in any of our own patient cohorts (20209C fi A was not tested). At the level of the caucasian population, these variations will therefore not contribute significantly ...
808 Letters to the Editor
in any of our own patient cohorts (20209C fi A was not tested). At the level of the caucasian population, these variations will therefore not contribute significantly to the observed variation in prothrombin levels and to the development of venous thrombosis. However, this does not mean that such variations are not functional. Our results showed that the A to C change at position 20207 and the A to G change at position 20218 do not result in major changes in the position of the poly(A) attachment site, in the effectiveness of polyadenylation or in protein expression. Based on the results obtained with our model system, we would expect that these mutations do not contribute to the thrombotic risk of the patients carrying them. This is in contrast with our results on the 20210G fi A mutation [10], using the same experimental setup as used for the analysis of the present two variations, and with the results of Danckwardt et al. [9], who showed that the 20221C fi T change also results in increased activity of the prothrombin polyadenylation region. References 1 Poort SR, Rosendaal FR, Reitsma PH, Bertina RM. A common genetic variation in the 3¢-untranslated region of the prothrombin gene is associated with elevated plasma prothrombin levels and an increase in venous thrombosis. Blood 1996; 88: 3698–703. 2 Ceelie H, Bertina RM, van Hylckama Vlieg A, Rosendaal FR, Vos HL. Polymorphisms in the prothrombin gene and their associ-
3
4
5
6
7
8
9
10
ation with plasma prothrombin levels. Thromb Haemost 2001; 85: 1066–70. Perez-Ceballos E, Corral J, Alberca I, Vaya A, Llamas P, Montes R, Gonzalez-Conejero R, Vicente V. Prothrombin A19911G and G20210A polymorphisms’ role in thrombosis. Br J Haematol 2002; 118: 610–4. Wylenzek M, Geisen C, Stapenhorst L, Wielckens K, Klingler KR. A novel point mutation in the 3¢ region of the prothrombin gene at position 20221 in a Lebanese/Syrian family. Thromb Haemost 2001; 85: 943–4. Meadows CA, Warner D, Page S, Lyon E. Detection of novel mutation using fluorescent hybridization probes and melting temparature analysis. J Mol Diagn 2002; 3: 195. Warshawsky I, Hren C, Sercia L, Shadrach B, Deitcher SR, Newton E, Kottke-Marchant K. Detection of a novel point mutation of the prothrombin gene at position 20209. Diagn Mol Pathol 2002; 11: 152–6. Balim Z, Kosova B, Falzon K, Bezzina Wettinger S, Colak Y. Budd– Chiari syndrome in a patient heterozygous for the point mutation C20221T of the prothrombin gene. J Thromb Haemost 2003; 1: 852–3. Schrijver I, Lenzi TJ, Jones CD, Lay MJ, Druzin ML, Zehnder JL. Prothrombin gene variants in non-Caucasians with fetal loss and intrauterine growth retardation. J Mol Diagn 2003; 5: 250–3. Danckwardt S, Gehring NH, Neu-Yilik G, Hundsdoerfer P, Pforsich M, Frede U, Hentze MW, Kulozik AE. The prothrombin 3¢ end formation signal reveals a unique architecture that is sensitive to thrombophilic gain-of-function mutations. Blood 2004; 104: 428–35. Ceelie H, Spaargaren-van Riel CC, Bertina RM, Vos HL. G20210A is a functional mutation in the prothrombin gene; effect on protein levels and 3¢-end formation. J Thromb Haemost 2004; 2: 119–27.
Novel missense mutations in two patients with factor XI deficiency (Val271Leu and Tyr351Ser) and one patient with combined factor XI and factor IX deficiency (Phe349Val) G . J A Y A N D H A R A N , R . V . S H A J I , S . C . N A I R , M . C H A N D Y and A . S R I V A S T A V A Department of Hematology, Christian Medical College, Vellore, 632 004, India
To cite this article: Jayandharan G, Shaji RV, Nair SC, Chandy M, Srivastava A. Novel missense mutations in two patients with factor XI deficiency (Val271Leu and Tyr351Ser) and one patient with combined factor XI and factor IX deficiency (Phe349Val). J Thromb Haemost 2005; 3: 808–811.
Factor XI (FXI) is the zymogen of a trypsin-like serine protease that catalyzes the activation of FIX in the consolidation phase of blood coagulation through a thrombin-generated feedback loop. The human FXI gene is located on the long arm of chromosome 4 (4q35) [1]. It is composed of 15 exons and Correspondence: Alok Srivastava, Department of Hematology, Christian Medical College, Vellore, 632 004, India. Tel.: + 91 416 2282352; fax: + 91 416 2232035; e-mail: aloks@ cmcvellore.ac.in Received 25 October 2004, accepted 14 December 2004
spread over approximately 23 kilobases [2]. Mutations in this gene result in a relatively mild and variable bleeding diathesis [3]. Although FXI deficiency is common in well-defined populations, including Ashkenazi Jews and French Basques [4,5], only 50 different mutations in this gene have been reported world-wide [6]. An increased frequency of such disorders has been expected in Middle Eastern countries and Southern India where consanguineous marriages are relatively common [6]. We report here for the first time, the molecular data in three South Indian patients with FXI deficiency. Patients with clinical bleeding or a prolonged activated partial thromboplastin time (APTT) on preoperative screening were further evaluated. A diagnosis of FXI or FIX 2005 International Society on Thrombosis and Haemostasis
Letters to the Editor 809 Table 1 Primers used for amplification of factor XI gene Exon f11-exon f11-exon f11-exon f11-exon f11-exon f11-exon f11-exon f11-exon f11-exon f11-exon f11-exon f11-exon f11-exon f11-exon
1 2 3 4 5 6 7 8+9 10 11 12 13 14 15
Forward primer (5¢)3¢)
Reverse primer (5¢)3¢)
Amplicon size (bp)
AAAGCAAGCAATTCTCTCAAGG TTGAATGCCACACACAGTCA GAGCTACTTGCCTTGCCTTT TTTGTTTTGGCATGAGATAAAG GAGTCAGGAGGGACAGTTGC CAGGTGCTTAGCAACACTGC GACCGGAATTTTCCTGATAGC ACTTTCTCTAGGTGCTGTAAAAATG TCTGCCTGTGAGGTGCATTA TGAAGGAGCATAATTACTGATGGA GCCACACACTTCACAATGTCT CGATATCGTGCTGAACCTGA TTGTGTATGGTTATTCTACAAACGAA GAAGATGGGAAGCGTCTGAG
TCTCTACAAAGCTAAATCAGACACA TTATTTCCTTCCCGGCATAA TGGAAATGTGTTAAGAATAGCAATC CCGATGTGGCGATATGTGTA GGCATAAAGTTGATGGCAAAA GTCCGTTTCATCGTGAGCAT TGATGGATTTTGATCAGCTATTTT GGGTGTCTGCATAACCCTTC TGGTCAGCTTGAGTGACAGG TGTGTGAAGAAGATGAACTAATAAAAA AGGGTCAGGCCGTAAGTCTA TTGACAGGGCAGAAAAGGTT GGGCAACAGAGCGAGACT CAACGATCATAGAACGGGAGT
379 359 326 294 321 380 284 481 318 280 334 328 310 410
PCR was performed in a 25-lL reaction volume containing 7.5 pmol of each primer in a 1· concentration of a ready reaction mix (Abgene, Epsom, UK) containing 1.5 mmol L)1 MgCl2, 75 mmol L)1 Tris–HCl (pH 8.8), 20 mmol L)1 (NH)2SO4, 0.2 mmol L)1 of each of dNTP, 0.01% (v/v) Tween-20 and 1.25 units of Thermoprime plus DNA polymerase. Approximately 250 ng of genomic DNA was used for amplification reactions. Following an initial denaturation at 94 C for 5 min, 30 cycles of PCR amplification were performed, with denaturation at 94 C for 40 s, annealing at 58 C for 40 s and extension at 72 C for 40 s. The final extension was at 72 C for 5 min.
deficiency was based on a prolonged APTT and a low FIX or FXI coagulant activity (FIX/FXI:C). Genomic DNA was obtained from the peripheral blood of these patients. FXI gene was amplified by 14 pairs of primers (Primer3, http:// www.broad.mit.edu/cgi-bin/primer/primer3_http://www.cgi) designed to cover all 15 exons and intron–exon boundaries (Table 1). Mutations were screened by conformation-sensitive gel electrophoresis (CSGE) as previously described [7]. In the patient with a double coagulation defect, FIX gene defects were identified by a multiplex polymerase chain reaction (PCR) and CSGE strategy as reported earlier [8]. Samples displaying abnormal CSGE patterns were sequenced using the Big Dye Terminator cycle sequencing kit (Applied Biosystems, Warrington, UK) on an ABI 310 genetic analyzer (PE Applied Biosystems, Foster City, CA, USA). PCR–restriction enzyme analysis (PCR-REA) was carried out with BsaAI (New England Biolabs, Hitchin, UK) and BamHI (MBI Fermentas, St Leon Rot, Germany) to confirm the novel mutations identified in exons 8 and 9 of the FXI gene and to screen for their presence in 50 normal chromosomes of south Indian descent. Mutations at or near the splice junction consensus sequences were analyzed using the ÔSplice Site Prediction programÕ (http://www.fruitfly.org/seq_tools/splice.html) to predict changes in RNA splicing. FXI amino acid sequences from 10 different species/related serine proteases were obtained from the SwissProt and Trembl databases (http:/ us.expasy.org/sprot/) by PSI-BLAST to study the conservation of novel missense substitutions identified. The clinical and hematological data for these patients (Table 2), show that those patients with severe FXI deficiency alone, had no spontaneous bleeding. The measurement of plasma levels of factor activity usually helps to predict the severity and frequency of clinical manifestations, but for FXI deficiency this relationship is poor as is evident from this study 2005 International Society on Thrombosis and Haemostasis
and as reported previously [9]. However, the patient with combined deficiency (FIX and FXI) had a clinical phenotype consistent with severe hemophilia. It is of interest to note that replacement of FIX concentrates alone relieved the bleeding symptoms of hemarthroses in this patient. Mutations in FXI or FIX genes were identified in all three subjects by PCR and CSGE. In all, four different causative missense mutations (FXI, n ¼ 3; FIX, n ¼ 1) were detected of which three were novel (Table 2). Two previously reported [5] polymorphisms in FXI gene, )138A fi C in intron A and Gly379Gly (GGT fi GGC) were also identified in a heterozygous (BL-86) or a homozygous state (BL-154) in two patients. In the patient (BL-154) with a double coagulation defect, a novel T fi G transversion at nucleotide 31166 of FIX gene (http://www.kcl.ac.uk/ip/petergreen/haemBdatabase. html//) resulted in a phenylalanine to valine missense substitution at codon 349 affecting the FIX catalytic domain. A Phe394Ile missense change has been shown [10] to be causative of hemophilia B. Both these amino acids differ in size and shape and Phe349 is present in a disulfide loop formed by Cys336 and Cys350. The Phe349Val missense change identified in this study may cause hemophilia B by a similar mechanism, as both isoleucine and valine mutants are structurally similar aliphatic amino acids. This mutation was coinherited with a previously reported, homozygous, Gly460Arg missense change in the catalytic domain of FXI and has been shown to be causative of FXI deficiency [11]. In another patient (BL-86), the Gly460Arg mutation was detected in a compound heterozygosity with a novel, Val271Leu (GTG fi CTG) amino acid change affecting the apple-3 domain of FXI. This substitution is also likely to be disease causative. As Val271 is the last codon of exon 8, located at its 3¢ splice donor junction, a mutation at this consensus splice sequence (CA G-GTA fi CA C-GTA) is predicted to abolish
