NOVEL METHOD FOR DETECTING HUMAN ...

NOVEL METHOD FOR DETECTING HUMAN POLYOMAVIRUSES IN ENVIRONMENTAL WATERS AS AN INDICATOR OF HUMAN SEWAGE POLLUTION

By SHANNON M. MCQUAIG

A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2005

Copyright 2005 by Shannon M. McQuaig

To my mom, my dad, and my uncle Jimmy.

ACKNOWLEDGMENTS I acknowledge my advisor Dr. Farrah for his guidance throughout my undergraduate and graduate studies. He was always supportive and encouraging. I also acknowledge my supervisory committee members, Dr. Keyhani and Dr. Kima. In addition, I would like to thank the entire Department of Microbiology and Cell Science. I thank Gainesville Regional Utilities (GRU) and CH2M Hill for allowing me to incorporate my work into their project and also for funding a part of this study. I specially thank Dr. Troy Scott. He is a great teacher, colleague, and (most of all) friend. Without his help and support this would not been possible. I thank Dr. George Lukasik for his supervision and expertise. I also extend my appreciation to Joel Caren for his help with the GRU samples. I would like to acknowledge my fellow graduate student, Johnny Davis, and our dishwasher and my best friend, Rene´ Nortman. They both made every day in the lab fun and entertaining. I also acknowledge my friend Kindra Kelly, who was always willing to lend an ear. I thank Adam Mayer for his support, understanding, and comic relief; and for being a much-needed distraction during the most stressful time of my graduate study: the end. Lastly, I thank my parents, Kathy and Gary McQuaig; and my uncle, James McQuaig. They gave me the love and foundation needed to accomplish everything that I have, and for that I will always be grateful.

iv

TABLE OF CONTENTS page ACKNOWLEDGMENTS ................................................................................................. iv LIST OF TABLES........................................................................................................... viii LIST OF FIGURES .............................................................................................................x ABSTRACT....................................................................................................................... xi CHAPTER 1

INTRODUCTION ........................................................................................................1 Human Pathogenic Bacteria Spread via Fecal-Oral Route...........................................1 Escherichia coli .....................................................................................................1 Shigella ..................................................................................................................2 Salmonella .............................................................................................................3 Vibrio.....................................................................................................................3 Campylobacter ......................................................................................................4 Human Pathogenic Viruses Spread via Fecal-Oral Route............................................4 Adenovirus ............................................................................................................4 Enterovirus ............................................................................................................5 Hepatitis A.............................................................................................................5 Rotavirus................................................................................................................6 Norovirus...............................................................................................................6 Human Pathogenic Protozoan Spread via Fecal-Oral Route........................................7 Entamoeba histolytica ...........................................................................................7 Giardia lambia ......................................................................................................7 Cryptosporidium parvum.......................................................................................8 Water Regulations ........................................................................................................8 Water Quality Indicators...............................................................................................9 Chemical Indicators of Fecal Pollution .................................................................9 Coprostanol ....................................................................................................9 Caffeine ........................................................................................................10 Whitening agents..........................................................................................10 Microbial Indicators of Fecal Pollution...............................................................10 Traditional microbial water quality indicators .............................................10 Microbial source tracking.............................................................................12

v

Viruses Shed in Urine..........................................................................................21 Polyomaviruses ............................................................................................21 Human polyomaviruses................................................................................21 Purpose of Study..................................................................................................23 Experimental Rationale .......................................................................................23 2

DETECTION OF HUMAN POLYOMAVIRUSES IN BOTH SEWAGE AND SEPTIC TANK SAMPLES AND THE ABSENCE OF HUMAN POLYOMAVIRUSES IN DAIRY WASTE ..............................................................24 Materials and Methods ...............................................................................................24 Collection of Samples..........................................................................................24 DNA Extraction ..........................................................................................................25 PCR Detection of HPyVs ....................................................................................25 Gel Electrophoresis of PCR Products..................................................................26 Excision of PCR Products from Agarose Gels....................................................26 Cloning of PCR Product......................................................................................26 Plasmid Isolation .................................................................................................27 Restriction Enzyme Analysis of Plasmids and DNA Sequencing.......................27 Sequence Analysis of PCR Product ....................................................................27 Limit of Detection of PCR for HPyVs in Sewage...............................................27 Results.........................................................................................................................28 Discussion...................................................................................................................28

3

DEVELOPMENT OF A METHOD TO CONCENTRATE AND DETECT HUMAN POLYOMAVIRUSES FROM WATER SAMPLES .................................34 Materials and Methods ...............................................................................................35 Sample Collection ...............................................................................................35 Sample Preparation..............................................................................................36 Virus Concentration on Micropourous Filters.....................................................36 QIAamp DNA Stool Kit (Qiagen, Inc., Valencia, CA).......................................36 QIAamp Viral RNA Kit (Qiagen, Inc., Valencia, CA) .......................................36 QIAamp MinElute Kit (Qiagen, Inc., Valencia, CA)..........................................37 QIAamp Blood DNA Midi Kit (Qiagen, Inc., Valencia, CA).............................37 HPyV Enzymatic Conditions: .............................................................................37 Agarose Gel Electrophoresis ...............................................................................38 SYBR-Gold Viral Direct Counts.........................................................................38 Range of Detection ..............................................................................................39 Results.........................................................................................................................39 Discussion...................................................................................................................40

vi

4

HUMAN POLYOMAVIRUSES AS INDICATORS OF HUMAN-DERIVED FECAL POLLUTION IN ENVIRONMENTAL WATER SAMPLES: THREE DIFFERENT INDICATORS OF HUMAN FECAL POLLUTION IN JACKSONVILLE AREA CANALS AND CREEKS................................................44 Materials and Methods ...............................................................................................44 Sample Collection ...............................................................................................44 Processing of Samples for Bacteroides Marker ..................................................45 Preparation of Bacteroidetes template DNA for PCR reactions ..................45 PCR primers and reaction conditions for Human Bacteroides marker detection..................................................................................................45 Processing of Samples for esp Detection ............................................................46 Isolation of enterococci ................................................................................46 PCR primers and reaction conditions...........................................................46 Processing of Samples for HPyV Detection........................................................47 Prefiltration of samples ................................................................................47 Virus concentration on micropourous filters................................................47 DNA extraction ............................................................................................47 HPyV enzymatic conditions.........................................................................47 Results.........................................................................................................................48 Discussion...................................................................................................................53

5

HUMAN POLYOMAVIRUSES AS INDICATORs OF HUMAN-DERIVED FECAL POLLUTION IN ENVIRONMENTAL WATER SAMPLES: FECAL INDICATORS IN GAINESVILLE'S URBAN CREEKS .........................................55 Materials and Methods ...............................................................................................56 Sample Collection ...............................................................................................56 Processing of Samples for Total Coliforms.........................................................56 Processing of Samples for Fecal Coliforms ........................................................56 Processing of Samples for Enterococci ...............................................................57 Processing of Samples for esp Detection ............................................................57 Processing of Samples for HPyV Detection........................................................57 Results.........................................................................................................................57 Discussion...................................................................................................................58

6

SUMMARY AND CONCLUSIONS .........................................................................64

LIST OF REFERENCES...................................................................................................68 BIOGRAPHICAL SKETCH .............................................................................................83

vii

LIST OF TABLES Table

page

2-1

Primers used to amplify the homologous t-antigen of BKV and JCV.* ..................29

2-2

HPyV detection in septic tank, raw sewage and dairy waste throughout a nine month period.* .........................................................................................................29

2-3

Detection of HPyVs in raw sewage from the University of Florida Water Reclamation Facility.* .............................................................................................30

3-1

Concentration and detection of HPyVs in water inoculated with sewage.* ............42

3-2

Direct counts of BKV using SYBR-Gold staining epifluorescence microscopy.....42

4-1

Sampling sites for Jacksonville area study...............................................................49

4-2

Results of 11/15/04 analysis for markers of human fecal pollution.........................49

4-3

Results of 12/13/04 analysis for markers of human fecal pollution.........................50

4-4

Results of 1/10/05 analysis for markers of human fecal pollution...........................50

4-5

Results of 2/8/05 analysis for markers of human fecal pollution.............................51

4-6


4-7


4-8

Results of 6/7/05 analysis for markers of human fecal pollution.............................52

4-9

Percent positive correlation of the three indicators used to identify human fecal pollution. ..................................................................................................................53

5-1

Results of October 2004 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs.......................................................60

5-2

Results of November 2004 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs...................................61

5-3

Results of January 2005 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs.......................................................62 viii

5-4

Results of February 2005 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs...................................62

5-5

Results of June 2005 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs.......................................................63

5-6

Guidelines for total coliforms, fecal coliforms, E. coli, and enterococci in surface waters.*........................................................................................................63

ix

LIST OF FIGURES Figure

page

2-1

Gel electrophoresis of human and dairy cow waste samples: a) 100 bp molecular ladder , b) Negative control, c) and e) Raw sewage samples, d) Dairy cow waste sample, f) BK virus positive control. .......................................................................31

2-2

Sequencee of plasmid SA.........................................................................................31

2-3

Sequence of plasmid SC...........................................................................................32

2-4

Sequence alignments of plasmid SA and published BK polyomavirus strain As (GENBANK). Similarities are highlighted in yellow. ............................................33

2-5

Sequence alignments of plasmid SC and published BK polyomavirus isolate BKV HC-u9 (GENBANK). Similarities are highlighted in yellow........................33

3-1

Approximately 3 x 108 BKV virus stained with SYBR-Gold and viewed using 1000X magnification on an epifluorescence microscope with blue excitation........43

x

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science NOVEL METHOD FOR DETECTING HUMAN POLYOMAVIRUSES IN ENVIRONMENTAL WATERS AS AN INDICATOR OF HUMAN SEWAGE POLLUTION By Shannon M. McQuaig December 2005 Chair: Samuel R. Farrah Major Department: Microbiology and Cell Science Federal and state regulatory agencies mandate the use of fecal coliforms, E. coli and/or Enterococci as microbial indicators of water quality. However, these traditional indicators of fecal pollution do not adequately assess the specific sources of pollution or the associated health risks. Many methods have been developed to identify sources of fecal contamination. This field of study has been collectively termed Microbial Source Tracking (MST). My study proposes the use of human-specific polyomaviruses (HPyVs), JCV and BKV, as indicators of human fecal pollution. The HPyVs are ubiquitous throughout the human population and serological studies speculate that 60 to 80% of adults harbor antibodies against HPyVs. They are secreted in the urine in high titers and mostly cause asymptomatic infections. Infected individuals shed viruses throughout their life span.

xi

A rapid and sensitive method was developed and optimized to concentrate and extract DNA of HPyVs from environmental water samples. Primers specific for the conserved t-antigen of both JCV and BKV were used in a nested PCR reaction to detect HPyVs. The method was able to detect viruses in as little as one microliter of raw sewage. Environmental samples were assayed for the presence of HPyVs as indicators of human fecal pollution. Samples were also screened for the presence of two additional molecular markers of human fecal pollution; the Enterococcus faecium esp gene described by Scott et al (2004), and a human-specific target in Bacteroides-Prevotella developed by Bernhard and Field (2000). In addition, a part of this study compared the presence of human-specific indicators of fecal pollution to total and fecal coliform counts and enterococci counts. All three markers were consistently detected in raw sewage. In environmental samples, one or more of the markers were detected in all of the samples suspected of containing human fecal impact. Specifically, HPyVs were detected in 100% of samples in which the Enterococcus faecium esp gene and Bacteroides-Prevotella human markers were found. No correlation was observed between the presence of human-specific indicators and high bacteriological counts. Data indicate the developed method for HPyVs detection has the sensitivity required to be a reliable predicator of human fecal pollution in environmental waters.

xii

CHAPTER 1 INTRODUCTION Identifying human fecal pollution in waters used for human recreation, fish breeding, or shellfish harvesting is necessary to reduce the potential of human contact with enteric pathogens. Waters contaminated with human fecal matter have the capability to pose serious health risks for shellfish consumers and swimmers, and tremendous economic losses for shellfish harvesters and businesses near beaches (Scott et al. 2002b). A large number of human pathogens may be spread by the fecal-oral route. Infections with these pathogens can produce mild to serious consequences and may even be fatal. The clinical symptoms associated with infections with enteric pathogens can be intestinal symptoms (ranging from abdominal cramps to acute gastroenteritis to bloody diarrhea) or extraintestinal symptoms (that can include fever, headache, and jaundice following liver infections). The following is a brief overview of some common bacterial, viral and protozoan pathogens spread by the fecal-oral route. Human Pathogenic Bacteria Spread via Fecal-Oral Route Escherichia coli Escherichia coli (E. coli) are part of the Enterobacteriaceae family. This gramnegative bacilli is a part of the intestinal flora of both humans and other warm-blooded animals (Brenner 1984). E. coli can range from nonpathogenic to virulent strains, depending on their virulence factors, such as the production of toxins and adhesion molecules. There are several strains that have virulence factors and cause diarrhea including enterotoxigenic (ETEC), enteropathogenic (EPEC), enterohemorrhagic

1

2 (EHEC), enteroinvasive (EIEC), and enteroaggregative (EAggEC) (Thielman and Guerrant, 2004). The most serious strain of E. coli is the virulent enterohemorrhagic (EHEC) strain 0157:H7. Ingestion of less than 100 bacillli can cause infection with severe bloody diarrhea and abdominal cramps (Murray et al. 2002; Nicholls et al. 2000). Children under 5 years old and the elderly who become infected with 0157:H7 are particularly susceptible to kidney failure (hemolytic uremic syndrome). For the most part E. coli, is harmless, and the presence of E. coli in water samples has been used as an indication of fecal pollution. Traditional methods for detecting E. coli rely on its ability to ferment lactose with the production of acid and gas. Detection of E. coli can also be accomplished by polymerase chain reaction (PCR), or probe hybridization; or biochemically, by the inability to metabolize methyllumbelliferyl-β-Dglucuronide (MUG) (Lior and Borczyk 1987) or to ferment sorbitol (March and Ratnam 1986). Shigella Shigella spp. are also a part of the Enterobacteriaceae family. These organisms are gram-negative, non-motile bacilli. Four species of Shigella have been isolated and described; S. dysenteriae, S. flexneri, S. boydii, and S. sonnei (Murray et al. 2002). S. sonnei are responsible for most the infections in developed countries, S. flexneri are responsible for most the infections in developing countries, S. dysenteriae are responsible for the most severe infections, and S. boydii are rarely isolated (Murray et al. 2002). Approximately 70% of all Shigella infections occur in children younger than 15 years old, and infection can establish from as few as 200 bacilli (Murray et al. 2002). Shigella produce 3 characteristic toxins including the Shigella enterotoxin 1 and 2; and a

3 phage-born Shiga toxin (Murray et al. 2002). Shigella has the ability to invade M cells and colonize the intestinal epithelium of the intestinal tract. Toxins adhere to receptors in the small intestines, and block absorption of electrolytes, glucose, and amino acids causing watery diarrhea (Niyogi 2005). Shigella can be detected using various methods including immunocapture PCR (Peng et al. 2002), immunomagentic isolation and PCR (Islam and Lindberg 1992). Salmonella Salmonella spp. (like E. coli and Shigella spp.) are in the family Enterobacteriaceae and are gram-negative bacilli. These organisms can colonize humans, domestic animals, birds, reptiles, livestock, and rodents (Murray et al. 2002). After ingestion by humans, Salmonella invade the M cells and can cause chronic colonization, enteritis, or enteric fever (typhoid fever). Salmonella enterica can cause fever, abdominal cramps, vomiting, and nonbloody diarrhea (Murray et al. 2002). Although many Salmonella spp. infections are limited to the gastrointestinal tract, S. typhi produces a generalized infection (typhoid fever). Traditional methods used to detect Salmonella spp. in clinical and environmental samples are tedious and labor-intensive. Detection methods usually include the use of pre-enrichment, enrichment, plating on selective and differential media, and finally, confirmation of isolates as Salmonella spp. using biochemical and immunological tests. Different molecular methods have been used to detect Salmonella, including immunomagnetic isolation (Yu et al. 1996) and PCR-based assays (Nam et al. 2005). Vibrio All Vibrio species are curved bacilli that have the ability to grow naturally in estuarine and marine environments. Vibrio cholerae is the most well-known of the

4 Vibrio species and is the causative agent of cholera (Murray et al. 2002). Infection with V. cholerae can cause severe watery diarrhea, electrolyte imbalance and can lead to death from dehydration. Standard methods exist for the concentration and detection of Vibrio species from water samples (Section 9260H). Vibrio spp. can also be enriched from clinical, water and food samples using Alkaline Peptone Water a high pH. The media contains 2% (w/v) sodium chloride, which promotes the growth of Vibrio and the high pH inhibits growth of most unwanted background flora (Cruickshank 1968). Campylobacter The genus of Campylobacter consists of motile, small, curved gram-negative bacilli, that have a polar flagellum (Murray et al. 2002). C. jejuni is the most common Campylobacter species found in the United States. C. jejuni can infect poultry, livestock, domestic animals and humans. In humans, clinical symptoms are normally gastroenteritis. Campylobacter can be detected in water using concentration of samples followed by selection on specific media or by molecular assays including PCR (Waage et al. 1999). Human Pathogenic Viruses Spread via Fecal-Oral Route Adenovirus Adenoviruses are approximately 90-100 nm in diameter and have a doublestranded DNA genome (Murray et al. 2002). Adenoviruses can cause a range of effects including respiratory illness to gastroenteritis. Adenoviruses year-round and are frequently found in raw sewage (He and Jiang 2005). Two types of Adenoviruses (types 40 and 41) are the most frequently detected enteric adenoviruses. Various methods have

5 been developed to detect Adenoviruses in water, including integrated cell culture and PCR-based methods (He and Jiang 2005). Enterovirus Enteroviruses have single-stranded RNA genomes surrounded by an icosahedral capsid (Murray et al. 2002). The enterovirus capsids are approximately 30 nm in diameter, and have the ability to resist a pH as low as 3, enabling them to withstand the conditions of the gastrointestinal tract (Murray et al. 2002). Polioviruses, coxsackieviruses, and echoviruses are all serotypes of enteroviruses. Enteroviruses have a seasonal occurrence, and are most prevalent during summer and fall (Skraber et al. 2004). These viruses are primarily transmitted by the fecal-oral route; however infections with enteroviruses are unapparent and usually do not lead to intestinal symptoms. However, extra-intestinal infection may be established in organs such as the nervous system, heart, and skin (Murray et al. 2002). These viruses can replicate in the alimentary canal and be shed asymptomically for up to a month after infection (Murray et al. 2002). Enteroviruses can be detected using absorption-elution techniques combined with cell culture (Clesceri et al. 1998;Kittigul et al. 2000), Reverse Transcriptase PCR (RT-PCR), or integrated cell culture/PCR methods (Reynolds et al. 2001). Hepatitis A Hepatitis A virus has a single-stranded RNA genome surrounded by a naked icosahedral capsid. The capsid is approximately 27 nm in diameter. Hepatitis A is stable at a pH of 1.0. Hepatitis A is classified as an Enterovirus but differs from the other enteroviruses in some ways. It is more heat-resistant than most other enteroviruses and causes weak or no cytopathic effects (CPE) in cell culture. The Hepatitis A virus is usually acquired by ingestion, and enters the bloodstream, and establishes infection in the

6 liver. Viruses produced in the liver are released in bile and thus can be isolated from stool in high titers (Murray et al. 2002). People infected with Hepatitis A may experience fever, fatigue, nausea, abdominal pain, and jaundice. Complete recovery is observed in 99% of patients. Detection of Hepatitis A is similar to detection methods used for enteroviruses. However RT-PCR is the current preferred method of detection (Kingsley and Richards 2001; Kittigul et al. 2000). Rotavirus Rotaviruses have double-stranded RNA genomes comprised of 11 segments. These viruses have a non-enveloped double-layered protein capsid that is approximately 60 to 80 nm in diameter (Murray et al. 2002). The virus is stable at a pH ranging from 3.5 to 10, which allows the virus to survive the acidic environment of the stomach. Once inside the small intestines, Rotaviruses absorb to the columnar cells and begin replication, and as much as 1010 viral particles per gram of stool can be shed at the height of disease (Murray et al. 2002). Rotaviruses are the leading cause of severe gastroenteritis in children worldwide (Widdowson et al. 2005). Rotaviruses are most commonly detected in water by concentration using filtration then Reverse Transcriptase PCR assay (Kittigul et al. 2005). Norovirus Noroviruses have single-stranded RNA genomes surrounded by a non-enveloped capsid. Formerly known as Norwalk-like Viruses, Noroviruses have 4 genogroups including GI, GII, GIII, and GIV (Skraber et al. 2004). Noroviruses have a seasonal distribution, with most infections occurring during the winter months (Skraber et al. 2004). Norovirus infection usually presents as vomiting, watery non-bloody diarrhea

7 with abdominal cramps, and nausea. Infections in young children and the elderly can lead to complications such as severe dehydration. As few as 10 viral particles can cause disease (Murray et al. 2002). Noroviruses can be detected in water using filtration and RT-PCR (Borchardt et al. 2004). Human Pathogenic Protozoan Spread via Fecal-Oral Route Entamoeba histolytica The life cycle of Entamoeba histolytica includes the formation of a single nucleus cyst that has a diameter of 12 µm. The cysts can withstand the acidic environment of the stomach, which allows them to pass through the stomach wall to the ileum where excystation occurs (Bogitsh and Cheng 1998). Infections with E. histolytica can vary in severity with some individuals showing no symptoms while others may have amoebic dysentry or chronic amoebiasis. E. histolytica can be detected by microscopic examination, ELISA, or PCR (Evangelopoulos et al. 2001; Schunk et al. 2001; Zindrou et al. 2001). Giardia lambia Giardia spp. can be found in a variety of mammals including humans, beavers and domestic livestock. Infection with Giardia lambia occurs by the ingestion of a cyst. An infection can be established with as few as 100 cysts (Bogitsh and Cheng 1998). After ingestion, the cysts form trophozoites that attach to the intestinal walls, and can cause diarrhea and symptoms related to malabsorption of nutrients. Infected individuals can shed as many as a billion trophozoites in a single stool sample (Bogitsh and Cheng, 1998). Standard Methods exist for detecting G. lambia in water samples (EPA Method 1623).

8 Cryptosporidium parvum The 4-5 µm oocysts of Cryptosporidium parvum are infectious. Once ingested, sporozoites are formed and then attach to the epithelial cells of the colon (Bogitsh and Cheng 1998). Several metamorphic events occur in which the sporozoites become trophozoites. C. parvum can infect a range of hosts including humans, cattle, sheep, rodents, and birds. Symptoms range from none to severe diarrhea. Death can occur in immunocompromised patients. Cryptosporidium can be detected in the environment using fluorescent antibodies viewed with epiflourescence microscopy. In addition, standard methods have been developed to detect Cryptosporidium (EPA Method 1623). Water Regulations Bacterial, viral, and protozoan pathogens can be introduced into waters in various ways including sewer overflows, leaking septic tanks, sewer malfunction, contaminated storm drains, runoff from animal feedlots, human fecal discharge from boats and poorly operating septic tanks, and other sources (Aslan-Yilmaz et al. 2004; Dietz et al. 2004; O’Shea and Field 1992; Wakida and Lerner 2005). In addition, there is a strong correlation between storm-water runoff and increased microbial load in retention waters (Fujioka 2001; Kistemann et al. 2002; Marsalek and Rochfort 2004). All surface waters in the state of Florida are classified according to their intended use. Potable water is categorized as Class I. Waters used to harvest and propagate shellfish are Class II. Class III is defined as any waters used for recreation and the propagation and harvesting of fish. Surface waters used for utilities, navigation or industrial purposes are Class IV. Minimum criteria for all water classes restricts any substance or combination of substances that may produce a foul odor, be acutely toxic, or

9 render a serious threat to the general public or wildlife (FL Surface Water Quality Standards, Ch. 62-302.500). In 1972, the Environmental Protection Agency (EPA) released The Clean Water Act. The report specified acceptable levels of biological and chemical contaminates; and suggested the use of total and fecal coliforms counts as an indicator of fecal pollution (Quality Criteria for Water. EPA-440976023). In 1986, The Clean Water Act was modified. The resulting report (titled Ambient Water Quality Criteria for Bacteria) recommended the use of Escherichia coli (E. coli) and enterococci, in place of total and fecal coliforms, as the leading indicators. However, water quality standards are governed at a state level and many U.S. states have implemented the use of total and fecal coliform counts as water-quality indicators (EPA’s BEACH Watch Program: 2000 Update. EPA823-F-00-012). Water Quality Indicators Various methods have been proposed to identify human impact of surface waters. These methods include chemical indicators, traditional microbial indicators, and microbial source tracking methods. Chemical Indicators of Fecal Pollution Coprostanol Coprostanol is a sterol formed from the reduction of cholesterol by bacteria in the intestines (Scott et al. 2002). Coprostanol comprises about 60% of the total sterols in human feces (Bull et al. 2002). Venkatesan and Kaplan (1990) suggested using coprostanol as an indicator of human fecal pollution. However Coprostanol is also produced in cats and pigs (although 10% less concentrated than in humans) (Puglisi et al. 2003).

10 Caffeine Caffeine is a substance found in soda, tea and coffee. It has been proposed as an indicator of human fecal pollution (Burkhardt 1990). Caffeine is broken down in the liver and excreted in urine. Only 0.5 to 3% of caffeine is excreted chemically unchanged (Curaldo and Robertson 1993). While high concentrations of caffeine have been documented in sewage, little is known in regards to the survival, transport and dilution of caffeine once it is introduced in the environment (Scott et al. 2002b). Whitening agents Whitening agents are found in detergents and washing powder. Whitening agents can be detected by HPLC with fluorescence detection (Kramer et al. 1996; Poinger et al. 1996). Whitening agents have been proposed as an indicator of human pollution; however they are not consistently found in human sewage (Scott et al. 2002b). Microbial Indicators of Fecal Pollution An ideal indicator is defined as a microorganism that is well characterized, has validated temporal and geographical consistency, is stable in fresh and marine water environments, is shed by a majority of the indicate species, and has a well-defined persistence (Scott et al. 2002b). The indicator must also be detected in the presence of human pathogens. Points to consider when developing a method to detect the indicator organism are reliability, reproducibility, cost effectiveness, and standardizable protocols. Traditional microbial water quality indicators Enumeration of total and fecal coliforms, E. coli and Enterococci has generally been used to assess microbial water quality. The coliform group consists of all aerobic and facultative anaerobic, gram-negative, nonspore-forming, rod-shaped bacteria that

11 ferment lactose with gas formation within 48 hours of inoculation at 35°C. Fecal coliforms are distinguished from total coliforms by growth at a slightly higher temperature (44.5 ± 0.2°C) (Clesceri et al. 1998). E. coli is a member of the fecal coliform group. Enterococci are a subgroup of fecal streptococci and are distinguished by their ability to grow in 6.5% sodium chloride, at 10°C and 45°C, and at a pH of 9.5 (Scott et al. 2005). Fecal coliforms, E. coli, and enterococci share a common feature; they all can inhabit the intestines of warm-blooded animals, including wildlife, livestock, and humans, and therefore can be excreted in the feces of these animals. Although there have been some associations between high levels of indicator bacteria and disease outbreaks (Chao et al. 2003; Chou et al. 2004; Strauss et al. 1995), there is little or no prediction of specific sources of contamination, nor correlation with human pathogens (Scott et al. 2002; Simpson et al. 2002; Skraber et al. 2004). For example, Sunen and Sobsey (1999) found hepatitis A viruses and enteroviruses in waters deemed safe based on acceptable levels of fecal coliform and enterococci. Total coliforms have the ability to survive and potentially proliferate in tropical environments (Bordalo et al. 2002; Colwell 1993; Mark 1977). Fecal coliforms, E. coli, and enterococci have been shown to multiply in warm waters (Desmarais et al. 2002; Hardina et al. 1991; Roll et al. 1997; Solo-Gabriele et al. 2000; Wright 1989), and have been found in waters with no history of anthropogenic impact (Carillo et al. 1985; Rivera et al. 1988; Wright 1986). The reliability of traditional indicators is uncertain because of the possibility of survival and regrowth in tropical climates (Chao et al. 2003), particularly since EPA’s

12 guidelines were based on studies performed in nontropical areas of the United States including Boston, New York and New Orleans (Shibata et al. 2004). Therefore, high indicator counts cannot be attributed to excrement with complete certainty. Microbial source tracking The inability of traditional indicators to distinguish human fecal pollution from wild and domestic animal fecal pollution is a major shortcoming. This shortcoming has given rise to Microbial Source Tracking (MST), a collective term for methodologies employed to detect and differentiate sources of fecal pollution in waters (using microorganisms as indicators). The concept of MST is based on differences in the intestinal flora of different hosts because of distinct habitats including temperature, food supply, and host digestive systems. Some methods exploit differences arising from natural selection including competition among microorganisms for space and nutrients, or exposure to antibiotics. The process of developing an MST method includes choosing a target microorganism found in the feces of a specific host group, and then identifying a characteristic phenotypic and/or genotypic reference feature unique to the chosen microorganism. Water is tested for fecal contamination based on the association of fecal contamination with the presence or absence of the targeted reference feature. MST is an ever-growing field of study, and various methods have been developed. Methodologies developed can be categorized into either phenotypic or genotypic, library independent or dependent methods. Phenotypic library dependent methods. Phenotypic library dependent methods categorize microorganisms based on differences and similarities of results in biochemical

13 based tests. Multiple antibiotic resistance patterns and E. coli serotyping are both phenotypic library dependent methods. Multiple antibiotic resistance (MAR). In the 1940s penicillin was introduced into the clinical field as an antibiotic. Since then, many other antibiotics have been introduced (e.g. cephalosporin, isoniazid, bacitracin, tetracycline, rifampin). The effectiveness of antibiotics led to their increasing use. In addition, farm animals, such as beef cattle, are frequently given antibiotics to elicit fast weigh gain for quicker slaughter (Rogers et al. 2004; Rumsey et al. 2000). Consequently, exposure of human and domestic animals to antibiotics has become frequent. This has led to intestinal flora that exhibit specific antibiotic resistance patterns. In contrast, bacteria from wildlife species tend to be susceptible to certain antibiotics. Escherichia coli and Enterococcus spp. are the primary organisms used in Multiple Antibiotic Resistance analyses (MAR). Isolates from known sources are plated on agar containing different antibiotic disks at various concentrations. Growth patterns are observed, and a resistance pattern emerges that can be used in source differentiation (Cooke 1976; Harwood et al. 2000; Kelch and Lee 1978; Parveen et al. 1997; Wiggins 1996, 1999). Large libraries of isolates are constructed for a watershed. Representative libraries are defined as having greater than 6,000 isolates (Wiggins et al. 2003). Unknown isolates are then compared to the known source profiles using statistical analyses. Drawbacks of the method include costs associated with the initial construction of the known library, reproducibility of results, and indeterminate results (Harwood et al. 2003; Samadpour et al. 2005).

14 E. coli serotyping. The immune systems of both humans and animals respond to foreign carbohydrate and protein molecules by producing antibodies. These antibodies circulate through the blood and can be isolated in serum. E. coli serotyping involves exposing various serums of either animal or human origin with the somatic antigens of E. coli isolates. The origin of the isolate can be pinpointed based on reactions with specific antisera. Several studies have associated specific E. coli serotypes with either human or non-human sources (Crichton and Old 1979; Gonzalez and Blanco 1989; Parveen et al. 2001). A serious limiting factor of E. coli serotyping is that it requires a large antisera bank to get a complete and representative analysis and documented cross-reactivity of human types with isolates of nonhuman origin (Orskov and Orskov 1981). Phenotypic library independent methods. Phenotypic library independent methods are based either on ratios of organisms or on the direct presence of certain organisms. Fecal coliforms to fecal streptococci ratios, presence of sorbital fermenting Bifidobacteria, Rhodococcus coprophilus or Clostridium perfringens are all different phenotypic library independent methods. Fecal coliforms to fecal streptococci ratios. The use of fecal coliforms (FC) to fecal streptococci (FS) ratios as fecal pollution indicators was first described by Geldreich and Kenner (1969). The basis of this approach rests on the fact that human feces contains relatively higher fecal coliform counts when compared to animal feces, and fecal streptococci counts are proportionally higher in animal feces relative to human feces. Approximate ratios were determined with an FC:FS of >4 indicative of human

15 fecal contamination and an FC:FS of JBR90_D04_3722_08.ab1 CHROMAT_ID=411769 aatcccagcttggtccgagctcggatccttcgtaacggaggaaagtgtgctggaatttcc ccttggtgcgaacctatggaacagaagagtgggagtcctggtggagctcctttaatgaaa aatgggatgaagatttattctgccatgaggatatgtttgccagtgatgaagaagcaacag cagattcccaacactcaacaccacccaaagaaaaaagaaaggtagaagaccctaaagact aagggcgaattctgcagatatccatcacactggcggccgctcgagcatgcatctagaggg cccaattcgccctatagtgagtcgtattacaattcactggccgtcgttttacaacgtcgt gactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgcc agctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctg aatggcgaatggacgcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgc gcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttccctt cctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttag ggttccgatttagtgctttacggcacctcgaccccaaaaacttgattagggtgatggttc acgtagtgggccatcgccctgatagacggttttcgccttttgacgttggagtcacgttct taatagtggactcttggtccaaatggaacaacactcaaccctattcggtcttatcttttg attataagggaattngcganttcgcctattgtttaaaaatgactgattaacaaatttaac cgatattaacaaattcaggcgg

acgt trimmed region(s) acgt vector region(s)

Figure 2-2. Sequencee of plasmid SA

60 120 180 240 300 360 420 480 540 600 660 720 780 840 900

32

SC (cycled with forward primer) Sequence >JBR89_C04_3722_06.ab1 CHROMAT_ID=411770 ggttttttgacccgatntnaannggnnacttcntnatgagaggagcnaaattttcccttg gtgccacctatggaacagaacatttgccgtcctggtggagctcctttaatgaaaaatggg atgaagattttttttgccctgaagatatgtttgccaatgatgaagaagcgaccgccgatt ctcaacactccacacctcccaagaaaaagagaaaggtataagaccctaaagactaagggc gaattccagcacactggtggccgtctctagtggatcccagctcggtttttttttggcgta atcatggtcatagctgtttcctgtgtgaaattggtattcgctcacgattccacacaacat acgagccggaagcataaagtgtaaagcccggggtgcctattgagtgagctaactcattta aattgggttgcgctcaatgcccgctatccagtccggaaacctgtcatgcccactgcatta aagaatcggcctatcgcgcaggaagaggtgagtttgcgttatgggtgctatttcgcgtcc tcagttactgactgcgcgcgatcggtctgttcggttgctgaagagcggttacagtctgac tcaataggtggtgataacggtatccactaaaatacggggtataaccccgggaaaaagaca ggggagaaaaaggcccaggaaatggccaggaaccgctaaaagccgcgttgtcggatcaat atccaaggggtcccccccttatggagatgaagaaatttaagcttattcaacagtgggcga agcacgacagacatgatattccacccgttttccttggatcacttctgcaatccatgattc catatgctaatcagaatatggtatcttttcccttcggattcagaatttttgaggattatg t

acgt trimmed region(s) acgt vector region(s)

Figure 2-3. Sequence of plasmid SC

60 120 180 240 300 360 420 480 540 600 660 720 780 840 900

33

Figure 2-4. Sequence alignments of plasmid SA and published BK polyomavirus strain As (GENBANK). Similarities are highlighted in yellow.

Figure 2-5. Sequence alignments of plasmid SC and published BK polyomavirus isolate BKV HC-u9 (GENBANK). Similarities are highlighted in yellow.

CHAPTER 3 DEVELOPMENT OF A METHOD TO CONCENTRATE AND DETECT HUMAN POLYOMAVIRUSES FROM WATER SAMPLES When dealing with detection of viruses in water several issues must be addressed. These include the concentration procedure to be used, the assay procedure to detect viruses and removal of inhibitors of the assay procedure. Human and animal viruses are generally present in low numbers in environmental waters, therefore the viruses must usually be concentrated before detection assays are performed. Several methods to concentrate viruses are available, these include: ultracentrifugation, cartridge filters (electropositive or electronegative), glass wool filters, vortex and tangible flow filtration, acid flocculation, organic flocculation (Fong and Lipp 2005). Enteric viruses can be concentrated from water at a low pH using microporous filters. Research has shown MS2, ΦX174, and Poliovirus-1 absorption to Millipore HA filters is >99% at pH 3.5 (Gerba 1984; Lukasik et al. 2000). While some viruses can be inactivated at a pH of 3.5 (Scott et al. 2002a); human polyomaviruses (HPyVs) have been shown to withstand exposure to low pHs (Bofill-Mas et al. 2001). After absorption to microporous filters, viruses must be eluted from the filter in a smaller volume of eluting solution for DNA extraction. The microporous filters not only concentrate viruses but also PCR inhibitors. These inhibitors must be removed from the sample. Most commercially available DNA extraction kits are designed to isolate DNA and remove PCR inhibitors from clinical samples such as blood, tissue and forensic

34

35 samples. However samples containing feces and urine harbor relatively high concentrations of inhibitors and are problematical substrates for PCR (Behzadbehbahani et al. 1997). It is imperative that the chosen DNA extraction method eliminates all inhibition of PCR. Research has been performed addressing the efficiency of different commercially available DNA extraction kits. McOrist et al. (2002) found QIAamp DNA Stool Mini Kit the most effective extraction method for fecal samples when compared to FastDNA® kit (Bio 101, Carlsbad, CA, USA), Nucleospin® C+T kit (Macherey-Nagal, Germany), and Quantum Prep® Aquapure Genomic DNA isolation kit (Bio-Rad, Hercules, CA, USA). QIAamp Viral RNA Kit co-precipitates RNA and DNA and had been used with success in extracting Enterovirus RNA from nitrocellulose filters (Scott, unpublished data). Moreover, Whiley et al. (2004) effectively used QIAamp DNA Blood Mini Kit (Qiagen, Inc., Valencia, CA) to perform nucleic acid extractions on urine samples. One objective of this study was to design a protocol to concentrate and detect HPyVs from water samples. Four different DNA extraction kits were tested for efficiency of inhibitor removal, DNA recovery and reproducibility of results. Materials and Methods Sample Collection Sewage samples were collected from the University of Florida’s Water Reclamation Facility (Gainesville, FL). All samples were collected in sterile bottles, transported to the laboratory on ice then stored at 4ºC until processed. All samples were processed within 24 hours of collection.

36 Sample Preparation One hundred milliliters of tap water was dechlorinated with sodium thiosulfate. One hundred microliters of raw sewage was inoculated into the dechlorinated water. The pH of the water was then adjusted to 3.5 using hydrochloric acid (HCl). Virus Concentration on Micropourous Filters Water was vacuum filtered through a 0.45 micron, 47-mm diameter nitrocellulose filter. The filter was lifted and placed into a 30 ml polypropylene tube, and stored at -20 C. All filters were processed within 24 hours. QIAamp DNA Stool Kit (Qiagen, Inc., Valencia, CA) DNA extractions were performed with some modifications to the manufacturer’s protocol. Two hundred microliters of 0.1% Tween in phosphate buffered solution (PBS) and 1.4 ml Buffer ASL were added to the tube containing the filter and was then placed on a Dynal Rotator and rotated for 10 minutes at 70ºC. Tubes were centrifuged briefly to collect the lysate. The lysate was then added to the Qiagen spin column and viral DNA was isolated according to manufacturer’s instructions. DNA was resuspended in 200 µL nuclease free reagent grade water and stored at -20ºC. QIAamp Viral RNA Kit (Qiagen, Inc., Valencia, CA) DNA extractions were performed according to manufacturer’s instructions with some modification. Briefly, 700 µL of viral lysis buffer was added to the tube containing the filter and then rotated on a Dynal Rotator for 10 minutes until the filters were saturated. Tubes were centrifuged briefly to collect lysate. The lysate was added to the Qiagen spin column and viral RNA and DNA were isolated according to manufacturer’s instructions. Nucleic acids were resuspended in 50 µL nuclease free reagent grade water and stored at -20ºC.

37 QIAamp MinElute Kit (Qiagen, Inc., Valencia, CA) DNA extractions were performed according to manufacturer’s instructions with some modification. A combination of QIAGEN Protease, 800 µL of phosphate buffered solution and 800 µL of viral lysis buffer were added to the tube containing the filter. The tube containing the lysis solution and filter was incubated at 56°C. After 15 minutes tubes were centrifuged briefly to collect lysate. The lysate was then added to the Qiagen spin column and viral DNA was isolated according to manufacturer’s instructions. DNA was resuspended in 50 µL nuclease free reagent grade water and stored at -20ºC. QIAamp Blood DNA Midi Kit (Qiagen, Inc., Valencia, CA) Two-milliliters of Beef Extract (pH 9.3) was added to the tube along with 200 µL of QIAGEN Proteinase and 2.4 ml of Buffer AL. The tubes were rotated on a Dynal Rotator for 10 minutes at 70°C, after which the lysate was then added to the Qiagen spin column. The viral DNA was isolated according to manufacturer’s instructions. DNA was resuspended in 90 µL nuclease free reagent grade water and stored at -20ºC. HPyV Enzymatic Conditions: The assay was carried out using 45 µL Platinum® Blue PCR SuperMix (Invitrogen, Inc., Carlsbad, CA), 200-nM of primers P5 and P6, template volume of 4 µl, the final volume was adjusted to 50 µl with reagent grade water. The PCR reaction conditions were as follows: initial denaturing at 94°C for 2 minutes, followed by 45 cycles of: 94°C for 20 seconds, 55°C for 20 seconds, and 72°C for 20 seconds, then a final elongation at 72°C for 2 minutes. The nested PCR was run using the same reaction conditions with 1 µl of the first reaction used as the template.

38 Agarose Gel Electrophoresis The PCR products were analyzed using 1.5% agarose gel electrophoresis. DNA was viewed using GelStar nucleic acid stain (Biowhittaker, Inc., Walkersville, MD) under UV light. Bands were identified by visual analysis and comparison to a pGEM HindIII digest (Promega, Inc., San Luis Obispo, CA) or 100 bp Molecular Ruler (BioRad) and a positive control. BK virus (ATCC #VR-837) was used as a positive control. Positive results were recorded when bands appeared at 172 bp which corresponded to the PCR product of the BK virus positive control. SYBR-Gold Viral Direct Counts BK virus stock (ATCC #VR-837) was obtained from the American Tissue Culture Collection. The stock was serially diluted in reagent grade nuclease free water. Samples were fixed with 0.02 µm-filtered formalin to a final concentration of 1% in the sample. Prior to filtration an antifade mounting solution was prepared by combining 990 µL of 50/50 PBS: Glycerin and 10 µL of 10% p-phenylenediamine. The formalin fixed samples were vacuumed filtered through a 25 mm, 0.02 µm pore size Whatman Anodisc filter backed by a 25 mm, 0.8 µm pore size AA Millipore mixed-ester membrane filter. The Whatman filters were then lifted and placed in a petri dish containing staining solution. The staining solution was comprised of 97.5 µL of 0.02 µm filtered deionized water and 2.5 µL of 1:10 diluted SYBR-Gold Nucleic Acid Dye (Invitrogen, Inc., Carlsbad, CA). Filters were stained for approximately 12 minutes. After the staining period, the filters were placed on a slide and covered with 28 µL of antifade mounting solution and cover slip. BK virus was observed using 1000X magnification on an epifluorescence microscope with blue excitation.

39 Range of Detection One hundred milliliters of tap water was dechlorinated with sodium thiosulfate. The dechlorinated tap water was inoculated with a known titer of BK virus. The pH of the water was lowered to 3.5 using HCl. Water samples were filtered through a 0.45 micron porosity, 47-mm diameter nitrocellulose filter. The filter was lifted and placed into a 30 ml polypropylene tube, and stored at –20 ºC. All filters were processed within 24 hours. QIAamp Blood DNA Midi kit was used for DNA extractions. PCR and gel electrophoresis was used to detect BK virus (protocols previously described). Results A total of 4 samples of were extracted using the QIAamp DNA Stool Mini Kit. All samples were negative for the presence of HPyVs. Two of the twelve DNA samples (16.7%) extracted using the QIAamp Viral RNA Kit were positive for HPyVs. Fourtyeight (30%) samples out of 160 extracted using the QIAamp MinElute Virus Spin Kit were positive for HPyVs. A total of 30 samples were extracted using QIAamp DNA Blood Midi Kit. HPyVs were detected in all thirty of the samples (100%) (Table 3-1). QIAamp DNA Blood Midi Kit was selected as the best method for DNA extraction and inhibitor removal. Direct viral counts were made using SYBR-Gold and epifluorescence microscopy (Figure 3-1). A total of 292, 140 and 237 BK virus particles were counted at the 10-10 dilutions, and a total of 14, 12 and 22 BK virus particles were counted at the 10-11 dilutions (Table 3-2). The titer of the BK virus stock was approximated to be 1.915 ± 0.7 x 1012. One hundred milliliter water samples were inoculated with 223 ± 77, 160 ± 43, or 16 ± 4 BK virus particles. The method developed was able to detect BK virus DNA

40 represented by a PCR product after extraction of filter by QIAamp DNA Blood Kit in the samples inoculated with 160 ± 43 and 223 ± 77 viral particles; but not in the water sample inoculated with 16 ± 4 BK virus particles. Discussion The QIAamp DNA Stool Kit was the least efficient of all the kits used to extract DNA from filters. At one point in the manufacturer’s protocol only half of the sample was applied for further processing. Therefore, at that step the sensitivity of HPyV detection was decreased by one-half, which could be a large contribution to the inefficiency of this kit. When using both the QIAamp Viral RNA Kit and QIAamp MinElute Kit the volume of lysis buffer was insufficient to saturate the entire surface of a membrane filter, and therefore limited the exposure of the viruses to the lysis buffer, which may have contributed to the ineffectiveness of these two kits. Results were variable when using the QIAamp Viral RNA Kit and inadequate for the purpose of this study. The QIAamp MinElute Kit was more efficient than the Viral RNA Kit; however it showed limited reproducibility. The best-suited commercially available DNA extraction kit was the QIAamp DNA Blood Midi Kit. It allowed a larger volume (2 ml) to be used to elute the membrane filter. The higher volume of elution buffer allowed for sufficient coverage of the filter. In addition, the high pH (9.3) Beef Extract used to elute the filter appeared to more readily release virus particles from the filter perhaps by interfering with the electrostatic interactions and competing for protein binding on the surface of the filter. The DNA Blood Midi Kit gave consistent results, making it the obvious choice to use in subsequent DNA extractions.

41 Approximately 150 BK viral particles diluted in 100 ml of water could be detected using this method. This coupled with previous studies showing the detection of HPyVs in as little as 1 µL of sewage imply that this method is sensitive. The sensitivity of detection further enforces the potential of this method to be successfully used for detecting human fecal pollution in environmental waters. Preliminary data suggest that environmental water samples suspected of human fecal pollution (broken sewage lines, sewer overflows, etc.) will be positive for HPyVs.

42 Table 3-1. Concentration and detection of HPyVs in water inoculated with sewage.* Results of HPyVs detection # of # of Percent positives negatives Positive QIAamp DNA Stool Mini Kit 0 4 0% QIAamp Viral RNA Mini Kit 2 10 16.70% QIAamp MinElute Virus Spin Kit 48 112 30% QIAamp DNA Blood Midi Kit 30 0 100% Note: HPyVs were concentrated on microporous filters. DNA extractions were performed directly on the filter. DNA extraction kits were tested for efficiency of inhibitor removal and consistency of results. Table 3-2. Direct counts of BKV using SYBR-Gold staining epifluorescence microscopy. Dilutions 10-10 10-11

Number of BK Viral Particles Counted 292 140 237 14 12 22

Average ± Std. Dev. 223 ± 77 16 ± 4

43

Figure 3-1. Approximately 3 x 108 BKV virus stained with SYBR-Gold and viewed using 1000X magnification on an epifluorescence microscope with blue excitation.

CHAPTER 4 HUMAN POLYOMAVIRUSES AS INDICATORS OF HUMAN-DERIVED FECAL POLLUTION IN ENVIRONMENTAL WATER SAMPLES: THREE DIFFERENT INDICATORS OF HUMAN FECAL POLLUTION IN JACKSONVILLE AREA CANALS AND CREEKS The fecal anaerobe genus Bacteroides has been used as an indicator of human fecal pollution (Bernhard and Field, 2000). Primer sets for human-specific organisms were developed based on 16S rRNA sequences, and have been used successfully in field studies on the west coast (Bernhard, et. al 2003), although they have not been used in other geographical areas. Enterococcus faecium is one of the dominant enterococci found in human feces, and the enterococcal surface protein gene (esp) found in this species is associated with human, but not animal-derived, fecal matter (Scott et al. 2004). Scott et al. (2004) developed a PCR based method to detect the esp gene in waters suspected of human fecal pollution. Our objective was to compare and contrast the presence of human specific Bacteroides marker, the esp marker and the presence of HPyVs, and to identify any correlations between the three indicators. Materials and Methods Sample Collection Samples were collected from creeks and canals in the Jacksonville area (Nassau and Duval Counties) (Table 4-1). All samples were collected in sterile bottles, transported to the laboratory on ice then stored at 4ºC until processed. All samples were processed

44

45 within 24 hours of collection. Samples were collected from November 2004, through June 2005. Processing of Samples for Bacteroides Marker We filtered 100 ml of water from each sample through a 0.45 micron filter to collect bacterial cells for molecular analysis. In case of a clogged filter, an additional filter was utilized until a total of 100 ml was filtered. Each filter was then processed according to methodology outlined below. Preparation of Bacteroidetes template DNA for PCR reactions Filters were suspended in Qiagen Stool Lysis Buffer and vortexed vigorously. The resulting lysate was processed using QIAamp DNA Stool Kit (Qiagen, Inc., Valencia, CA) PCR reactions were performed on composite DNA samples extracted from membrane filters. PCR primers and reaction conditions for Human Bacteroides marker detection Primers specific for Bacteroides derived from human sources (Fwd: 5’AACGCTAGCTACAGGCTT-3’ and Rev: 5’- CAATCGGAGTTCTTCGTG-3’) were developed by Bernhard and Field (2000). PCR reactions were performed in a 50 µL reaction mixture containing 1X PCR buffer, 1.5 mM MgCl2, 200 µM of each of the four deoxyribonucleotides, 0.3 µM of each primer, 2.5 U of HotStarTaq DNA polymerase (Qiagen), and 5 µL of template DNA. Amplification consisted of 25 cycles at 94°C for 30 sec, an annealing temperature of 53°C for 30 sec, and 72°C for 1 min followed by a final 6-min extension at 72°C. To increase the sensitivity of detection, 1 µL of each PCR product was reamplified using the same conditions. PCR products were visualized in a 1% agarose gel stained with GelStar.

46 Processing of Samples for esp Detection Isolation of enterococci Enterococci were isolated by membrane filtration. Filters were incubated for 18 to 24 hours on mE agar supplemented with indoxyl substrate (mEI, Sigma, Inc.) according to methodology outlined in USEPA Method 1600. Growth of enterococci Filters containing enterococci were lifted, suspended in Tryptic Soy Broth, vortexed vigorously, and incubated for 3 h at 41oC. DNA extractions were performed on the culture using a QIAamp DNA extraction kit according to manufacturer’s instructions (Qiagen, Inc.). PCR primers and reaction conditions The forward primer used it this study was previously designed by Scott, et. al (2004), and is specific for the E. faecium esp gene (5’-TAT GAA AGC AAC AGC ACA AGT T-3’). A conserved reverse primer (5’-ACG TCG AAA GTT CGA TTT CC-3’), developed previously by Hammerum and Jensen (2002), was used for all reactions. PCR reactions were performed in a 50 µL reaction mixture containing 1X PCR buffer, 1.5 mM MgCl2, 200 µM of each of the four deoxyribonucleotides, 0.3 µM of each primer, 2.5 U of HotStarTaq DNA polymerase (Qiagen), and 5 µL of template DNA. Amplification was performed with an initial step at 95 oC for 15 min (to activate Taq polymerase), followed by 35 cycles of 94oC for 1 min, 58oC for 1 min, and 72oC for 1 min. PCR products were separated on a 1.5% agarose gel stained with GelStar nucleic acid stain (BioWhittaker, Inc., Walkersville, MD ) and viewed under UV light. The PCR product is 680 or 681 base pairs in length, representing both variants of the E. faecium esp gene.

47 Processing of Samples for HPyV Detection Prefiltration of samples Samples were prefiltered to remove large particles, before prefiltration the pH of samples was raised to 10.0 to reduce virus absorption to the filter. The samples were vacuum filtered through 47 mm prefilter and effluent was collected in a sterile side arm flask. Virus concentration on micropourous filters After prefiltration the pH of the water sample was dropped to 3.5 using concentrated acetic acid. Six hundred milliliters of the water sample was vacuum filtered through a 0.45 micron, 47-mm diameter nitrocellulose filter. The filter was lifted and placed into a 30 ml polypropylene tube, and stored at -20 C. All filters were processed within 24 hours. DNA extraction Two-milliliters of Beef Extract (pH 9.3) was added to the tube along with 200 µL of QIAGEN Proteinase and 2.4 ml of Buffer AL. The tubes were rotated on a Dynal Rotator for 10 minutes at 70°C, after which the lysate was added to the Qiagen spin column. The viral DNA was then isolated according to manufacturer’s instructions. DNA was resuspended in 100 µL nuclease free reagent grade water and stored at -20ºC. HPyV enzymatic conditions The assay was carried out using 45 µl Platinum® Blue PCR SuperMix (Invitrogen, Inc., Carlsbad, CA), 200-nM of primers P5 and P6, template volume of 4 µL, the final volume was adjusted to 50 µL with reagent grade water. The PCR reaction conditions were as follows: initial denaturing at 94°C for 2 minutes, followed by 45 cycles of: 94°C for 20 sec, 55°C for 20 sec, and 72°C for 20 sec, then a final elongation

48 at 72°C for 2 min. The nested PCR was run using the same reaction conditions with 1 µL of the first reaction used as the template. The PCR products were analyzed using 1.5% agarose gel electrophoresis. DNA was viewed using GelStar nucleic acid stain (Biowhittaker, Inc.) under UV light. Bands were identified by visual analysis and comparison to a pGEM HindIII digest (Promega, Inc.) or 100 bp Molecular Ruler (BioRad) and a positive control. BK virus was used as a positive control. Positive results were recorded when bands appeared at 172 bp which corresponded to the PCR product of the BKV positive control. Results Ten sites were sampled in the months of November of 2004, December of 2004, January of 2005, February of 2005, March of 2005, April of 2005, and June of 2005. Each site was analyzed for the presence of the esp marker, the Bacteroides marker, and human polyomaviruses. In November of 2004, all three markers of human fecal pollution were found in one sample D1 (Table 4-2). In December of 2004, both the esp marker and Bacteroides marker were not found in any samples, however human polyomaviruses were detected in samples D3 and D4 (Table 4-3). None of the indicators of human fecal pollution were found in the January of 2005 samples (Table 4-4). In February of 2005, all three markers were found in samples D1, D2, D3, N2 and N5. Both the esp marker and HPyVs were detected in sample N1, only the esp marker was found in D5, and only HPyVs were detected in sample N4 (Table 4-5). In March of 2005, all three markers were detected in samples D1 and N5, both the Bacteroides marker and HPyVs were detected in samples D2, N2, only the Bacteroides marker was detected in N1, and only HPyVs were detected

49 in D3, D4, D5, N3 and N4 (Table 4-6). In April of 2005, all three markers were detected in D2, only the esp marker was detected in D1, both the Bacteroides marker and HPyVs were detected in N1 and N2, and only HPyVs were detected in N3 (Table 4-7). In June of 2005, none of the markers were detected in any of the samples (Table 4-8). Table 4-1. Sampling sites for Jacksonville area study. Site Sampling Location Designation D1 Graceland Bridge D2 Lenox Ave. Bridge D3 San Juan Blvd Boat Ramp D4 Blanding Ave. Cedar Shore Apt.Bldg. D5 Ortega Canal N1 CR-125/St. Mary’s Middle Prong Bridge N2 CR-127/ St. Mary’s Middle Prong Bridge N3 CR-250/St. Mary’s Middle Prong Bridge N4 Hwy 90/ Deep Creek Bridge N5 CR-121/Brandy Branch Bridge Table 4-2. Results of 11/15/04 analysis for markers of human fecal pollution. Human Bacteroides HPyV Detectionb Date Site esp a Markera Collected Number Marker (+/-) (+/-) (+/-) 11/15/04 D1 + + + 11/15/04

D2

-

-

-

11/15/04

D3

-

-

-

11/15/04

D4

-

-

-

11/15/04

D5

-

-

-

11/15/04

N1

-

-

-

11/15/04

N2

-

-

-

11/15/04

N3

-

-

-

11/15/04

N4

-

-

-

11/15/04

N5

-

-

-

a-Total volume of water processed was 100 ml. b-Total volume of water processed was 600 ml.

50 Table 4-3. Results of 12/13/04 analysis for markers of human fecal pollution. Human Bacteroides HPyV Detectionb Date Site Number esp (+/-) Collected Markera Markera (+/-) (+/-) 12/13/04 D 1 12/13/04

D2

-

-

-

12/13/04

D3

-

-

+

12/13/04

D4

-

-

+

12/13/04

D5

-

-

-

12/13/04

N1

-

-

-

12/13/04

N2

-

-

-

12/13/04

N3

-

-

-

12/13/04

N4

-

-

-

12/13/04

N5

-

-

-

a-Total volume of water processed was 100 ml. b-Total volume of water processed was 600 ml. Table 4-4. Results of 1/10/05 analysis for markers of human fecal pollution. Date Site Human Bacteroides HPyV Detectionb esp Collected Number Markera Markera (+/-) (+/-) (+/-) 1/10/05 D1 1/10/05

D2

-

-

-

1/10/05

D3

-

-

-

1/10/05

D4

-

-

-

1/10/05

D5

-

-

-

1/10/05

N1

-

-

-

1/10/05

N2

-

-

-

1/10/05

N3

-

-

-

1/10/05

N4

-

-

-

1/10/05

N5

-

-

-


51 Table 4-5. Results of 2/8/05 analysis for markers of human fecal pollution. Human Bacteroides HPyV Detectionb Date Site esp (+/-) Collected Number Markera Markera (+/-) (+/-) 2/8/05 D1 + + + 2/8/05

D2

+

+

+

2/8/05

D3

+

+

+

2/8/05

D4

-

-

-

2/8/05

D5

+

-

-

2/8/05

N1

+

-

+

2/8/05

N2

+

+

+

2/8/05

N3

-

-

-

2/8/05

N4

-

-

+

2/8/05

N5

+

+

+

a-Total volume of water processed was 100 ml. b-Total volume of water processed was 600 ml. Table 4-6. Results of 3/14/05 analysis for markers of human fecal pollution. Date Site Human Bacteroides HPyV Detectionb esp Collected Number Markera Markera (+/-) (+/-) (+/-) 3/14/05 D1 + + + 3/14/05

D2

-

+

+

3/14/05

D3

-

-

+

3/14/05

D4

-

-

+

3/14/05

D5

-

-

+

3/14/05

N1

-

+

-

3/14/05

N2

-

+

+

3/14/05

N3

-

-

+

3/14/05

N4

-

-

+

3/14/05

N5

+

+

+


52 Table 4-7. Results of 4/18/05 analysis for markers of human fecal pollution. Human Bacteroides HPyV Detectionb Date Site esp (+/-) Collected Number Markera Markera (+/-) (+/-) 4/18/05 D1 + 4/18/05

D2

+

+

+

4/18/05

D3

-

-

-

4/18/05

D4

-

-

-

4/18/05

D5

-

-

-

4/18/05

N1

-

+

+

4/18/05

N2

-

+

+

4/18/05

N3

-

-

+

4/18/05

N4

-

-

-

4/18/05

N5

-

-

-

a-Total volume of water processed was 100 ml. b-Total volume of water processed was 600 ml. Table 4-8. Results of 6/7/05 analysis for markers of human fecal pollution. Human Bacteroides HPyV Detectionb Date Site esp a Markera Collected Number Marker (+/-) (+/-) (+/-) 6/7/05 D1 6/7/05

D2

-

-

-

6/7/05

D3

-

-

-

6/7/05

D4

-

-

-

6/7/05

D5

-

-

-

6/7/05

N1

-

-

-

6/7/05

N2

-

-

-

6/7/05

N3

-

-

-

6/7/05

N4

-

-

-

6/7/05

N5

-

-

-


53 Discussion The Jacksonville area utilizes both sewer and septic systems to dispose of waste. Breaks in sewer lines, overflows of lift stations and faulty septic tanks have led to sewage contamination of canals and creeks. Three different types of human fecal indicators were used to assess the quality of canals and creeks. Seventy samples were screened for all three markers. One or more of the markers was found in 23 (33%) of the samples. HPyVs were detected in 9 out of 9 (100%) of the samples that contained both the esp marker and Bacteroides marker. A total of 14 samples were positive for Bacteroides marker, of these 13 (93%) were also positive for HPyVs. A total of 12 samples were positive for the esp marker, of these 10 (83%) were also positive for HPyVs. (Table 4-14). A higher number of samples were positive for the presence of HPyVs (n=23) than both the esp marker (n=12) and the Bacteroides (n=14), this could be attributed a larger volume of water used in the HPyVs analysis. Also, viruses tend to be slightly more stable in environmental conditions. Table 4-9. Percent positive correlation of the three indicators used to identify human fecal pollution. Percent Positive + esp + Bacteroides +esp Correlation + Bacteroides + HPyVs 83% 93% 100% + Bacteroides 75% 100% 100% + esp 100% 75% 100% Instances occurred in which only the esp marker or only the Bacteroides marker was found in a sample. While this study was not designed to address and explain these scenarios, one reason for our observations may be due to disturbance of sediment of the canals. Numerous studies have shown microorganisms have the ability to persist for long

54 periods of time in the sediment of lakes and rivers (Anderson et al. 2005; Lisle et al. 2004; Stenstrom and Carlander 2001). Recreational activities are frequent in the canals and creeks that were sampled. These activities could have led to a disturbance in the sediment and subsequently the release of microorganisms to the water. Further studies could be done to analyze the microbial quality of the sediment in areas where water sampling occurs. Overall, HPyVs were consistently present in samples which both the human specific esp marker and the Bacteroides marker were detected. This is further evidence that the presence of HPyVs is a valuable addition to the Microbial Source Tracking ‘toolbox’.

CHAPTER 5 HUMAN POLYOMAVIRUSES AS INDICATORS OF HUMAN-DERIVED FECAL POLLUTION IN ENVIRONMENTAL WATER SAMPLES: FECAL INDICATORS IN GAINESVILLE'S URBAN CREEKS There are 31 wastewater facilities in Alachua County. From January 1st to December 31st, 2004, there were 11 sewage spills reported in Alachua County with a total of 24,500 gallons of sewage being released into the environment (Clean Water Fund). Sewage spills occur due to various reasons including clogged sewer lines (e.g. grease clogs), aged pipes and storm events that led to an overload of system capacity. Creeks of Gainesville can become riddled with sewage during sewer line malfunctions. Gainesville Regional Utilities uses total and fecal coliforms as a measure of water quality; however total and fecal coliforms counts along with Enterococci counts are a conservative measure of fecal contamination in water and little information is construed from enumerating these indicator organisms. The presence of these microorganisms can be attributed to an assortment of possible animal and/or human sources. Enterococcus faecium is one of the dominant enterococci found in human feces, and the enterococcal surface protein gene (esp) found in this species is associated with human, but not animal-derived, fecal matter (Scott et al. 2004). Scott et al. (2004) developed a PCR based method to detect the esp gene in waters suspected of human fecal pollution. Determining sources of fecal pollution allows for cost-effective remediation of contaminated waters and more accurate risk assessment for consumers and swimmers.

55

56 The objective of this study was to use the method developed to detect HPyVs in environmental water samples suspected of containing human fecal pollution, and to then compare those results with bacteriological counts and the presence of the esp marker. Materials and Methods Sample Collection Samples were collected from urban creeks of Gainesville, Florida (Hogtown Creek, Tumblin Creek, and the Sweetwater Branch). All samples were collected in sterile bottles, transported to the laboratory on ice then stored at 4ºC until processed. All samples were processed within 24 hours of collection. Samples were collected from October, 2004 through June, 2005. Processing of Samples for Total Coliforms Total coliforms were isolated by membrane filtration according to standard methods (Section 9222). Volumes of 0.1 ml, 1.0 ml and 100 ml of each sample were filtered. Filters were lifted, placed on mEndo agar (Difco) and incubated at 35 ± 0.5ºC for 24 hours. Total coliforms were enumerated by counting colonies with a pink to darkred color having a metallic sheen. Processing of Samples for Fecal Coliforms The Most Probable Number (MPN) of fecal coliforms in each sample was determined using multiple-tube fermentation technique. For each sample three tubes containing A-1 Broth (Fisher) were inoculated with 0.1 ml, 1.0 ml, and 10 ml. Tubes were incubated at 35 ± 0.5ºC for 3 hours then transferred to a water bath at 44 ± 0.5ºC for 21 hours. Gas production in any tube within 24 hours indicated a positive reaction and thus the presence fecal coliforms. MPN was calculated from the number of positive tubes as described in Standard Methods (Section 9221C).

57 Processing of Samples for Enterococci Enterococci were isolated by membrane filtration. Volumes of 0.1 ml, 1.0 ml and 100 ml of each sample were filtered. Filters were lifted, placed on mE agar (Difco) and incubated at 41 ± 0.5ºC for 48 hours. All colonies having a light or dark red color were counted as enterococci (Standard Methods Section 9230C). Processing of Samples for esp Detection Samples were processed as previously described in Materials and Methods of Chapter 4. Processing of Samples for HPyV Detection Samples were processed as previously described in Materials and Methods of Chapter 4. Results Samples were collected in the months of October (Table 5-1), November (Table 52), January (Table 5-3), February (Table 5-4) and June (Table 5-5), and processed for total and fecal coliforms, Enterococci and the presence of the esp maker and HPyVs. A total of 22 sites were sampled in October 2004. Sites S3, S7, S11 and S38 were positive for the esp marker. HPyVs were detected in sites S3, S7 and S38. Based on EPA water guidelines (Table 5-6), all sites did not meet total coliform or enterococci standards and only sites S13P, S13R, S39, S41P, S42, S45P and S46 were considered uncontaminated by fecal pollution based on fecal coliform counts. A total of 13 sites were sampled in November 2004. Sites S7, S9, S11, S23 and S38 were positive for both the esp marker and HPyVs. All enterococci counts were above EPA standards. Sites S7, S9, S11, S20 and S23 were considered ‘safe’ based on

58 fecal coliform counts. All the sites except for S17M were above acceptable total coliform levels. A total of 11 samples were collected in January 2005. The esp marker and HPyVs were detected in sites S7, S11, S38, SWD and SWU. Enterococci counts were above acceptable levels for all the sites. Only S42 and SWU had total coliform counts below EPA standards. Fecal coliforms counts were above standard levels in sites S7, S23, S37, S38, S42 and S45P. Six samples were collected in February 2005. The esp marker and HPyVs were detected in sites S7, S38 and SWU. All sites were above acceptable enterococci counts and all but SWU were above acceptable total coliform counts. Only two sites, S37 and SWU, were below EPA guidelines for fecal coliform counts. A total of 10 samples were collected in June 2005. The esp marker and HPyVs were detected in sites S3, S8, S9, S13P, S37 and S38. Only HPyVs were present in sample S7. All samples were above acceptable levels for both total coliforms and enterococci. Only S8 and S13P did not met EPA standards for fecal coliforms. Discussion Based on EPA guidelines, a majority of samples collected were considered unsafe for human consumption and recreation. The creeks and streams that the samples were taken from are frequented by wildlife. High enterococci and coliform counts could be credited to either the presence of wildlife or human fecal contamination. Using indicators of human fecal pollution, the esp marker and the detection of HPyVs, a total of 24 samples were deemed unsafe for human interactions. Sources of human fecal pollution may include bypassed and failing septic tanks, stormwater runoff, sanitary sewer overflows and leaking sewer pipes.

59 In one instance the esp marker was found when the presence of HPyVs was not detected, and in one instance HPyVs were detected when the esp marker was not detected. The absence of the HPyVs in the presence of the esp marker may be due to experimental error when extracting DNA. Experimental error may also be the reason for the absence of the esp marker in the presence of HPyVs. However, the problem could possibly be attributed to the differences in volume assayed; a total of 600 ml was used in the HPyVs assay whereas only 100 ml was used in the esp assay. Overall, the results of the esp marker and the HPyVs concurred for 60 of the 62 (97%) samples.

60 Table 5-1. Results of October 2004 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs. Total Fecal Site Espc HPyVsc Enterococcusa a b Coliforms Coliforms S3 7000 >2400 2780 + + S7 12000 1600 2980 + + S11 6000 920 3500 + S12 3000 1600 3940 S13P 5000 540 700 S13R 13000 540 2160 S16 4000 920 6210 S17M 4000 920 1060 S18 9000 350 1200 S20 5000 540 4480 S22 3000 920 1820 S23 5000 920 5380 S31 10000 >2400 4100 S37 5000 >2400 1980 S38 23000 920 2660 + + S39 13000 350 2100 S41P 8000 540 1120 S42 4000 170 2840 S45M 6000 920 2280 S45P 5000 350 760 S46 7000 350 2160 SSE 12000 >2400 4280 a CFU/100 ml b MPN/ 100 ml c Results reported as a “+” or “-” indicate a positive or negative detection of a PCR product.

61 Table 5-2. Results of November 2004 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs. Total Fecal Site Espc HPyVsc Enterococcusa a b Coliforms Coliforms S7 11000 350 5640 + + S9 5000 540 2680 + + S11 9000 280 2900 + + S12 5000 1600 4200 S17M 1000 920 3140 S18 27000 920 1200 S20 7000 540 3140 S23 7000 540 7960 + + S31 6000 >2400 2240 S38 16000 >2400 5800 + + S43 5000 1600 3700 S46 4000 1600 2680 SSE 10000 920 2460 a CFU/100 ml b MPN/ 100 ml c Results reported as a “+” or “-” indicate a positive or negative detection of a PCR product.

62 Table 5-3. Results of January 2005 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs. Total Fecal Site Enterococcusa Espc HPyVsc a Coliforms Coliformsb S3 8000 540 1020 S7 5000 920 1400 + + S11 3000 540 4000 + + S23 5000 920 2940 S37 6000 920 2640 S38 5000 1600 4960 + + S42 1000 >2400 3200 S45M 5000 540 1520 S45P 4000 >2400 4620 SWD 3000 540 1080 + + SWU 1000 540 880 + + a CFU/100 ml b MPN/ 100 ml c Results reported as a “+” or “-” indicate a positive or negative detection of a PCR product. Table 5-4. Results of February 2005 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs. Total Fecal Site Enterococcusa Espc HPyVsc a Coliforms Coliformsb S3 18000 920 1540 S7 10000 920 2000 + + S11 8000 920 1360 S37 4000 540 2200 S38 18000 920 2080 + + SWU 1000 540 880 + + a CFU/100 ml b MPN/ 100 ml c Results reported as a “+” or “-” indicate a positive or negative detection of a PCR product.

63 Table 5-5. Results of June 2005 analysis for total and fecal coliform counts, Enterococci counts and detection of esp marker and HPyVs. Total Site Fecal Coliformsb Enterococcusa Espc HPyVsc Coliformsa S3 11000 540 3800 + + S4 10000 350 7400 S7 5000 540 1200 + S8 32000 1600 2200 + + S9 10000 240 3200 + + S12 4000 220 4800 S13P 4000 920 1600 + + S23 4000 130 2000 S37 4000 170 2000 + + S38 6000 170 3800 + + a

CFU/100 ml MPN/ 100 ml c Results reported as a “+” or “-” indicate a positive or negative detection of a PCR product. b

Table 5-6. Guidelines for total coliforms, fecal coliforms, E. coli, and enterococci in surface waters.* INDICATOR GUIDELINES Monthly average of