Nova Southeastern University
NOTICE: WARNING CONCERNING
Health Professions Division Library InterLibrary Loan and Document Delivery Unit Room 3115
COPYRIGHT RESTRICTIONS
3200 South University Drive Ft. Lauderdale, FL 33328 (954) 262-3115 or ext. 2-3115 (954) 262-3120 or ext. 2-3120 Email :
[email protected] http://nova.campusguides.com/hpdilll
THE COPYRIGHT LAW OF THE UNITED STATES (TITLE 17, UNITED STATES CODE) GOVERNS THE MAKING OF THE PHOTOCOPIES OR OTHER REPRODUCTIONS OF COPYRIGHTED MATERIALS. Any electronic copy or copies, photocopies or any other type of reproduction of this article or other distribution of this copyrighted material may be an infringement of the COPYRIGHT LAW. This copy is not to be used for any purpose other than private study, scholarship or research [section 107]. If a user makes or later uses any form of reproduction of this copyrighted work for purposes in excess of section 107, FAIR USE, that user may be liable for copyright infringement.
1545
Send Orders for Reprints to
[email protected] Current Drug Targets, 2017, 18, 1545-1557
RESEARCH ARTICLE ISSN: 1389-4501 eISSN: 1873-5592
Pharmacological Effects of Turmeric on Learning, Memory and Expression of Muscarinic Receptor Genes (M1, M3 and M5) in Stress-induced Mouse Model
Impact Factor: 3.236
BENTHAM SCIENCE
Aliya Khalid1,¥, Rabia Shakeel1,¥, Saira Justin1, Ghazala Iqbal1, Syed Adnan Ali Shah2,3, Saadia Zahid1 and Touqeer Ahmed1,* 1
Neurobiology Laboratory, Department of Healthcare Biotechnology, Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Sector H-12, Islamabad – 44000, Pakistan; 2Faculty of Pharmacy, Universiti Teknologi MARA, Puncak Alam Campus, 42300 Bandar Puncak Alam, Selangor Darul Ehsan, Malaysia; 3 Atta-ur-Rahman Institute for Natural Product Discovery (AuRIns), Universiti Teknologi MARA, Puncak Alam Campus, 42300 Bandar Puncak Alam, Selangor Darul Ehsan, Malaysia Abstract: Background: Stress is involved in memory impairment through multiple mechanisms, including activation of hypothalamic-pituitary axis, which in turn activates release of corticosterone in blood. Cholinergic system blockade by the muscarinic antagonist, scopolamine, also impairs memory. Objective: This study aimed to investigate the effect of turmeric (20mg/kg) on learning and memory and cholinergic system in a mouse model of stress along with cholinergic blockade. ARTICLE HISTORY Received: June 16, 2016 Revised: July 14, 2016 Accepted: January 09, 2017
Current Drug Targets
DOI: 10.2174/1389450118666170315120627
Methods: Restrained stress was induced and cholinergic receptors were blocked using scopolamine in mice. Animals were treated with turmeric (turmeric rhizome powder which was also subjected to NMR analyses) and learning and social behavior was examined. Effect of turmeric on cholinergic muscarinic receptors (mAChR; M1, M3 and M5) gene expression was assessed by RT-PCR in both pre-frontal cortex and hippocampus. Results: Ar-turmerone, curcuminoids and α-linolenic acid were the lead compounds present in turmeric extract. Increased serum corticosterone levels were observed in stressed mice when compared to the control group, while turmeric treatment significantly reduced serum corticosterone level. Turmeric treatment caused an improved learning and memory in Morris water maze test in stressed animals. Social novelty preference was also restored in turmeric treated animals. Following turmeric treatment, M5 expression was improved in the cortex and M3 expression was improved in the hippocampus of stress + scopolamine + turmeric treated group. Conclusions: These findings highlight the therapeutic role of turmeric by increasing the expression of M3, M5 and improving learning and memory. Turmeric can be an effective candidate for the treatment of amnesia caused by the stress.
Keywords: Corticosterone, social behavior, cholinergic system, scopolamine, turmeric. 1. INTRODUCTION Stress is a condition of vulnerable stability causing numerous changes in the central nervous system, endocrine and immune system and in tissue metabolism [1, 2]. Stress is not only life threatening, but has deleterious effect on an organism’s ability to learn and memorize [3]. Restraint stress is the physical and psychological stress in which mice are deprived of food and water, and are unable to move their body. It is a model of chronic stress in rodents that gradually leads to neuronal remodeling of limbic regions such as *Address correspondence to this author at the Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Sector H-12, Islamabad - 44000, Pakistan; Tel: + 92-51-9085-6141; Fax: + 9251-9085-6102; E-mails:
[email protected];
[email protected]
pre-frontal cortex (PFC) [4] and hippocampal CA1 [5] and CA3 neurons. Chronic stress is also used as a model for studying depression and anorexia nervosa [6]. Stress is responsible for causing impairment in working memory [7], induces anxiety, and depressive-like behavior. Glucocorticoids are used as biomarkers for measuring stress level [8] in blood. The major glucocorticoid present in the rodent is corticosterone [9]. During stressful conditions, hypothalamo– pituitary-adrenocortical (HPA) system is activated, which raises corticosterone level in the plasma [10]. Corticosterone being lipophilic in nature readily enters brain and binds to the two major receptors, high-affinity mineralocorticoid receptors (MR) and low affinity glucocorticoid receptors (GR) in limbic area including hippocampus, amygdala and lateral septum [11]. This binding of corticosterone in the brain areas causes disruption of their structure and function [12].
¥ = Equal contributions 1873-5592/17 $58.00+.00
© 2017 Bentham Science Publishers
1546 Current Drug Targets, 2017, Vol. 18, No. 13
Khalid et al.
Muscarinic receptors are involved in cognitive learning [13]. There are five subtypes of mAChRs (M1-M5) and each is responsible for specific function [14]. M1-receptor is important in cognition in hippocampal CA1 neurons [15], M3 receptor is important in regulation of learning, memory and behavior as well as food intake [16], while M5 is crucial for acetylcholine-mediated cerebrovascular function and also in rewarding brain stimulation [17].
sciences, National University of Sciences and Technology in a controlled environment i.e. at a constant temperature of 25±2°C with a natural 14:10 hrs light-dark cycle. The animals were given normal tap water and a standard diet ad libitum consisting of 30% crude protein, 9% crude fat, 4% crude fiber and 10% moisture.
Scopolamine, a tropane alkaloid and a muscarinic acetylcholine receptor (mAChR) antagonist, is a very potent psychoactive drug that is used as a reference drug for inducing amnesia in mammals [18]. It affects learning, acquisition and short term memory and also decreases acetylcholine level in hippocampus [19]. It has been used as pharmacological model of inducing amnesia in experimental animals, to deteriorate their performances in various tasks depending upon intact working and reference memory [18]. It is not known that how muscarinic receptor blocking through the scopolamine could affect the stress responses. Therefore, it is important to understand the role of muscarinic receptors, because, loss of these receptors in old age is very common in dementias and is accompanied with stress-induced depression as a major clinical symptom.
The stress protocol was same as described previously [23], with some modifications. Body fit restrainers were made from 50 ml falcon tube made of plastic. The caps of these restrainers had a hole in it, so that the tail of animal can pass through it. Mice were placed daily in it such that they were unable to move their body. All the animals except controls were given stress for 4 hours and 30 minutes, daily for 26 days.
Turmeric (Curcuma longa) and its components, exhibit a wide variety of pharmacological activities including antiinflammatory, anti-amyloidogenic, antioxidant, wound healing, metal chelating properties, immune-modulatory and neuroprotective activities [20]. The hydrophobic compounds are present in nature due to which they can easily cross blood-brain barrier and accumulate in the brain [21, 22]. Keeping in view the significance of muscarinic receptors, we were interested to study their role in stress. Moreover, pharmacological significance of turmeric in various neurological disorders attracted us to investigate the therapeutic effect of turmeric on learning and social behavior in stress model and to determine its role on the modulation of muscarinic receptors expression. 2. MATERIALS AND METHODS 2.1. Chemicals and Drugs Scopolamine (S-1013) was purchased from Sigma, St. Louis, MO. The drug was dissolved in sterile saline solution immediately before use. Taq polymerase, 10mM dNTPs and Reverse Transcriptase enzyme were obtained from Fermentas®. Tri-reagent for Ribonucleic acid (RNA) extraction was from Invitrogen®. Normal saline was prepared as 0.9% solution of sodium chloride. 2.2. Animals All experiments performed were in compliance with the rulings of the Institute of Laboratory Animal Research, Division on Earth and Life Sciences, National Institute of Health, USA (Guide for the Care and Use of Laboratory Animals: Eighth Edition, 2011). The protocol was approved from the Internal Review Board (IRB), Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology. In this study 60 male BALB/c mice (3-4 months of age and weighting from 30-50 g) were used. Mice were housed at the Atta-ur-Rahman School of Applied Bio-
2.3. Restrain Stress
2.4. Drug Administration Experimental animals were weighed daily and normal saline (0.9%) or scopolamine (1mg/kg body weight) was given to them every day through subcutaneous injections using (30 gauge needle) insulin syringes [24, 25]. Animals were divided into five groups and given treatment (scopolamine and/or turmeric) for 26 days. These groups were designated as: (i) Control group (received saline according to the body weight). (ii) Stress group (received stress only). (iii) Stress + turmeric group (received stress along with turmeric mixed in feed to provide a dose of 20mg/kg/day for 26 days [26, 27]. (iv) Stress + scopolamine group (received scopolamine injection (for 26 days) after they were retrieved from stress, and behavior tests of these animals were performed after one hour of injection). (v) Stress + scopolamine + turmeric group (received stress, scopolamine and turmeric in feed). Pilot study was performed and we observed that 40 grams mouse consumes 5 grams of feed per day (average). So 40 grams of mice has to consume 0.8mg of turmeric (20mg/kg/day) in 5 grams of feed. The feed was prepared accordingly. 2.5. Nuclear Magnetic Resonance (NMR) Spectroscopic Analysis NMR spectroscopy technique is an extremely powerful and a widely used method for structure elucidation and analyses of chemical entities in natural product mixtures. The major advantage of high-resolution 1H and 13C NMR over other commonly used spectroscopic methods is that, it is intrinsically quantitative. 1H and 13C-NMR spectra of turmeric crude extract, standard samples of curcumin and arturmerone were recorded in deuterated Acetone on Bruker Avance III 600 MHz spectrometer. The chemical shifts (δ) were obtained in ppm, while Tetramethylsilane (TMS) is used as an internal reference standard during analysis of sample. 2.6. Behavior Testing Behavior tests were performed from 21st-26th day of treatment. The mice were shifted to the animal behavior room, 30 minutes prior to the beginning of the test trials in order to familiarize the mice to the environmental conditions.
Pharmacological Effects of Turmeric on Learning, Memory and Expression
The testing room was properly illuminated and the temperature was maintained at 25±2°C. 2.6.1. Morris Water Maze Test The test protocol was similar as described previously [28], with some modifications. The apparatus of a round steel pool (120cm diameter and 60cm height) was used having a submerged platform placed in the North-West quadrant, 1 cm below the surface of opaque water. The pool contains the high contrast spatial cues. Test was conducted on 21st day of treatment. A total of 5 trials were performed each day with 10 minutes of inter-trial interval for 5 days. The platform location was same throughout the test while the mouse release direction was different in each trial. Maximum trial duration was 90 seconds the time taken by mouse to reach platform was recorded and plotted as escape latency. On 26th day of treatment, probe trial was performed in which the platform was removed and time spend in the platform quadrant was recorded to assess the reference memory of mouse. 2.6.2. Social Preference Test Social preference for novelty test was performed according to a previously established protocol [29], with some modifications. The apparatus for this test was square box. Two small cylindrical hollow wire cages were placed in opposite corners of the box. The test consisted of two sessions each of 10 min with 20 min interval in between. In the first session (sociability test), one small cage had mouse (stranger 1), while the other cage was kept empty. The test animal was allowed to interact with mouse and empty cage and time of interaction was recorded. In the second session (social novelty preference), a second unfamiliar mouse (stranger 2), was introduced in the empty cage, while stranger 1 remained the same as it was in the first session. Interaction time of test animal was recorded with both the stranger 1 and stranger 2. Data was plotted and discrimination index was calculated as follow: DI = (time spent with stranger mouse) / (time spent with familiar + stranger mouse). 2.7. Corticosterone Measurement On 26thday of treatment, test animals were subjected to decapitation, brains were harvested and blood samples from Table 1.
Current Drug Targets, 2017, Vol. 18, No. 13
each animal were collected. Serum was isolated from blood by centrifugation at 12,000 rpm for 10 min in a centrifuge and it was transferred to an eppendorf tube. The serum was then stored at -80°C for further processing. Corticosterone levels were measured by means of Micro ELISA kit as per the manufacturer’s instructions. 2.8. Gene Expression Studies Gene expression analyses were done as explained earlier [30]. Briefly, hippocampus and prefrontal cortex were dissected and RNA was extracted using Trizole. cDNA was synthesized from extracted RNA using reverse transcriptase (RT) enzyme followed by the PCR amplification of desired gene using gene specific primers (Table 1). Each PCR product band was quantified for densitometry using NIH software “ImageJ”. 2.9. Statistical Analysis Data are expressed as mean ± standard error of mean (SEM; n= number of animals). Statistical analysis of the results was done using “Graphpad Prism” software (version 5.03). One-way ANOVA was applied following Bonferroni multiple comparison to analyze the significance of result. Results with p value less than 0.05 were taken as significant. 3. RESULTS 3.1. NMR Investigations of Turmeric Extract NMR analyses is known to be very useful for determination of components in a mixture, less time consuming, easy to perform, produces more accurate and precise results and leads to a higher reproducibility. The 1H NMR spectra (Fig. 1B) of Turmeric extracts in Acetone-d6 were also showed up field chemical shifts between δ 0.7-1.6 and down field chemical shift between δ 7.05-7.6, which indicated the presence of turmerone, ar-turmerone, and zingiberene (Fig. 1A). Further elaboration of 1H NMR spectra of extracts indicated aromatic protons resonated at downfield region between δ 7.1-7.8, which confirmed the presence of coloring agents called curcuminoids. Curcuminoids consist of curcumin, demethoxycurcumin, 5’methoxycurcumin, and dihydrocurcumin. The presence of aromatic system was further confirmed through 13C NMR spectra, which exhibited
List of primers used in study along with their respective annealing temperatures.
S. No
Gene
Primer Sequence (5’ to 3’)
AT*
No. of Cycles
1
Actin
GCCTTCCTTCTTGGGTATGG CAGCTCAGTAACAGTCCGC
55 ͦ C
32
2
M1
GTCCCATGGAAACCCTGAATCC ATGTTGGGACTGACAGCAGG
58 ͦ C
35
3
M3
TCTTCCTGAAAGCCAGATCCAG GTCACTGACTTAGTCGCCCG
57 ͦ C
35
4
M5
AGCACCTCAACAACGGGAAA GGGGATCCAGGCCTTTTGTT
57 ͦ C
32
*AT= Annealing temperature.
1547
1548 Current Drug Targets, 2017, Vol. 18, No. 13
Fig. (1). contd….
Khalid et al.
Pharmacological Effects of Turmeric on Learning, Memory and Expression
Current Drug Targets, 2017, Vol. 18, No. 13
1549
Fig. (1). contd….
1550 Current Drug Targets, 2017, Vol. 18, No. 13
Khalid et al.
Fig. (1). (A) Chemical structures of major components in turmeric extract. (B) 1HNMR spectra of turmeric extract in MeOD, DMSO-d6, CDCl3 and Acetone-d6. (C) Turmeric extract 1HNMR comparison with standard curcumin 1HNMR. (D) Turmeric extract 1HNMR comparison with standard ar-turmerone 1HNMR. (E) Turmeric extract 13CNMR comparison with standard curcumin 13CNMR. (F) Turmeric extract 13 CNMR comparison with standard ar-turmerone 13CNMR.
Pharmacological Effects of Turmeric on Learning, Memory and Expression
aromatic carbons resonated between δ 111.6-141.3 (Fig. 1E). Furthermore, NMR spectra (1H &13C) of turmeric extract were compared with standard samples of curcumin and turmeric, which further supported the presence of analogs of curcumin and turmeric (Fig. 1C-1F). Some additional peaks in up field chemical shift region between δ 1.7-3.5 also determined the presence of 3 fatty acid and -linolenic acid (Fig. 1B). All spectroscopic data were also showed well agreement with the previously published data [31]. 3.2. Effect of Turmeric on Serum Corticosterone Level Mice exposed to restrained stress showed elevated level of corticosterone (1.33 ± 0.13) along with those which were given stress and scopolamine together (1.28 ± 0.09) as compared to control group (0.45 ± 0.07). The serum corticosterone level was significantly reduced, although not to baseline levels, in groups treated with turmeric i.e., stress + turmeric (0.90 ± 0.08) and stress + scopolamine + turmeric (0.88 ± 0.09) in comparison to stress and stress + scopolamine group (Fig. 2).
***
*** *
*
Fig. (2). Corticosterone levels in mice serum. Comparison among control (CN), stress (St), stress and turmeric (St + T), stress and scopolamine (St + Sc) and stress, scopolamine and turmeric (St + Sc + T) groups. *** = p
