NPM1 mutations in therapy-related acute myeloid leukemia with ...

Leukemia (2008) 22, 951–955 & 2008 Nature Publishing Group All rights reserved 0887-6924/08 $30.00 www.nature.com/leu

ORIGINAL ARTICLE NPM1 mutations in therapy-related acute myeloid leukemia with uncharacteristic features MT Andersen, MK Andersen, DH Christiansen and J Pedersen-Bjergaard Department of Clinical Genetics, Hematology/Oncology Section 4052, Rigshospitalet, Copenhagen University Hospital, Copenhagen, Denmark

Frameshift mutations of the nucleophosmin gene (NPM1) were recently reported as a frequently occurring abnormality in patients with de novo acute myeloid leukemia (AML). To evaluate the frequency of NPM1 mutations in patients with therapy-related myelodysplasia (t-MDS) and therapy-related AML (t-AML), and their possible association to type of previous therapy and to other gene mutations, 140 patients with t-MDS or t-AML were analyzed for mutations of NPM1. NPM1 mutations were observed in 7 of 51 patients presenting as overt t-AML, as compared to only 3 of 89 patients presenting as t-MDS (P ¼ 0.037). The mutations were not related to any specific type of previous therapy, but they were significantly associated with a normal karyotype and mutations of FLT3 (P ¼ 0.0002 for both comparisons). Only 1 of 10 patients with NPM1 mutations presented chromosome aberrations characteristic of therapyrelated disease, and 7q/7, the most frequent abnormalities of t-MDS/t-AML, were not observed (P ¼ 0.002). This raises the question whether some of the cases presenting NPM1 mutations were in fact cases of de novo leukemia. The close association to class I mutations and the inverse association to class II mutations suggest mutations of NPM1 as representing a class II mutation-like abnormality in AML. Leukemia (2008) 22, 951–955; doi:10.1038/leu.2008.17; published online 14 February 2008 Keywords: mutations of NPM1; therapy-related MDS; therapyrelated AML

Introduction Balanced translocations to chromosome band 5q35 with chimeric rearrangement of the nucleophosmin gene (NPM1) have previously been observed in rare cases of leukemia or lymphoma. The translocation partners include the anaplastic lymphoma kinase gene on chromosome band 2p23,1 the retinoic acid receptor-a gene on chromosome band 17q122 and the myelodysplasia (MDS)/myeloid leukemia factor 1 gene on chromosome band 3q25.1.3 Recently, frame shift mutations of the NPM1 gene were identified as a very frequent abnormality in adult patients with de novo acute myeloid leukemia (AML).4 This has subsequently been confirmed by several other studies.5–10 In de novo AML, NPM1 mutations are predominantly observed in cases with a normal karyotype and significantly associated with mutations of the Fms-like tyrosine kinase 3 gene (FLT3).4,6–10 NPM1 mutations on their own confer a favorable prognosis of AML, whereas if combined with a FLT3-internal tandem duplication (FLT3-ITD), they predict a less favorable outcome of the disease.4,6–9 Correspondence: Dr MT Andersen, Department of Clinical Genetics, Hematology/Oncology Section 4052, Rigshospitalet, Copenhagen University Hospital, Blegdamsvej 9, Copenhagen DK-2100, Denmark. E-mail: [email protected] Received 17 October 2007; revised 10 January 2008; accepted 15 January 2008; published online 14 February 2008

The NPM1 gene encodes a nucleocytoplasmic shuttling protein.11 The wild-type protein is primarily located to the nucleolus, whereas the mutated form is abundant in the cytoplasm. This redistribution is caused by a loss of the nucleolar localization signal in the C terminus of the mutated NPM1 protein, with simultaneous introduction of a novel nuclear export signal.12 Nucleophosmin is involved in a variety of cellular activities, including ribosome biogenesis13–15 and maintenance of genomic stability.16–18 It has been shown to interact with components of the ARF/Mdm2/p53 pathway,19–21 and NPM1 þ / mice were found often to develop an MDS-like syndrome.18 To the best of our knowledge, NPM1 has not been recorded to participate directly in the RTK/RAS-BRAF signal transduction pathway. In AML, a cooperation between constitutively activating mutations of genes in the RTK/RAS-BRAF signal transduction pathway (class I mutations) and inactivating mutations of genes encoding hematopoietic transcription factors (class II mutations) has been proposed.22,23 Previous reports from our laboratory have confirmed this association in patients with therapy-related MDS or AML (t-MDS/t-AML).24,25 Therapy-related MDS/t-AML is of interest to study as the cytogenetic abnormalities and their associated gene mutations are often related to specific types of previous treatment.26 So far, only few studies of NPM1 mutations in t-MDS or t-AML have been published. Falini et al.4 did not detect cytoplasmic NPM1 in any of 135 patients with secondary AML. Thiede et al.9 examined 55 patients with t-AML for mutations of the NPM1 gene as part of a larger study of de novo AML. Only four cases with NPM1 mutations were observed. In another study, Do¨hner et al.6 observed an apparently much higher frequency, as four of six patients with t-AML presented NPM1 mutations. Detailed clinical information and cytogenetic data for each individual patient were not provided in these reports. Thus, a more extensive study of NPM1 mutations in t-MDS and t-AML and their possible relation to type of previous therapy, to other gene mutations and to cytogenetic abnormalities is warranted. We therefore examined 140 clinically and genetically well-characterized patients with therapy-related disease for frame shift mutations in exon 12 of the NPM1 gene.

Materials and methods Mononuclear cells isolated from the bone marrow at diagnosis of 89 patients with t-MDS and of 51 patients presenting as overt t-AML were included in the study. All patients were previously analyzed for mutations of p53, AML1 and selected genes in the RTK/RAS-BRAF pathway.24,27

Mutations of the NPM1 gene in t-MDS/t-AML MT Andersen et al

952

Genomic DNA was extracted as previously described.28 Screening for length mutations in the translated part of NPM1 exon 12 was performed by PCR followed by fragment analysis. Primers used were NPM-I11f and NPM-E12r as previously reported by Thiede et al.9 Primer NPM-I11f was labeled with 6-FAM for fluorescence detection on the ABI 3100 (Applied Biosystems, CA, USA). Approximately 50–200 ng of genomic DNA was amplified in a total volume of 20 ml containing 1 Qiagen buffer (Qiagen, Hilden, Germany), 200 mM dNTPs (GE Healthcare, Munich, Germany), 0.5 mM of each primer (DNA Technology, Aarhus, Denmark) and 0.5 U of HotStarTaq polymerase (Qiagen). Amplification conditions consisted of an initial denaturation/activation step at 95 1C for 15 min followed by 30 cycles at 94 1C for 30 s, 56 1C for 30 s, 72 1C for 1 min and a final elongation step at 70 1C for 10 min. The PCR product (1 ml) was analyzed on an ABI 3100 Genetic Analyzer (Applied Biosystems) in 10 ml of HiDi formamide (Applied Biosystems) containing 5% v/v GeneScan-500 ROX Standard (Applied Biosystems). DNA from patients showing aberrantly sized peaks in addition to the expected wild-type peak of 291 bp were re-amplified using primers NPM1-F and NPM1-R as described by Falini et al.4 and amplification conditions consisting of an initial denaturation/activation step at 95 1C for 15 min followed by 35 cycles at 94 1C for 30 s, 55 1C for 30 s, 72 1C for 1 min and a final elongation step at 70 1C for 5 min. PCR products were purified (JETquick; Genomed, Lo¨hne, Germany) and sequenced directly using the NPM1-R2 primer, previously described by Do¨hner et al.6 Regions of mixed sequences were compared to publish normal sequence of NPM1 to identify the insertion sequence. Statistical evaluations of differences between patients with and without NPM1 mutations according to various characteristics were performed using Fisher’s exact test (two-tailed) or the Wilcoxon’s two-sample test.

Results Frameshift mutations of NPM1 exon 12 were detected in 10 of 140 patients with t-MDS or t-AML. Eight patients presented the variant A mutation and one the variant D mutation as previously described by Falini et al.4,29 The mutation variant observed in the last patient (case 113) was, to our knowledge, novel (Table 1). Detailed clinical and cytogenetic data for each of the 10 cases with NPM1 mutation are shown in Table 2. The most important clinical, cytogenetic and genetic characteristics of the 10 patients with NPM1 mutations, as compared to the remaining 130 patients with germ line NPM1, are shown in Table 3. Seven of 10 patients with NPM1 mutations presented as overt t-AML, whereas 3 patients presented as t-MDS (P ¼ 0.037). Case 113 with t-MDS, a characteristic karyotype, and a novel NPM1 mutation type, survived for only 4 months and died from complications to cytopenia without developing overt leukemia.

Table 1

Leukemia

Cases 132 and 163 were atypical, as they presented as refractory anemia (RA) with less than 5% blasts in the bone marrow and a normal karyotype or trisomy 8, both rarely observed in t-MDS. In these two patients, the disease progressed to overt t-AML after 20 and 16 months of observation, respectively. Six of 10 patients with NPM1 mutations had previously received high-voltage radiotherapy and one had received radium for cervical cancer. In three cases, irradiation was the only type of therapy administered. Six patients had previously received alkylating agents, two patients had received topoisomerase II inhibitors and one patient had been treated with methotrexate and prednisone for rheumatoid arthritis (case R). Thus, a nonsignificant excess of patients was previously treated with irradiation only. No other associations between NPM1 mutations and previously administered mutagenic therapy were found. Seven of 10 patients with mutations of NPM1 exon 12 had normal karyotypes as compared to only 17 of 130 patients with germ line NPM1 (P ¼ 0.0002, Table 3). In addition, one patient presented a ring chromosome 10 (case 52), another trisomy 8 (case 163), both detected as sole abnormalities. Only 1 of 10 patients presented a complex karyotype with deletion of 5q and loss of 17p, characteristic of t-MDS and t-AML. The most common abnormalities of t-MDS and t-AML, 7q/7, were not observed (P ¼ 0.002, Table 3). Mutations of NPM1 exon 12 were associated with ITD mutations of FLT3 in 5 of 10 patients (P ¼ 0.0002, Table 3). In addition, a mutation of NRAS was detected in case 132. Thus, associated class I mutations were detected in 6 of 10 patients with NPM1 mutations as compared to only 27 of 130 patients with germ line NPM1 (P ¼ 0.012, Table 3). Neither point mutations of p53 or of AML1, the most common mutations of therapy-related diseases, nor chimeric rearrangements of genes encoding hematopoietic transcription factors (class II mutations) were detected in patients with NPM1 mutations. In contrast, associated class II mutations were detected in 47 of 130 patients with germ line NPM1 (P ¼ 0.017, Table 3). The analyses for mutations of FLT3, NRAS, p53 and AML1 were performed previously on all 140 patients.

Discussion In the present study, frameshift mutations of the NPM1 gene were observed in 7 of 51 patients presenting as overt t-AML (14%). This frequency is much lower than that observed in patients with de novo AML, ranging from 25 to 35%.4,7,9,10 If correcting for karyotype and type of disease, however, we observed NPM1 mutations in 6 of 15 (40%) patients with overt t-AML and a normal karyotype, as compared to 47–64% in similar cases of de novo AML reported in the literature.5–8,10 Thus, the difference in frequency of NPM1 mutations between therapy-related and de novo AML seems to rely mainly on a difference in cytogenetic characteristics, with a normal

Nucleotide and theoretical peptide sequences of the NPM1 exon 12 translated region

Mutation type

Nucleotide sequence (50 -30 )

Theoretical peptide sequence

wt Type A Type D Novel type (case 113)

GCTATTCAAGATCTCTG – – – – GCAGTGGAGGAAGTCTCTTTAAGAAAATAG GCTATTCAAGATCTCTGTCTGGCAGTGGAGGAAGTCTCTTTAAGAAAATAG GCTATTCAAGATCTCTGCCTGGCAGTGGAGGAAGTCTCTTTAAGAAAATAG GCTATTCAAGATCTCTGCAAGGCAGTGGAGGAAGTCTCTTTAAGAAAATAG

AIQDLWQWRKSL AIQDLCLAVEEVSLRK AIQDLCLAVEEVSLRK AIQDLCKAVEEVSLRK


953 Table 2

Characteristics of 10 patients with t-MDS or t-AML and mutations of the NPM1 gene

Case no.

Age/sex

Primary tumor

Treatment for primary tumor and duration of therapy (months)

Latent perioda (months)

Type of complication

Karyotype

Other mutations

NPM1 mutation type

29 52

63/F 68/F

Cervix cancer Breast cancer

24 12

M2 M1

A A

78/M

Rectal cancer

104

M5

46,XX[75] 46,XX,r(10)[25]/46, XX[37] 46,XY[22]

FLT3-ITD FLT3-ITD

78

F

A

82

58/F

18

M5

46,XX[9]

F

A

113

69/M

Non-Hodgkin’s NS/IA Hodgkin NS/IA

Radium X-rays McWhirter 40.7 Gy BCNU+5FU+DTIC+ VCR (24) X-rays mantle 40 Gy Ctx+VCR+Pred (12) MOPP (6), X-rays mantle 37 Gy Etop+Vlb+Dox (5)

25

MDS

FLT3-ITD

119

52/F

Non-Hodgkin’s NLPD/IA

52

M4

F

A

132 148

39/F 46/F

Wegener Breast cancer

59/20 37

RA-t-AML M1

46,XX[32] 46,XX[26]

NRAS FLT3-ITD

A D

163

35/F

Hodgkin LP/IIIA

38/16

RA-t-AML

A

68/F

Rheumatoid arthritis

77

M2

47,XX,+8[8],46, XX[17] 46,XX[25]

F

R

CHOP (5), X-rays mantle 40 Gy Ctx (59) X-rays McWhirter 40 Gy MOPP (6), X-rays mantle 37.8 Gy MTX+Pred (77)

46,X,t(Y;16)(q12;q?), del(3)(p24p?),del(5) (q31q31),dic(5;17) (q11;p11), dup(19)(q?q?),+del(21) (q21)[17]/48,idem, +18,+19,dup(19), +22[6]/46,XY[1] 46, XX[19]

FLT3-ITD

A

Novel

Abbreviations: ABVD, Dox+bleomycin+Vlb+DTIC; AraC, cytosine arabinoside; BCNU, carmustine; BEAM, BCNU+Etop+AraC+melphalon; CCNU, lomustine; CHOP, Ctx+Dox+VCR+Pred; CLAVOPP, chlorambucil+Dox+Vlb+VCR+Pred; COPP, Ctx+VCR+procarbazine+Pred; Ctx, cyclophosphamide; Dox, doxorubicin; DTIC, dacarbazine; Etop, etoposide; F, female; 5FU, 5-fluoracil; LP, lymphocyte predominance; M, male; MDS, myelodysplasia; MOPP, mechlorethamine+VCR+procarbazine+Pred; MTX, methotrexate; NLPD, nodular poorly differentiated lymphocytic lymphoma; NS, nodular sclerosis; Pred, prednisone; RA, refractory anemia; t-AML, therapy-related acute myeloid leukemia; t-MDS, therapy-related MDS ; Nov, novantrone; VCR, vincistin; Vlb, vinblastine. a Latent period: Time from primary tumor/disease to t-MDS/t-AML. Where two latent periods are listed; the first is time from primary tumor/disease to t-MDS, whereas the second is time from t-MDS to t-AML.

karyotype being observed much more frequently in de novo AML. The observation of two cases presenting clones with a single chromosomal abnormality (ring chromosome 10, case 52; trisomy 8, case 163) in combination with many normal metaphases is in line with previous findings in de novo AML.4 The occurrence of NPM1 mutations in de novo MDS is uncommon and controversial.30,31 Our observation of three cases of NPM1 mutations in patients with t-MDS is therefore surprising. All three cases, however, were atypical. Case 113 presented a complex karyotype with del(5q) and loss of 17p in 23 of 24 mitoses, abnormalities rarely observed in combination with NPM1 mutations. Cases 132 and 163 were also rather unique, as they belonged to the small subgroup of patients with t-MDS and a normal karyotype or trisomy 8. As far as etiology is concerned, no significant associations to specific types of previous therapy were observed in our patients with t-MDS or t-AML and NPM1 mutations, despite intensive mutagenic exposures of the whole group. Noteworthy are three patients with NPM1 mutations, who had received irradiation only. In our previous studies, only mutations of FLT3 have been significantly associated with previous radiotherapy.24 In other studies, relative risks in the order of 2.0–2.4 have been observed following radiotherapy.32,33 This indicates that approximately 50% of such AMLs are directly radiation induced, whereas another 50% are cases of de novo AML. Hence, cases 29, 52 and 148, as well as case R treated with methotrexate þ prednisone without a confirmed leukemogenic potential, could all be suspected to represent de novo

leukemias. Also, cases 82 and 78, who developed t-AML with normal karyotypes after unusually short or long latent periods of 18 or 104 months, respectively, could be cases of de novo leukemia. Five of 10 patients with NPM1 mutations also presented FLT3 mutations as compared to only 6 of 130 patients with germ line NPM1 (P ¼ 0.0002, Table 3). Of importance, another patient with an NPM1 mutation presented an NRAS mutation. These observations, with 6 of 10 patients with NPM1 mutations presenting an associated class I mutation (P ¼ 0.012), but not a single class II mutation (P ¼ 0.017), raise the question whether NPM1 mutations should be considered as a class II mutation equivalent, cooperating with class I mutations in leukemogenesis. Other findings are compatible with this assumption. NPM1 has been shown to stabilize p53 in a transcriptionally competent state,21 and haploinsufficiency of the gene may function as primary lesion in the development of an MDS-like disease in mice.18 Finally, the NPM1 gene has not been shown to be directly participating in the RTK/RAS-BRAF pathway. If the NPM1 mutations are included together with the classic class II mutations previously observed in our cohort of 140 patients with t-MDS or t-AML,25 the total number of class I mutations still amounts to 35, whereas class II mutations now amount to 59. In 25 of these cases, a concomitant classes I and II mutation was observed (P ¼ 0.0001).34 Further knowledge about the mechanisms of action of nucleophosmin will hopefully clarify whether mutations of the NPM1 gene represent a class II type of mutation. Leukemia


954 Table 3 Characteristics of NPM1 mutated versus non-mutated cases of t-MDS/t-AML Characteristics

NPM1 mutated, n ¼ 10

NPM1 wild–type, n ¼ 130

Age, years (median) Female/male

61 8/2

60 65/65

0.965a 0.100

Previous therapy Alkylating agents Topo-II inhibitors RT±CT Radiotherapy only

6 2 7 3

102 59 59 14

0.236 0.186 0.191 0.104

3/7 2/3 38

86/44 29/86 48

0.037 0.277 0.282a

1 0 7 0

33 63 17 22

0.451 0.002 0.0002 0.363

0 0 5 1

34 22 6 13

0.118 0.363 0.0002 B1.00

6

27

0.012

0

47

0.017

Presentation t-MDS/t-AML t-MDS-t-AML Latent period (months) Cytogenetics 5q/5 7q/7 Normal Balanced translocations Gene mutations p53 AML1 FLT3 RAS Associated class I mutation Associated class II mutation

P

Abbreviations: CT, chemotherapy; RT, radiotherapy; t-AML, therapyrelated acute myeloid leukemia; t-MDS, therapy-related myelodysplasia. a Calculated using the Wilcoxon’s two-sample test.

Acknowledgements We thank Pia Maj-Britt Bech for her technical assistance and Severin Olesen Larsen for his help with the statistical calculations. This work was supported by grants from The Danish Cancer Society.

References 1 Morris SW, Kirstein MN, Valentine MB, Dittmer KG, Shapiro DN, Saltman DL et al. Fusion of a kinase gene, ALK, to a nucleolar protein gene, NPM, in non-Hodgkin’s lymphoma. Science 1994; 263: 1281–1284. 2 Redner RL, Rush EA, Faas S, Rudert WA, Corey SJ. The t(5;17) variant of acute promyelocytic leukemia expresses a nucleophosmin-retinoic acid receptor fusion. Blood 1996; 87: 882–886. 3 Yoneda-Kato N, Look AT, Kirstein MN, Valentine MB, Raimondi SC, Cohen KJ et al. The t(3;5)(q25.1;q34) of myelodysplastic syndrome and acute myeloid leukemia produces a novel fusion gene, NPM-MLF1. Oncogene 1996; 12: 265–275. 4 Falini B, Mecucci C, Tiacci E, Alcalay M, Rosati R, Pasqualucci L et al. Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal karyotype. N Engl J Med 2005; 352: 254–266. 5 Boissel N, Renneville A, Biggio V, Philippe N, Thomas X, Cayuela JM et al. Prevalence, clinical profile, and prognosis of NPM mutations in AML with normal karyotype. Blood 2005; 106: 3618–3620. Leukemia

6 Dohner K, Schlenk RF, Habdank M, Scholl C, Rucker FG, Corbacioglu A et al. Mutant nucleophosmin (NPM1) predicts favorable prognosis in younger adults with acute myeloid leukemia and normal cytogenetics: interaction with other gene mutations. Blood 2005; 106: 3740–3746. 7 Verhaak RG, Goudswaard CS, van Putten W, Bijl MA, Sanders MA, Hugens W et al. Mutations in nucleophosmin (NPM1) in acute myeloid leukemia (AML): association with other gene abnormalities and previously established gene expression signatures and their favorable prognostic significance. Blood 2005; 106: 3747–3754. 8 Schnittger S, Schoch C, Kern W, Mecucci C, Tschulik C, Martelli MF et al. Nucleophosmin gene mutations are predictors of favorable prognosis in acute myelogenous leukemia with a normal karyotype. Blood 2005; 106: 3733–3739. 9 Thiede C, Koch S, Creutzig E, Steudel C, Illmer T, Schaich M et al. Prevalence and prognostic impact of NPM1 mutations in 1485 adult patients with acute myeloid leukemia (AML). Blood 2006; 107: 4011–4020. 10 Suzuki T, Kiyoi H, Ozeki K, Tomita A, Yamaji S, Suzuki R et al. Clinical characteristics and prognostic implications of NPM1 mutations in acute myeloid leukemia. Blood 2005; 106: 2854–2861. 11 Borer RA, Lehner CF, Eppenberger HM, Nigg EA. Major nucleolar proteins shuttle between nucleus and cytoplasm. Cell 1989; 56: 379–390. 12 Falini B, Bolli N, Shan J, Martelli MP, Liso A, Pucciarini A et al. Both carboxy-terminus NES motif and mutated tryptophan(s) are crucial for aberrant nuclear export of nucleophosmin leukemic mutants in NPMc+ AML. Blood 2006; 107: 4514–4523. 13 Herrera JE, Savkur R, Olson MO. The ribonuclease activity of nucleolar protein B23. Nucleic Acids Res 1995; 23: 3974–3979. 14 Savkur RS, Olson MO. Preferential cleavage in pre-ribosomal RNA byprotein B23 endoribonuclease. Nucleic Acids Res 1998; 26: 4508–4515. 15 Yu Y, Maggi Jr LB, Brady SN, Apicelli AJ, Dai MS, Lu H et al. Nucleophosmin is essential for ribosomal protein L5 nuclear export. Mol Cell Biol 2006; 26: 3798–3809. 16 Okuda M, Horn HF, Tarapore P, Tokuyama Y, Smulian AG, Chan PK et al. Nucleophosmin/B23 is a target of CDK2/cyclin E in centrosome duplication. Cell 2000; 103: 127–140. 17 Colombo E, Bonetti P, Lazzerini DE, Martinelli P, Zamponi R, Marine JC et al. Nucleophosmin is required for DNA integrity and p19Arf protein stability. Mol Cell Biol 2005; 25: 8874–8886. 18 Grisendi S, Bernardi R, Rossi M, Cheng K, Khandker L, Manova K et al. Role of nucleophosmin in embryonic development and tumorigenesis. Nature 2005; 437: 147–153. 19 Bertwistle D, Sugimoto M, Sherr CJ. Physical and functional interactions of the Arf tumor suppressor protein with nucleophosmin/B23. Mol Cell Biol 2004; 24: 985–996. 20 Kurki S, Peltonen K, Latonen L, Kiviharju TM, Ojala PM, Meek D et al. Nucleolar protein NPM interacts with HDM2 and protects tumor suppressor protein p53 from HDM2-mediated degradation. Cancer Cell 2004; 5: 465–475. 21 Colombo E, Marine JC, Danovi D, Falini B, Pelicci PG. Nucleophosmin regulates the stability and transcriptional activity of p53. Nat Cell Biol 2002; 4: 529–533. 22 Deguchi K, Gilliland DG. Cooperativity between mutations in tyrosine kinases and in hematopoietic transcription factors in AML. Leukemia 2002; 16: 740–744. 23 Kelly LM, Gilliland DG. Genetics of myeloid leukemias. Annu Rev Genomics Hum Genet 2002; 3: 179–198. 24 Christiansen DH, Andersen MK, Desta F, Pedersen-Bjergaard J. Mutations of genes in the receptor tyrosine kinase (RTK)/RAS-BRAF signal transduction pathway in therapy-related myelodysplasia and acute myeloid leukemia. Leukemia 2005; 19: 2232–2240. 25 Pedersen-Bjergaard J, Christiansen DH, Desta F, Andersen MK. Alternative genetic pathways and cooperating genetic abnormalities in the pathogenesis of therapy-related myelodysplasia and acute myeloid leukemia. Leukemia 2006; 20: 1943–1949. 26 Pedersen-Bjergaard J, Rowley JD. The balanced and the unbalanced chromosome aberrations of acute myeloid leukemia may develop in different ways and may contribute differently to malignant transformation. Blood 1994; 83: 2780–2786.


955 27 Christiansen DH, Desta F, Andersen MK, Pedersen-Bjergaard J. Mutations of the PTPN11 gene in therapy-related MDS and AML with rare balanced chromosome translocations. Genes Chromosomes Cancer 2007; 46: 517–521. 28 Christiansen DH, Andersen MK, Pedersen-Bjergaard J. Mutations of AML1 are common in therapy-related myelodysplasia following therapy with alkylating agents and are significantly associated with deletion or loss of chromosome arm 7q and with subsequent leukemic transformation. Blood 2004; 104: 1474–1481. 29 Falini B, Nicoletti I, Martelli MF, Mecucci C. Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features. Blood 2007; 109: 874–885. 30 Shiseki M, Kitagawa Y, Wang YH, Yoshinaga K, Kondo T, Kuroiwa H et al. Lack of nucleophosmin mutation in patients with myelodysplastic syndrome and acute myeloid leukemia with chromosome 5 abnormalities. Leuk Lymphoma 2007; 48: 2141–2144.

31 Falini B. Any role for the nucleophosmin (NPM1) gene in myelodysplastic syndromes and acute myeloid leukemia with chromosome 5 abnormalities? Leuk Lymphoma 2007; 48: 2093–2095. 32 Boice Jr JD, Blettner M, Kleinerman RA, Stovall M, Moloney WC, Engholm G et al. Radiation dose and leukemia risk in patients treated for cancer of the cervix. J Natl Cancer Inst 1987; 79: 1295–1311. 33 Curtis RE, Boice Jr JD, Stovall M, Bernstein L, Greenberg RS, Flannery JT et al. Risk of leukemia after chemotherapy and radiation treatment for breast cancer. N Engl J Med 1992; 326: 1745–1751. 34 Pedersen-Bjergaard J, Andersen MK, Andersen MT, Christiansen DH. Genetics of therapy-related myelodysplasia and acute myeloid leukemia. Leukemia 2008; advance online publication, 17 January 2008.

Leukemia