., Gassmann, M., and Pilegaard, H. (2006) Regular endurance training reduces the exercise induced HIF-1alpha and HIF-2alpha mRNA expression in human skeletal muscle in normoxic conditions. Eur. J. Appl. Physiol. 96, 363–369 Wojtaszewski, J. F., Hansen, B. F., Kiens, B., and Richter, E. A. (1997) Insulin signalling in human skeletal muscle: time course and effect of exercise. Diabetes 46, 1775–1781 Radegran, G., and Saltin, B. (1999) Nitric oxide in the regulation of vasomotor tone in human skeletal muscle. Am. J. Physiol. 276, H1951–H1960 Dinenno, F. A., and Joyner, M. J. (2003) Blunted sympathetic vasoconstriction in contracting skeletal muscle of healthy humans: is nitric oxide obligatory? J. Physiol. 553, 281–292 Thomas, G. D., Sander, M., Lau, K. S., Huang, P. L., Stull, J. T., and Victor, R. G. (1998) Impaired metabolic modulation of alpha-adrenergic vasoconstriction in dystrophin-deficient skeletal muscle. Proc. Natl. Acad. Sci. U. S. A. 95, 15090 –15095 Sander, M., Chavoshan, B., Harris, S. A., Iannaccone, S. T., Stull, J. T., Thomas, G. D., and Victor, R. G. (2000) Functional muscle ischemia in neuronal nitric oxide synthase-deficient skeletal muscle of children with Duchenne muscular dystrophy. Proc. Natl. Acad. Sci. U. S. A. 97, 13818 –13823 Northoff, H., and Berg, A. (1991) Immunologic mediators as parameters of the reaction to strenuous exercise. Int. J. Sports. Med. 12 Suppl. 1, S9 –S15 Nieman, D. C., Nehlsen-Cannarella, S. L., Fagoaga, O. R., Henson, D. A., Utter, A., Davis, J. M., Williams, F., and Butterworth, D. E. (1998) Influence of mode and carbohydrate on the cytokine response to heavy exertion. Med. Sci. Sports Exerc. 30, 671– 678 Suzuki, K., Nakaji, S., Yamada, M., Totsuka, M., Sato, K., and Sugawara, K. (2002) Systemic inflammatory response to exhaustive exercise. Cytokine kinetics. Exerc. Immunol. Rev. 8, 6 – 48 Hiscock, N., Chan, M. H. S., Bisucci, T., Darby, I. A., and Febbraio, M. A. (2004) Skeletal myocytes are a source of interleukin-6 mRNA expression and protein release during contraction: evidence of fiber type specificity. FASEB J. 18, 992–994 Plomgaard, P., Penkowa, M., and Pedersen, B. K. (2005) Fiber type specific expression of TNF-alpha, IL-6 and IL-18 in human skeletal muscles. Exerc. Immunol. Rev. 11, 53– 63 Akerstrom, T., Steensberg, A., Keller, P., Keller, C., Penkowa, M., and Pedersen, B. K. (2005) Exercise induces interleukin-8 expression in human skeletal muscle. J. Physiol. 563, 507–516 Keller, C., Steensberg, A., Pilegaard, H., Osada, T., Saltin, B., Pedersen, B. K., and Neufer, P. D. (2001) Transcriptional activation of the IL-6 gene in human contracting skeletal muscle: influence of muscle glycogen content. FASEB J. 15, 2748 –2750 Steensberg, A., Febbraio, M. A., Osada, T., Schjerling, P., van Hall, G., Saltin, B., and Pedersen, B. K. (2001) Interleukin-6 production in contracting human skeletal muscle is influenced by pre-exercise muscle glycogen content. J. Physiol. 537, 633– 639 Febbraio, M. A., Steensberg, A., Keller, C., Starkie, R. L., Nielsen, H. B., Krustrup, P., Ott, P., Secher, N. H., and Pedersen, B. K. (2003) Glucose ingestion attenuates interleukin-6 release from contracting skeletal muscle in humans. J. Physiol. 549, 607– 612 Maass, D. L., White, J., and Horton, J. W. (2005) Nitric oxide donors alter cardiomyocyte cytokine secretion and cardiac function. Crit. Care Med. 33, 2794 –2803 Villarete, L. H., and Remick, D. G. (1995) Nitric oxide regulation of IL-8 expression in human endothelial cells. Biochem. Biophys. Res. Commun. 211, 671– 676 Kalra, D., Baumgarten, G., Dibbs, Z., Seta, Y., Sivasubramanian, N., and Mann, D. L. (2000) Nitric oxide provokes tumor necrosis factor-alpha expression in adult feline myocardium
NITRIC OXIDE CONTROL OF MYOKINE PRODUCTION
51.
52.
53. 54.
55. 56.
57. 58.
59.
60.
61.
62.
63.
64.
65.
66. 67.
68.
through a cGMP-dependent pathway. Circulation 102, 1302– 1307 Pae, H. O., Oh, G. S., Choi, B. M., Kim, Y. M., and Chung, H. T. (2005) A molecular cascade showing nitric oxide-heme oxygenase-1-vascular endothelial growth factor-interleukin-8 sequence in human endothelial cells. Endocrinology 146, 2229 –2238 Vesely, M. J., Exon, D. J., Clark, J. E., Foresti, R., Green, C. J., and Motterlini, R. (1998) Heme oxygenase-1 induction in skeletal muscle cells: hemin and sodium nitroprusside are regulators in vitro. Am. J. Physiol. 275, C1087–C1094 Malyshev, I. Y., Manukhina, E. B., Mikoyan, V. D., Kubrina, L. N., and Vanin, A. F. (1995) Nitric oxide is involved in heat-induced HSP70 accumulation. FEBS Lett. 370, 159 –162 Hiscock, N., Fischer, C. P., Pilegaard, H., and Pedersen, B. K. (2003) Vascular endothelial growth factor mRNA expression and arteriovenous balance in response to prolonged, submaximal exercise in humans. Am. J. Physiol. 285, H1759 –H1763 Pilegaard, H., and Neufer, P. D. (2004) Transcriptional regulation of pyruvate dehydrogenase kinase 4 in skeletal muscle during and after exercise. Proc. Nutr. Soc. 63, 221–226 Civitarese, A. E., Hesselink, M. K., Russell, A. P., Ravussin, E., and Schrauwen, P. (2005) Glucose ingestion during exercise blunts exercise-induced gene expression of skeletal muscle fat oxidative genes. Am. J. Physiol. 289, E1023–E1029 Jørgensen, S. B., Richter, E. A., and Wojtaszewski, J. F. P. (2006) Role of AMPK in skeletal muscle metabolic regulation and adaptation in relation to exercise. J. Physiol. 574, 17–31 Winder, W. W., Holmes, B. F., Rubink, D. S., Jensen, E. B., Chen, M., and Holloszy, J. O. (2000) Activation of AMP-activated protein kinase increases mitochondrial enzymes in skeletal muscle. J. Appl. Physiol. 88, 2219 –2226 Stoppani, J., Hildebrandt, A. L., Sakamoto, K., CameronSmith, D., Goodyear, L. J., and Neufer, P. D. (2002) AMPactivated protein kinase activates transcription of the UCP3 and HKII genes in rat skeletal muscle. Am. J. Physiol. 283, E1239 –E1248 Du, J.-H., Xu, N., Song, Y., Xu, M., Lu, Z.-Z., Han, C., and Zhang, Y.-Y. (2005) AICAR stimulates IL-6 production via p38 MAPK in cardiac fibroblasts in adult mice: A possible role for AMPK. Biochem. Biophys. Res. Commun. 337, 1139 –1144 MacDonald, C., Wojtaszewski, J. F., Pedersen, B. K., Kiens, B., and Richter, E. A. (2003) Interleukin-6 release from human skeletal muscle during exercise: relation to AMPK activity. J. Appl. Physiol. 95, 2273–2277 Zou, M.-H., Hou, X.-Y., Shi, C.-M., Kirkpatick, S., Liu, F., Goldman, M. H., and Cohen, R. A. (2003) Activation of 5-AMPactivated kinase is mediated through c-Src and phosphoinositide 3-kinase activity during hypoxia-reoxygenation of bovine aortic endothelial cells. Role of peroxynitrite. J. Biol. Chem. 278, 34003–34010 Zou, M.-H., Kirkpatick, S., Davis, B. J., Nelson, J. S., Wiles, I. V. W. G., Schlattner, U., Neumann, D., Brownlee, M., Freeman, M. B., and Goldman, M. H. (2004) Activation of the AMP-activated protein kinase by the anti-diabetic drug metformin in vivo. Role of mitochondrial reactive nitrogen species. J. Biol. Chem. 279, 43940 – 43951 Higaki, Y., Hirshman, M. F., Fujii, N., and Goodyear, L. J. (2001) Nitric oxide increases glucose uptake through a mechanism that is distinct from the insulin and contraction pathways in rat skeletal muscle. Diabetes 50, 241–247 Lei, B., Matsuo, K., Labinskyy, V., Sharma, N., Chandler, M. P., Ahn, A., Hintze, T. H., Stanley, W. C., and Recchia, F. A. (2005) Exogenous nitric oxide reduces glucose transporters translocation and lactate production in ischemic myocardium in vivo. Proc. Natl. Acad. Sci. U. S. A. 102, 6966 – 6971 Birk, J. B., and Wojtaszewski, J. F. P. (2006) Predominant ␣2/2/␥3 AMPK activation during exercise in human skeletal muscle. J. Physiol. 577, 1021–1032 Denk, A., Goebeler, M., Schmid, S., Berberichi, I., Ritz, O., Lindemanni, D., Ludwig, S., and Wirth, T. (2001) Activation of NF-B via the IB kinase complex is both essential and sufficient for proinflammatory gene expression in primary endothelial cells. J. Biol. Chem. 276, 28451–28458 Tuyt, L. M., Dokter, W. H., Birkenkamp, K., Koopmans, S. B., Lummen, C., Kruijer, W., and Vellenga, E. (1999) Extracellularregulated kinase 1/2, Jun N-terminal kinase, and c-Jun are
2693
69.
70. 71.
72.
2694
involved in NF-kappa B-dependent IL-6 expression in human monocytes. J. Immunol. 162, 4893– 4902 Baeza-Raja, B., and Munoz-Canoves, P. (2004) p38 MAPKinduced nuclear factor-kappa B activity is required for skeletal muscle differentiation: role of interleukin-6. Mol. Biol. Cell 15, 2013–2026 Ji, L. L., Gomez-Cabrera, M.-C., Steinhafel, N., and Vina, J. (2004) Acute exercise activates nuclear factor (NF) -B signalling pathway in rat skeletal muscle. FASEB J. 18, 1499 –1506 Ho, R. C., Hirshman, M. F., Li, Y., Cai, D., Farmer, J. R., Aschenbach, W. G., Witczak, C. A., Shoelson, S. E., and Goodyear, L. J. (2005) Regulation of IB kinase and NFB in contracting adult rat skeletal muscle. Am. J. Physiol. 289, C794 – C801 Umansky, V., Hehner, S. P., Dumont, A., Hofmann, T. G., Schirrmacher, V., Droge, W., and Schmitz, M. L. (1998) Costimulatory effect of nitric oxide on endothelial NF-kappaB implies a physiological self-amplifying mechanism. Eur. J. Immunol. 28, 2276 –2282
Vol. 21
September 2007
73.
Miki, C., Iriyama, K., Mayer, A. D., Buckels, J. A., Harrison, J. D., Suzuki, H., and McMaster, P. (1999) Energy storage and cytokine response in patients undergoing liver transplantation. Cytokine 11, 244 –248 74. Jung, J. E., Lee, J., Ha, J., Kim, S. S., Cho, Y. H., Baik, H. H., and Kang, I. (2004) 5-aminoimidazole-4-carboxamide-ribonucleoside enhances oxidative stress-induced apoptosis through activation of nuclear factor-B in mouse neuro 2a neuroblastoma cells. Neurosci. Lett. 354, 197–200 75. Chan, M. H. S., McGee, S. L. Watt, M. J., Hargreaves, M., and Febbraio, M. A. (2004) Altering dietary nutrient intake that reduces glycogen content leads to phosphorylation of nuclear p38 MAP kinase in human skeletal muscle: association with IL-6 gene transcription during contraction. FASEB J. 18, 1785–1787
The FASEB Journal
Received for publication October 19, 2006. Accepted for publication March 26, 2007.
STEENSBERG ET AL.
