... Biological Research and Evaluation, Food and Drug Administration, Washington, D.C. 20204,1 .... G5, G6, G8, GIO, or GIlstrain; no amplification was obtained.
JOURNAL
OF
CLINICAL MICROBIOLOGY, May 1994,
p.
1338-1340
Vol. 32, No. 5
0095-1137/94/$04.00+0 Copyright © 1994, American Society for Microbiology
NOTES Identification of Bovine and Porcine Rotavirus G Types by PCR VERA GOUVEA,1* NORMA SANTOS,1 AND MARIA DO CARMO TIMENETSKY1'
Division of Molecular Biological Research and Evaluation, Food and Drug Administration, Washington, D.C. 20204,1 and Virology Laboratoty, Instituto Adolfo Lutz, Sdo Paulo, Brazil2 Received 15 December 1993/Returned for modification 25 January 1994/Accepted 17 February 1994
A new seminested PCR typing assay has been extended to identify the important veterinary rotavirus serotypes G5, G6, G10, and Gll, as well as the rare human serotype G8. The specificity of the method was evaluated with 30 standard laboratory strains of the Gl to G6 and G8 to Gll types. Rotavirus strain types G6 and G8, not previously recognized in pigs, were identified in field specimens of porcine origin.
Group A rotaviruses are the leading cause of acute gastroenteritis in children and young animals of many species throughout the world. Development of a safe and efficacious pediatric vaccine is needed to control severe dehydrating disease and prevent costly hospitalization (4). Several candidates of live animal rotavirus strains or reassortants containing the VP7 gene of the major human serotypes in an animal background virus have been evaluated in clinical trials with various degrees of success. The rotavirus genome consists of 11 segments of doublestranded RNA surrounded by double-shelled capsids. The outer capsid contains two proteins, VP7 and VP4, that independently evoke neutralizing antibodies, although their relative importance in protective immunity in humans has yet to be established (4). Classification of rotaviruses is based on the specificity of the viral VP7 antigen, or G serotype, and its VP4 antigen, or P serotype. To date, 14 G serotypes have been defined by neutralization assays with hyperimmune sera: 13 in mammals, including the newly described human G12 and equine G13 and G14, and one serotype (G7) in birds (1, 4, 20). Serotypes Gi to G4 have been most frequently associated with diarrhea in humans and constitute the targets of current vaccine development, whereas the less common human serotypes G8 and G9 have been only rarely associated with disease. Natural infections with those G types, however, have not been restricted to humans; they have also been recovered from a few animal host species or, in the case of serotype G3, from a variety of species (4, 10). Rotavirus serotypes G6 and G10 are major bovine pathogens that have recently been recovered from diarrheic children and healthy human neonates (2, 5, 22). Serotypes G5 and Gll have been prevalent in pigs, although G5 has also been recovered from horses with acute gastroenteritis (1 1). Determination of rotavirus serotypes has been classically performed by neutralization assay of cell-adapted strains or has been performed directly with clinical specimens by enzyme immunoassay with neutralizing monoclonal antibodies (4, 14). Recently, molecular methods, such as probe hybridization and PCR amplification, have been developed to type rotaviruses (7, 16, 17). Genotyping has gained widespread acceptance as an alternative approach to rotavirus serotyping. It correlates well
with viral antigenic specificity, uses universal synthetic reagents, and allows rapid examination of a large number of specimens. We have extended our original PCR typing assay developed to characterize human rotavirus serotypes (7) to embrace the veterinary-relevant serotypes G5, G6, G10, and Gll. We describe here a new and complementary assay that includes an improved means of identifying the G8 serotype. Thirty well-characterized, cell-culture-adapted animal and human rotaviruses of known G serotypes were used to develop and test the new G typing assay. The following animal rotaviruses were used: G6 bovine strains WC3, NCDV, UK, OK, C486, and B641; GlO bovine strains B223 and Cr; G5 porcine strains OSU and EE and G5 equine strain H1; G4 porcine strains Gottfried and SB1A; G3 equine strains H2 and FI14; and Gll porcine strain YM. The following human rotaviruses were used: Gi strains Wa, 0, and M37; G2 strains DS1, RV5, and SC2; G3 strains P and HCR3; G4 strains Hochi and CC4; G8 strains 69M and B37; and G9 strains W161 and F45. In addition, 15 fecal specimens of an unknown G type obtained from field outbreaks of rotavirus diarrhea in cattle (8 samples) and in pigs (7 samples) in the United States were tested with the new PCR typing assay. Rotavirus double-stranded RNA was extracted and purified by treatment with guanidinium isothiocyanate, hydroxyapatite, and cetyltrimethylammonium bromide, as described by Santos and Gouvea (18), and was used as the template for reverse transcription and first PCR amplification as previously described (7). Primer Beg9 and a degenerate mixture of End9 primers (dEnd9) (8) were used to amplify full-length copies of the rotavirus VP7 gene under PCR conditions of 30 cycles of 94°C for 1 min, 42°C for 2 min, and 72°C for 1 min. Aliquots of 0.2 RI, or, preferably, 2 [lI of a 1:100 dilution, of the first PCR product were subjected to the seminested PCR typing assay with the A pool of primers. This pool consisted of the sense typing primers FT5, DT6, HT8, ET10, and BT11 specific for the serotypes G5, G6, G8, G10, and G11, respectively, and the conserved antisense primer sBeg9, which is a shorter version of primer Beg9. The sequences of the typing primers, their positions in the genomic segment, the prototype viruses from which the sequences were taken, and the expected segment lengths are displayed in Table 1 and Fig. 1. Amplification was performed essentially as described previously (7) under the following PCR conditions: 25 cycles of denaturing at 94°C for 1 min, annealing at 55°C for 2 min, and extension at 72°C for
* Corresponding author. Mailing address: 1220 North Pierce St., 701, Arlington, VA 22209. Phone: (703) 522-8431.
1338
NOTES
VOL. 32, 1994 TABLE 1. Oligonucleotide primers that constitute the A pool of PCR typing primers Primer
sBeg9 FT5 DT6 HT8
Position
Sequence (5'-3')
G strain
1-21 Wa GGCTTTAAAAGAGAGAATTTC CATGTACTCGTTGTTACGTC 779-760 OSU (G5)
CTAGTTCCTGTGTAGAATC CGGTTCCGGATTAGACAC ETIO TTCAGCCGTTGCGACTTC BT11 GTCATCAGCAATCTGAGTTGC
499-481 273-256 714-697 336-316
UK (G6) B37 (G8) B223 (GIO) YM (GIl)
N1
1
2 3 4
5
6
8
1339
9 10 11 M
Accession no.' K02033 X04613
K00037 J04334
X52650 M23194
a EMBL-GenBank accession number.
1 min. PCR products (5 [I) were analyzed by electrophoresis on a 1.2% agarose-ethidium bromide minigel in Tris borate buffer (7). Excellent specificity was obtained with the A pool of typing primers, as shown for the prototype G strains in Fig. 2. Thus, a single amplicon of the expected size was obtained for each G5, G6, G8, GIO, or GIl strain; no amplification was obtained for strains of other G types (Gl to G4 and G9). The serotypes of the other 20 well-characterized laboratory strains of animal and human rotavirus of serotypes GI to G6 and G8 to GIl were correctly identified (or were appropriately not amplified) by the new method, attesting to its specificity and validity. Similar results were obtained when each of the newly designed typing primers that constitute the A pool was used singly with the generic sBeg9 primer in individual PCR typing assays. The only exception was primer FT5, which weakly amplified G8 strains 69M and B37. This was not surprising, since oligonucleotide primer FT5 has only three mismatches with the nucleic acid sequences of G8 strains, which is about the limit of mismatches tolerated at the chosen annealing temperature of 55°C. In the presence of G8-specific primer HT8, as in the A pool, however, this cross-amplification is completely eliminated because the shorter segment amplified by HT8 is preferentially formed over the larger segment amplified by FT5. Selection of the new typing primers was based on our original strategy devised to identify human G serotypes (7). Thus, each type-specific primer was derived from a distinct variable region in the VP7 gene. These variable regions are discrete nucleic acid sequences characteristic of each G type and presumed to encode type-specific epitopes on VP7 (4). In fact, all five variable regions used in the present study have been confirmed as containing neutralization sites by sequence analysis of escape mutants selected with neutralizing monoclonal antibodies (3, 12). Nevertheless, intertypic sequence homologies within variable regions have also been demonstrated, such as those between G8 and G5 in variable region F (nucleotides 756
Beg 9 s
HT8 BT11
DT6
ET10
FT5
Beg 9
337 bpi
780 bp
FIG. 1. Rotavirus mRNA strand of VP7 gene, location of the A typing primers and expected lengths of amplified segments.
FIG. 2. PCR typing assay with the A pool of primers. Lane numbers correspond to the G types of strains as follows: 1, Wa; 2, DS l; 3, P; 4, Hochi; 5, OSU; 6, UK; 8, B37; 9, W161; 10, B223; and 11, YM. Lanes M, 100-bp markers with highlighted 600-bp segment.
to 774) and those between G8 and G3 in region E (nucleotides 477 to 505) (9). Sharing of variable regions between types presented some difficulties in the designing of type-specific primers and resulted in amplification of G8 strains by the G3-specific primer aET3 in our original PCR typing assay (7) and by G5-specific primer FT5, if used singly, in the present study. We have therefore designed a new G8-specific primer, HT8, to be included in the A pool of primers to completely eliminate amplification of G8 strains by FF5 primer in the present PCR A typing assay and to provide a means of confirming G8 strains identified by the previous PCR typing method. We examined 15 field specimens of bovine and porcine origins by the PCR A typing assay. All bovine fecal specimens had rotavirus strains of the conventional bovine types G6 (six specimens) and GIO (one specimen) or a mixture of both (one specimen). On the other hand, quite diverse and unusual types were found in the limited number of porcine fecal specimens. One was of the common porcine serotype G5, but two were G6, one was G8, and three remained untypeable. The presence of G5 and G6 rotaviruses in those specimens was confirmed by enzyme immunoassay with a panel of monoclonal antibodies specific for serotypes GI to G6 (14). The G8 sample was unreactive in the enzyme immunoassay but was recognized by primers ET3 and FF5 in individual PCR assays, as would be expected for a G8 rotavirus strain (see above). Cell adaptation and further analyses of these viruses are under way. Types G6 and G8 have not been previously recognized in pigs. G6, the most prevalent bovine serotype, has recently been recovered from two children with gastroenteritis in Italy (5), whereas G8, a serotype first described in children in Indonesia (13) and later described in Europe (6), has been recovered from cattle in Thailand (21), Scotland (19), and the United States (15). Although a novelty, the finding of type G6 and G8 rotavirus strains in pigs is not surprising in view of accumulating evidence for occasional but widespread transmission of group A rotaviruses from one animal species to another in nature (10, 22). The availability of molecular methods to identify rotavirus genotypes, such as the one described here, as an alternative to serotyping had facilitated and should intensify studies on the occurrence and distribution of individual G types in different animal populations.
1340
J. CLIN. MICROBIOL.
NOTES
We thank Yasutaka Hoshino, Linda Saif, Gerald Woode, H. Fred Clark, and Enzo Palombo for providing rotavirus strains used in this study and Harry Greenberg for providing monoclonal antibodies. N.S. is a recipient of a fellowship from Conselho Nacional do Desenvolvimento Cientifico e Tecnol6gico (CNPq), Brasilia, Brazil.
REFERENCES 1. Browning, G. F., T. A. Fitzgerald, R. M. Chalmers, and D. R. Snodgrass. 1991. A novel group A rotavirus G serotype: serological and genomic characterization of equine isolate F123. J. Clin. Microbiol. 29:2043-2046. 2. Dunn, S. J., H. B. Greenberg, R. L. Ward, 0. Nakagomi, J. W. Burns, P. T. Vo, K. A. Pax, M. Das, K. Gowda, and C. D. Rao. 1993. Serotypic and genotypic characterization of human serotype 10 rotaviruses from asymptomatic neonates. J. Clin. Microbiol. 31:165-169. 3. Dyall-Smith, M. L., I. Lazdins, G. W. Tregear, and I. H. Holmes. 1986. Location of the major antigenic sites involved in rotavirus serotype-specific neutralization. Proc. Natl. Acad. Sci. USA 83: 3465-3468. 4. Estes, M. K., and J. Cohen. 1989. Rotavirus gene structure and function. Microbiol. Rev. 53:410-449. 5. Gerna, G., A. Sarasini, M. Parea, S. Arista, P. Miranda, H. Brussow, Y. Hoshino, and J. Flores. 1992. Isolation and characterization of two distinct human rotavirus strains with G6 specificity. J. Clin. Microbiol. 30:9-16. 6. Gerna, G., A. Sarasini, L. Zentilin, A. Di Mateo, P. Miranda, M. Parea, M. Battaglia, and G. Milanesi. 1990. Isolation in Europe of 69M-like (serotype 8) human rotavirus strains with either subgroup I or II specificity and a long RNA electropherotype. Arch. Virol. 112:27-40. 7. Gouvea, V., R. I. Glass, P. Woods, K. Taniguchi, H. F. Clark, B. Forrester, and Z.-Y. Fang. 1990. Polymerase chain reaction amplification and typing of rotavirus nucleic acid from stool specimens. J. Clin. Microbiol. 28:276-282. 8. Gouvea, V., C. Ramirez, B. Li, N. Santos, L. Saif, H. F. Clark, and Y. Hoshino. 1993. Restriction endonuclease analysis of the vp7 genes of human and animal rotaviruses. J. Clin. Microbiol. 31:917923. 9. Hum, C. P., M. L. Dyall-Smith, and I. H. Holmes. 1989. The VP7 gene of a new G serotype of human rotavirus (B37) is similar to G3 proteins in the antigenic C region. Virology 170:55-61. 10. Hussein, H. A., A. V. Parwani, B. I. Rosen, A. Lucchelli, and L. J. Saif. 1993. Detection of rotavirus serotypes Gl, G2, G3, and Gll in feces of diarrheic calves by using polymerase chain reactionderived cDNA probes. J. Clin. Microbiol. 31:2491-2496. 11. Imagawa, H., T. Tanaka, K. Sekiguchi, Y. Fukunaga, T. Anzai, N. Minamoto, and M. Kamada. 1993. Electropherotypes, serotypes,
12.
13. 14.
15.
16.
17.
18. 19.
20.
21.
22.
and subgroups of equine rotaviruses isolated in Japan. Arch. Virol. 131:169-176. Kirkwood, C., P. J. Masendyck, and B. S. Coulson. 1993. Characteristics and location of cross-reactive and serotype-specific neutralization sites on VP7 of human G type 9 rotaviruses. Virology 196:79-88. Matsuno, S., A. Hasegawa, A. Mukoyama, and S. Inouye. 1985. A candidate for a new serotype of human rotavirus. J. Virol. 54: 623-624. Padilla-Noriega, L., C. F. Arias, S. L6pez, F. Puerto, D. R. Snodgrass, K. Taniguchi, and H. B. Greenberg. 1990. Diversity of rotavirus serotypes in Mexican infants with gastroenteritis. J. Clin. Microbiol. 28:1114-1119. Parwani, A. V., H. A. Hussein, B. I. Rosen, A. Lucchelli, L. Navarro, and L. J. Saif. 1993. Characterization of field strains of group A bovine rotaviruses by using polymerase chain reactiongenerated G and P type-specific cDNA probes. J. Clin. Microbiol. 31:2010-2015. Parwani, A. V., B. I. Rosen, J. Flores, M. A. McCrae, M. Gorziglia, and L. J. Saif. 1992. Detection and differentiation of bovine group A rotavirus serotypes using polymerase chain reaction-generated probes to the VP7 gene. J. Vet. Diagn. Invest. 4:148-158. Rosen, B. I., L. J. Saif, D. J. Jackwood, and M. Gorziglia. 1990. Serotypic differentiation of group A rotaviruses with porcine rotavirus gene 9 probes. J. Clin. Microbiol. 28:2526-2533. Santos, N., and V. Gouvea. 1994. Improved method for purification of viral RNA from fecal specimens for rotavirus detection. J. Virol. Methods 46:11-21. Snodgrass, D. R., T. Fitzgerald, I. Campbell, F. M. M. Scott, G. F. Browning, D. L. Miller, A. J. Herring, and H. B. Greenberg. 1990. Rotavirus serotypes 6 and 10 predominate in cattle. J. Clin. Microbiol. 28:504-507. Taniguchi, K., T. Urasawa, N. Kobayashi, M. Gorziglia, and S. Urasawa. 1990. Nucleotide sequence of VP4 and VP7 genes of human rotaviruses with subgroup I specificity and long RNA pattern: implication for new G serotype specificity. J. Virol. 64:5640-5644. Taniguchi, K., T. Urasawa, Y. Pongsuwanna, M. Choonthanom, C. Jayavasu, and S. Urasawa. 1991. Molecular and antigenic analyses of serotype 8 and 10 of bovine rotaviruses in Thailand. J. Gen. Virol. 72:2929-2937. Urasawa, S., A. Hasegawa, T. Urasawa, K. Taniguchi, F. Wakasugi, H. Suzuki, S. Inouye, B. Ponprot, J. Supawadee, S. Suprasert, P. Rangsiyanound, S. Tonusin, and Y. Yamazi. 1992. Antigenic and genetic analyses of human rotaviruses in Chiang Mai, Thailand: evidence for a close relationship between human and animal rotaviruses. J. Infect. Dis. 166:227-234.
