Nuclear Genes Coding the Yeast Mitochondrial Adenosine ...

Download PDF
4 downloads 0 Views 2MB Size Report
Comment
Masaharu TakedaS, Alessio VassarottiO, and Michael G. Douglas9lI. From the ...... Masaharu Takeda, Alessio Vassarotti and Michael G. Douglas. Strains and ...
THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1985 hy The American Society of Biological Chemists, Inc.

Vol. 260, No. 29, Issue of December 15, pp. 1545S15465 1985 Printed in Li.S.A.

Nuclear Genes Codingthe Yeast Mitochondrial Adenosine Triphosphatase Complex PRIMARY SEQUENCE ANALYSIS OF ATP2 ENCODING THE F1-ATPase P-SUBUNIT PRECURSOR* (Received for publication, May 6, 1985)

Masaharu TakedaS, Alessio VassarottiO, and MichaelG . Douglas9lI From the Department of Biochemistry, The University of Texas Health Science Center, Sun Antonio, Texas 78284

The yeast nuclear geneATP2 encodes a F1-ATPase of this post-translational secretion process. &subunit protein of509 amino acidswith a predicted One approach which has been initiated in several laboramass of 54,575 daltons. In contrast to the ATPase B- tories is theisolation and utilization of nuclear genes encoding subunit proteins determined previously from Escherichia coli and various plant sources, the yeast mito- mitochondrial proteins (Douglas and Takeda, 1985). Analysis chondrial precursor peptide contains a unique cysteine of these genes is necessary to define the sequence of different residue within its immediate amino terminus. Expres- mitochondrially imported proteins required for proper cytosion of anin-frame deletionin ATP2 between residues plasmic sorting and mitochondrial membrane binding. Recent 28 and 34 to eliminate this single cysteine residue studies reveal that the information necessary for the in vitro located near the processing site of the matrix protease import of proteins intothe mitochondrial matrix (Hurt et al., does not prevent thein vivo delivery of the subunit to 1984) or the in vivo delivery tothe outer mitochondrial mitochondria orits assembly intoa functional ATPase membrane (Hase et al., 1984; Douglas et al., 1984) is present complex. Thus, the import FIB-subunit into mitochonat theextreme amino terminus of the protein. Analysis of the dria does not require a covalent modification of the type utilized for the secretion of the major lipoprotein primary sequence for a number of cytoplasmically synthesized from E. coli. In addition, analysis of the level of the mitochondrial proteins, however, has revealed little homology major F1-ATPase subunits in mitochondria prepared among sequences near the amino terminus. Thus, theanalysis from an atp2- disruption mutant demonstrates thatofthe the amino-terminal end of mitochondrially targeted molein vivo import of these catalytic subunits is not de- cules in cell, in additionto any covalent modification reactions pendent on each other. These data and additional studnecessary for targeting competency, are under active study. ies, therefore, suggest that the determinants for mitochondrial delivery reside within the amino terminus of The import and assembly of different nuclear coded subunits of the mitochondrial ATPase complex have been dethe individual precursors. scribed in earlier studies (Maccecchini et al., 1979). In addition, the structure and localization of the end product of this mitochondrial import and assembly sequence are published Studies in a number of laboratories have now defined the (Todd et al., 1981). Earlier studies from this laboratory have landmarks for the import of proteins into mitochondria (re- demonstrated that the FIB precursor subunit of the ATPase viewed in Hayet al., 1984). In contrast to the synthesis arrest-complex contains the information necessary to specifically dependent delivery of proteins to the endoplasmic reticulum deliver an enzymatically active Escherichia coli B-galactosid(Walter andBlobel, 1981) mitochondrial proteins synthesized ase protein fused to it into mitochondria in vivo (Douglas et in the cytosol may be delivered in completed form to the al., 1984). In the present study, we show that the in vivo organelle prior tothe initiation of import(Neupertand delivery of the F&subunit is not required for the correct in Schatz, 1981; Schatz and Butow, 1983). The combination of in vitro mitochondrial import experiments and in vivo pulse vivo localization of the F1-ATPasel a-subunit. Thus, the catlabeling studies provides convincing support for the post- alytic subunits of the ATPase complex are imported and translational delivery of at least 45 mitochondrial proteins processed independently rather than being imported as a (Hay et al., 1984). Further analysis of the protein sequences partially assembled complex. This analysis, therefore, prowhich direct the correct cytoplasmic sorting and mitochon- vides the starting point for a detailed examination of the drial delivery is required to better define the molecular events protein sequences which participate in the sorting and delivery of the individual Fl-ATPase protein precursors to mito* This investigation was supported by National Institutes of Health chondria as well as an analysis of the requirements for their Grant GM-25648. The costs of publication of this article were deimport and assembly into a functional complex. frayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solelyto indicate this fact. $ Present address: Department of Biochemistry, Yamagata University School of Medicine Zao-lida, Yamagata, Japan 990-23. Present address: Department of Biochemistry, Division of Molecular Biology, University of Texas HealthScience Center at Dallas, Dallas, T X 75235. ll Recipient of Grant AQ-814 from the Robert A. Welch Foundation. To whom reprint requests should be sent.

The abbreviations used are: F1-ATPase, the water-soluble portion of the yeast mitochondrial ATPase complex located on the matrix face of the mitochondrial inner membrane; Fo-ATPase, the membrane-associated portion of the mitochondrial ATPase complex located in the mitochondrial inner membrane; CCCP, carbonyl cyanide rn-chlorophenyl hydrazone; X-gal, 5-bromo-4-chloro-3-indolylB-D-galactoside; bp, base pair; kb, kilobase pairs; SDS, sodium dodecyl sulfate.

15458

Fl-ATPase p-Subunit Sequence EXPERIMENTAL PROCEDURES~

RESULTS

Primary Sequence of ATP2“In earlier studies the gene encoding the Fl-ATPase P-subunit wasisolated and partially characterized (Saltzgaber et aZ., 1983). Restriction analysis of the 5’region of the genedesignated ATP2 revealed the absence of convenient restriction sites for determination of the primary sequence. Therefore, Ba131 was utilized to generate a series of DNA fragments retaining various 5’ lengths of the ATP2 gene (Fig. 1).A 2.7-kilobase pair BamHI fragment encoding the 5’ end of ATP2 and approximately 1.5 kilobase pairs of noncoding DNA was ligated into pBR322. A Pst fragment containing plasmid DNA and ATP2 DNA on opposite ends was treated with Ba131 for different lengths of time followed by ligation into the yeast E. coli shuttle vector pSEY101. This plasmid allows forthe direct selection of inframe insertions based on the ability of the yeast ATP2 gene to promote expression of an active lac2 gene product in E. coli (Douglas et al., 1984). Since these constructions retain a BamHI site at thejunction site, a series of overlapping ATP2 fragments were screened by restriction endonuclease digestion and moved into M13mp8 for DNA sequence analysis. The organization of sequencesto provide a complete primary sequence of ATP2 is shown in Fig. 2. The sequence of 1921bp in Fig. 3 contains one open reading frame of509 codons (1527 bp) flanked by 104 bp of5’ noncoding DNA and 290 bp of 3‘ noncoding DNA. This open reading frame for ATP2 encodes a protein which exhibits a highdegree ofhomology with proton ATPase &subunits previously determined (see below). The calculated molecular weight of the yeast Fl@-subunitprecursor protein from this sequence is 54,575 daltons which is in agreement with the estimated size of the protein determined in different laboratories (Maccecchini et al., 1979; McAda and Douglas, 1982). The yeast FIB-subunit like that from other sources exhibits properties of a soluble globularprotein and contains a charge distribution which lacks any membrane spanning hydrophobic stretch (Kreil, 1981). The FIB-subunit, a relatively abundant protein in yeast, is estimated to constitute 3% of total mitochondrial protein (Todd et al., 1979). In addition, a relatively abundant ATP2 mRNA steady-state level has been demonstrated in cells grown on a nonrepressing carbon source (Szekely and Montgomery, 1984).The codon biasdetermined for ATP2 supports the facilitated translation of this RNA. The most frequently used codonsin ATP2 are biased toward cognate tRNAs which are most abundant in yeast (Table I). A calculated codon bias index for ATP2 of0.57 (Bennetzen and Hall, 1982) agrees well with our previous estimates that ATP2 messenger RNA encodes a relatively abundant translation product (0.3%of total protein) in yeast (Todd et al., 1979). Comparisonof the Yeast F1P-subunitwith Other SubunitsThe primary sequence of P-subunit of proton translocating ATPase is highly conserved from plant, animal, and fungal sources. Without making conservative amino acid substitu-

15459

tions, almost 50% of the amino acids (2411509) are identical among all six species determined thus far (Fig. 4). Between residues 80 and 505 in yeast, 74% are identical with those of E. coli. The subunits in all cases exhibit the greatest homology in the carboxyl-terminal half of the molecule. It is in this region where mutations have been mapped which effect the proper assembly of the @-subunitwith the remainder of the proton translocation complex in E. coli (Kanazawa et al., 1983). Recentstudies have shown that a serine to phenylalanine change in theE. coli subunit (residue 212 in the present numbering system) causes a 90% reduction in the specific M$+-dependent ATPase activity (Noumi et aL, 1984). In addition, glutamic acid residue 230 in the yeast Flj3-subunit has been proposedas part of the binding site for DCCD which inhibits the enzyme (Yoshida et al., 1982). It is noteworthy that the serine 212 as well as the glutamic acid residueat 230 are conserved in theprimary sequence of all /3-subunitsdetermined thus far. The high conservation of this region, as well as the analysis of covalent inhibitor binding to this same region of the protein (Esch and Allison, 1978; Bitar, 1982) strongly indicate that the 20-residue stretch, G-F211-S-VF-T-G-V-G-E-R-T-R-E-G-N-D-L-Y-R-E23O-M, constitutes part of the F1@-subunitcontribution to the active site of the ATPase complex. The most striking feature of the primary sequence obtained for the mitochondrialF1@protein is the presence of an aminoterminal end which is longer than thatpreviously determined for other subunits. This portion of the subunit lacks any sequence homology with that for the subunit from various plant sources. In other studies, this part of the Fl@-subunit has been shown to act as a specific mitochondrial targeting sequence (Emr et al.,1985).3 The FIP-subunits from plant chloroplast and E. coli are molecules which are synthesized and assembled within the same soluble compartment of the cell and unlike the mitochondrial Fl/3-subunit, donot have to be secreted through a bilayer prior to assembly (Gillham, 1978). The primary sequence of the bovine Fl@-subunitwas determinedby protein sequenceanalysis of the mature protein and, therefore, data for the pre-sequence was not available (Runswick and Walker, 1983). Deletion of the Only Cysteine in the Fl/3 at Residue 29 Does Not Block Its Assembly-A second unusual feature of the amino-terminal end of the yeast F1@-subunitwas the presence of the only cysteine groupin the entire precursor subunit at residue 30. This unique cysteine group was located close to the site proposed for proteolyticmaturation of the precursor by the matrix localized metalloprotease(McAda and Douglas, 1982;Bohni et al., 1983).Furthermore, the only cysteine found in any of the FIB-subunitsdeterminedthus far from all sources is a single conservedsite (residue 87 in thepresent numbering system, Fig. 4) in the plant proteins. Is this residue required for the correct delivery and secretion of the FIB peptide precursor into mitochondria in the same manner as the covalent modification of a cysteine for secretion of the major lipoprotein fromE. coli (Inouye et al., 1983)?In order to test this, an in-frame deletion was generated which removed this residue (Fig.5 ) . The construction utilized a unique PvuII site in ATP2 from which deletions were generated towardthe 5‘ end of the gene (see Fig. 5 legend). In-frame deletions were selected by moving the EcoRI-BamHI fragments of ATP2 lacking a PvuII site into plasmid pSEYlOl and assaying for the expression of @-galactosidaseand its localization in yeast. The region encompassing the deletion was characterized by DNA sequence analysis through the original PvuII site. Fig.

Portions of this. paper(including“ExperimentalProcedures,” Tables I and 11, and Figs. 1, 2, complete sequence of 4, and 6) are presented in miniprint at the end of this paper. Miniprint is easily read withthe aid of a standard magnifyingFull glass. size photocopies 9650 Rockville are available from the Journal of Biological Chemistry, Pike, Bethesda, MD 20814. Request Document No. 85M-1506, cite the authors, and includea check or money order for $3.20 per set of photocopies. Full size photocopies are also included in the microfilm A. Vassarotti, C. Smagula, and M. Douglas, manuscript in prepedition ofthe Journal that is available from WaverlyPress. aration.

Fl-ATPase P-Subunit Sequence

15460 t

t

t

t

t

4

4

t

t

t

GGTCTCCTCCTCMGTCAMTTGCTTTCTTTTCTTTCATTT~TAGTCTGTTGTTATCCMTTTATACTGAATCTTTGAGAGMMCAWTmUAGA

11 21 1 ACA TCC CGT CTG CTT T T A AAG CAG CCA AAC ATA TCG CCG CTT CTA ACC TCG TGG A M AGA TGT ATG GTT TTG CCA AGA CTA TAT ACT GCT net Val Leu Pro Arg Leu TyrThr Ala Thr Ser Arg Leu Leu Leu Lys Gln ProAsn Ile Ser Pro Leu Leu Thr Ser Trp Lys Arg Cys PVUII 31 ATG GCC TCA GCT net Alaal-S

41 51 CAT TTT GAA C M TCA GAG GCTCAA TCT ACTCCA ATC ACC GGT AAA GTT ACCGCTGTC ATT GGTGCC ATT GTT GAC GTT Ile Gly Ala Ile Val Asp Val Eis Phe Glu Gln Ser Glu Gln Ser Thr Pro Ile Thr Gly Lys Val Thr Ala Val

81 71 61 TTG CCC GCT ATT TTG AAC GCT TTA GAA ATT AAA ACA CCT CAA GGTAAG TTG GTT TTG GAA GTT GCTC M CAT TTG GGT GAA AAC ACT GTC Lys Thr Pro Gln Gly Lys Leu Val Leu Glu Val Ala Gln His Leu Gly Glu Asn Thr Val Leu Pro Ala Ile Leu Asn Ala Leu Glu Ile KpnI 101 111 91 AGA ACC ATT GCTATG GAT GGTACC GAA GGT TTG GTC CGT GGTGAA AAG GTT CTT GAC ACT GGT GGC CCT ATC TCC GTC CCA GTT GGG AGA Glu Gly Leu Val Arg Gly Glu LYS Val Leu ASP Thr Gly Gly Pro Ile Ser Val Pro val Gly Arg Arg Thr Ile A ~ Z Inet ASP 131 141 121 GAA ACT TTA GGG AGA ATC ATC AAC GTT ATC GGT GAA CCT ATT GATGAA AGA GGT CCA ATT AAG TCC AAA CTA AGA M G CCA ATT CAC GCA Pro Ile Ile Ile Glu Asn Val Pro Ile AspGlu Arg Gly GlU Thr Leu Gly Arg Ile Lys Ser LyS Leu Arg Lys.PrO Ile His Ala Gly 161 171 151 GAC CCT CCT AGT TTT CGA GAA CAA TCT ACT TCG GCT GAA ATT TTG GAA ACA GGT ATC A M GTC GTC GAT CTA TTA GCT CCT TAT GCC AGA Asp PKO Pro Ser Phe Ala Glu Gln Ser Thr Ser AlaGlu Ile Leu Glu Thr Gly Ile Lys Val Val ASP Leu Leu Ala Pro Tyr Ala Arg 191 201 NCOI 181 AAG ACTGTG TTCATT CAA GAA TTG ATT AAC AAT ATC GCC AAG GCC CAT GGT GGT GGTAAG ATT GGT CTTTTC GGT GGTGCA GGT GTC GGT Gly Gly Lys Ile Gly Leu Phe Gly Gly.Ala Gly Val Gly Lys Thrval Phe Ile Gln Glu Leu Ile ASn A m Ile A l a LYS Ala His Gly 231 221 211 GTC ATT AAC TTG GGT TTT TCC GTT TTC GCC GGTGTT GGT GAA AGG ACC AGA GAG GGT AAT GAC TTG TAC CAT GAA ATG GAA GAT TCG GGA Gly Phe Ser Val Phe Ala Gly Val Gly Glu Arg Thr Arg Glu Gly Asn Asp LeU Tyr His Glu Met GlU ASP Ser Gly Val Ile Asn Leu 261 PVUI 241 251 GAA GGT GAA TCC AAG GTC GCC TTA GTT TAC GGT CAA ATG AAC GAA CCT CCA GGA GCC AGA GCC AGA GTC GCTTTA ACT GGT TTG ACG ATC s Ala Leu Val TYK Gly Gln net Asn Glu pro pro Gly Ala Arg Ala Arg Val Ala Leu Thr Gly Leu T ~ F T E GlU Gly Glu ser ~ y Val 28 1 291 27 1 GCT GAA TAT TTCAGA GAT GAA GAA GGT CAA GAC GTC TTG TTG TTT ATC GAC AAT ATC TTT AGA TTT ACT CAA GCT GGTTCA GAA GTC TCT Ala GlU Tyr Phe A r g Asp Glu Glu Gly Gln Asp Val Leu Leu Phe Sle Asp Asn Ile PheArg Phe Thr Gln Ala G1y Ser Glu Val Ser 311 321 301 GCC CTT TTG GGT CGTATT CCA TCT GCC GTC GGT TAT CAA CCA ACT TTG GCC ACT GAT ATG GGT CTC TTA CAA GAA AGA ATT ACC ACC ACA Asp net Gly Leu Leu Gln Glu A r q Ile Thr Thr Thr Ala Leu Leu Gly Arg Ile Pro Ser Ala Val Gly Tyl Gln Pro Thr Leu Ala Thr 331 341 351 AAC AAG GGT TCTGTC ACT TCT GTG CAA GCC GTT TAT GTT TTG CCA GCC GAT GAT TTA ACA GAT CCG TCT CCG TCC ACA TCT TTT GCC CAT Lys Lys Gly Ser Val Thr Ser Val Gln Ala Val ~ y rVal pro Ala Asp Asp Leu Thr ASP Pro Ser Pro Ser Thr Ser Phe Ala His Leu 361 371 PstI BamHI 381 GAC GCA TCA TCC GTC TTG TCA AGA GGT ATT TCA GAA TTA GGT ATT TAC CCT GCA GTG GAT CCA TTG GAT TCTA M TCA AGG TTA TTG GAT Asp Ala Ser Ser Val Leu Ser Arg Gly Ile Ser Glu Leu Gly Ile Tyr Pro Ala Val Asp Pro Leu Asp Ser Lys Set Arg Leu Leu 401 410 ECORV 391 GCC GCC GTT GTC GGT CAA GAA CAT TAT GAC GTC CGG TCC AAG GTT CAA GAA ACT TTA CAG ACC TAT M A TCT TTACAA GAT ATC ATT GCT Ala Ala Val Val GlY Gln GlU His TyK ASP Val Ala Sex Lys Val Gln Glu Thr Leu Gln Thr Tyr Lys Ser Leu Gln Ile Ala 421 431 441 ATT TTG GGT ATG GAT GAA TTG TCC GAA CAA GAT A M CTA ACT GTC G M AGG GCA AGA MG ATT CAA AGA TTC TTA TCT CAA CCA GCT Ile Leu GLY net ASP G1U Leu Ser Glu Gln Asp LyS Leu Thr Val Glu Arg Ala &rg ~ y s Ile Gln Arg phe ~ e user ~ l pro n phe )ria 451 461 471 GTC GCC GAA GTC TTT ACT GGT ATC CCA GGT A A A TTA GTG AGA TTA AAGGAC ACC GTT GCCTCG TTC AAA GCC GTT TTG GAA GGT M A TAC Val Ala Glu Val Phe Thr GlY 1le Pro Gly Lys Leu Val Arg Leu Lys Asp Thr Val Ala Ser Phe LYS Ala Val Leu Glu Gly ~ y s

~ y r

481 491 501 GAT AAT ATA CCA GAACAT GCT TTC TAT ATG GTT GGT GGT ATT GAAGAT GTT GTP CGT A M GCT CAA AAG TTA GCC CGT GAA ccc A A C TAG Asp Asn I l e pro GlU His Ala Phe Tyr net Val GlY Gly Ile Glu Asp Val Val A r g LYS Ala Glu LYS Leu Ala Arg Glu Ala Asn NON Hind111 40 30 10 20 90 80 70 60 100 110 AAGAAATAAAGCTTAAACCAAGGGAAGCAAAATTTGAAATACCGAAGATGAACAATAAG GATGATGGGAAAAAAAAGAGAATTTTTTTTTTTTGTTTTTCCCTGCTTCCTTCTTGTTTA 120 130 140 150 160 170 180 190 200 210 220 230 TTGGTATTATTATGTTACGATATTCATTCATTATCCTATTGATATTTTCTTTATATTCACTMAAAMAATTTATTCTATMGACTGACTATAATTTTTTTTACTCCCAACTGTAAGTA

240 280 250 270 260 Sau3A AATAAAGACTCACCTACGCATACATTTTTTATATATACTATAAGATGTAG~T

FIG. 3. Nucleotide sequence of ATP2. Shown is the sequence of the sense strand only extending from 104 bp upstream of ATP2 to a Sau3A restriction site 290 bp 3’ of the gene. An open reading frame of 509 codons i s present containingconvenient unique restriction sites located along its entire length.

5 illustrates that a deletion of interest selected in this manner tional ATPase complex. The yeast host strain MDY2102 was missing18 base pairs which deletes the cysteine at,codon containing a gene disruption in thechromosomalATP2 gene 30. This deletion does not alter in any significant manner the was used for this analysis (see Fig. 6 under “Experimental delivery of the hybrid molecule to mitochondria. The specific Procedures”). It was unable to grow on a nonfermentable activity of the hybrid P-galactosidasein isolated mitochondria carbon source (glycerol) and lacked the partial reactions catas well as the level of hybrid protein detected in immunoblots alyzed by a functional ATP synthetase (see below).Eco-Bum (not shown) was not significantly affected by the deletion. fragments containing either the wild-type ATP2 sequence for A reconstructed ATP2 gene containing this 18-bp deletion the first 380 residues or the 27-35 deletion were ligated into encodes a FIB-subunit which could be assembledinto a func- the vector pAVOlO to reconstruct both forms of the ATP2

Fl-ATPase P-Subunit Sequence

15461

-

-

M R I N P T T S G S G V S T L E K K N P G R V V O I I G P M R l N P T T S D P G V S T L E K K N L G R I A O I I G P

M R T N P T T S R P G I S T I E E K S V G R I D O I I G P S P S P K A G A T T G R I V A V I G A M A T G K I V O V I G A S . c e r e v i s i a e M V L P R L Y T A T S R L L L K Q P N I S P L L T S W K R C M A S A A N S T P t T G K V T A V I G A 10

20

40

30

50

FIG. 4. Comparison of the F1-ATPase @-subunit from different sources indicates that the additional is present for mitochondrialdelivery. The @-subunitprotein sequences from amino-terminal information the proton translocating ATPase of tobacco (Shinozaki et aZ., 1983), spinach (Zurawski and Clegg, 1984), maize (Krebbers et al., 1982), bovine (mature form) (Runswick and Walker, 1983), and E. coli (Kanazawa et d.,1981; Saraste et d.,1982) were aligned with the yeast protein. This process aligned the proteins such that 241 of the 509 residues of the yeast protein were identical withall the other Fl@-subunits. Without making conservative substitutions, all of the Fl@-subunitsfrom the different sources (Miniprint Section) exhibit almost 50% protein sequence homology. Shown in thefigure is only the first 50 residues of the yeast FIj3-subunit. The entire sequence comparison is shown in theMiniprint Section.

Reconstruction Mitochondrial Dependent gly+ p galactosidase Phenotype in (units/mq) atp 2’ strain

Pvu II I

-

TGG TCG AnA ser trp lys arg cys met 27

pp A 27/35

-

TCA GCT GCT ala ser ala ala gln 35

-

780

+

TCG TGG A C S T ser trp thr ala gln 27 35

-

830

+

FIG. 5. Deletion of the single cysteine at amino acid residue 30 does not prevent targeting of the F1@-subunit to mitochondriaor its assembly into a function enzyme. The unique PvuII site at codon 34 of ATP2 was modified with Ba131. Digestion of an isolated Pvu fragment from the 5’ end of ATP2 with Bd31 was followed by ligation with the DNA fragment coding ATP2 beyond codon 34. This process yields deletions which extend from the PvuII site in the5’ direction. An in-frame deletion was confirmed by expression of @-galactosidase in yeast following insertion of the modified fragment into pSEYlOl (Douglas et al., 1984). DNA sequenceanalysis through the deletion confirmed that an18-bp deletion of Lys 28-Arg CysMet Ala Ser Ala 34 had been replaced by a Thr. Analysis of the specific activity of @-galactosidasein isolated mitochondria was according to Miller (1972). To analyze the effect of the deletion on the function of the @-subunitin vivo the wild type and deleted forms of ATP2 were reconstructed and insertedinto the ATP2 gene disruption host MDY2102 (see “Experimental Procedures”). Function of the modified Fl@-subunitwas determined by scoring for the plasmid-dependent growth of MDY2102 on a nonfermentable carbon source as well as by F1-ATPaseactivity (see text).

gene (see “Experimental Procedures”). The plasmid pAVOl0 contains ATP2 DNAencoding the carboxyl-terminal 129 codons of the gene beginningat a unique BamHI site at codon 380 (see Fig. 3). The resulting URA3 yeast-E. coli shuttle plasmids harboring the two forms of ATP2 were introduced into MDY2102, and Ura3+ transformants were screened for the expression of a functional mitochondrial ATPase complex by their ability to grow on glycerol. As expected, the wild type ATP2 construct was able to complement the atp2- null mutation in MDY2102, however, the A2735 construction also imported and assembled a functional but altered F1@-subunit. Control deletions which removedFIP residues 5’ from residue 34 would not support growth of the mutant (notshown). Additional studies confirmed that thegrowth of atp2- host on glycerolwas dependent on the plasmid-encoded ATP2 gene. First, growth of the host strains on rich media containing dextrose caused the co-loss of both the Ura3+ marker as well as the Atp2+ marker (glycerol+, not shown).Second, analysis of the F1p-subunit present in both mitochondria and an active F1-ATPase released from the mitochondrial membrane by organic solventindicated that a slightly larger form of the Flp-subunit could bedetected in MDY2102 expressing

the internally deletedgene(Fig.7). This analysis further indicated that the FIP residues 28-33 are not required for processing and assembly of the p-subunit into an active FlATPase particle. The specific activities of the partially purified Fl-ATPase preparations prepared by chloroform release were 22.6 k 2.7 mol of Pi released per min/mg and 26.6 f 3.1 mol of Pi released per min/mg, respectively, for the wild type and deleted Flp-subunit constructs. Deletion of ATP2 Blocks Functional Assembly of FObut Not Import of the FIP-subunit-The construction of the atp2- null mutant allowed the determination of two specific events in assembly of the ATPase complex. First, is the import of the Fl-ATPase ,%subunitinto mitochondria coupledto theimport of other major subunits of the F1-ATPase. Second,is a functional proton channel of ATPase FOproteins formed in mitochondrial membranes in the absence of the [email protected] has recently been shown that the delivery of precursor proteins to mitochondria can involve either their interaction with soluble components of the reticulocyte cell-free translation system (Argon et al., 1983; Miura et al., 1983; Firqaira et al., 1984; Ohta and Schatz, 1984) or the formation of oligomers of the precursors in the cytoplasm (Zimmermanand Neupert,

Fl-ATPase P-Subunit Sequence

15462

subunit present in mitochondria. Thus, in vivo, the mitochondrial delivery, import and processing of the Fla-subunit can occur independently of the Fl/3-subunit. If solublecomponent(s) in the yeast cytosol (Ohta and Schatz, 1984) function in the same manner as the component(s) in the reticulocyte lysate, then the present observations indicate that they do not mediate an obligatory coupling betweenthe subunits for mitochondrial delivery and import. Analysis of respiration rates in the atp2- null mutant indicated that a functional proton channel of FOproteins is not detected in the inner membrane (Table 11). Controlled mitochondrial respiration rates (succinate oxidation) were determined followed by measurement of the extent to which the protonophore CCCP couldstimulate respiration. The ratio FIG. 7. Expression of ATP2 harboring a 6-amino acid dele- of the CCCP stimulated rate divided bythe ratein the absence tion still assembles an active F1 particle. Mitochondria were of CCCP is a measure of the relative amount of endogenous prepared from MDY2102 harboring either control plasmid pAVO-10 proton channel present in the inner membrane or the integrity or plasmids expressing wild type subunit (PO) and the internal dele- of the inner membrane (Table 11).The presence of comparable tion pp A27-35. The cells were grown on yeast nitrogen base 0.3% controlled rates in the MDY2102 mitochondria and compaDextrose maintaining Ura+ selection. Mitochondria were prepared from yeast spheroplasts and partiallypure F1was released from rable stimulation by CCCP indicated that a functional proton isolated mitochondrial membranes by shaking with chloroform transporting pore is either not assembled or is present but (Douglas et al., 1979a). Both mitochondrial proteins (50 pg) and controlled by another mitochondrial protein at a point prior chloroform extractable F1-ATPase (15 pg) wereresolved on10% to assembly withthe Fl/3-subunit.

A B C D E

sodium dodecyl sulfate gels, transferred to nitrocellulose paper, and probed with antiserumagainst the Fl@-subunit. The location of antigen bound antibody was visualized by a goat anti-rabbit horseradish peroxidase conjugate. A, mitochondria, pAVO-IO; B, mitochondria, pp; C, released F1-ATPase, pj3; D, mitochondria, pj3 A2735; E, released F1-ATPase, ppA 27-35.

DISCUSSION

In the present study the nuclear gene encoding the mitochondrial Fl-ATPase subunit has been characterized and modified to examine the effect of a deletion near the amino terminus on the import and assembly of the precursor protein into afunctional complex. In addition, a chromosomaldisruption of the ATP2 gene encoding the Fl@-subunitwas constructed and analyzed to assess its effecton the in vivo mitochondrial delivery and import of the Fla-subunit and the assembly state of ATPase Fo proteins within the membrane. The protein sequence of the yeast F&subunit is well conserved when compared with the same subunits described from prokaryotic, plant, and animal sources. It is noteworthy that essential residues of the 8-subunit which have been defined in earlier studies by either chemical or genetic modification are located in highly conserved regions of all F&subunits characterizedthus far. The primary sequencesin these regions are, in fact, identical among the six different subunits. The sequence data provided in this study is compatible with the proposal that the active site of the FI@-subunitcontains tyrosine and serine residues participating in the nucleotide FIG. 8. Lack of FIB import into mitochondria does not re- binding event (Yoshida et al., 1982). duce the levelof Fla-subunit into mitochondria.Mitochondria Alignment of homologous regions of the Fl/3-subunits rewere prepared from the wild-type strain SEY2102 and atp2- strain veals that themitochondrial subunit, which must be correctly MDY2102 whichhad been grown 20-24 generations in [35S]S0,.Each mitochondrial preparation (5-7 X 10' cpm/pg) was extracted with delivered to an organelle and secreted from the cytoplasm, detergent and immunoprecipitated with antiserum against eitherthe contains additional residues at its amino terminus. The 8FIS- or Flcr-subunit (Todd et aL, 1979). The immunoprecipitates were subunit sequences previously determined from various plant resolved on 10% sodium dodecyl sulfate gels and visualized by fluo- sources and E. coli are for proteins which are synthesized and rography of the dried gel. Lanes A and C, wild-type mitochondria assembled within the same soluble cellular space (Gillham, immunoprecipitated with anti-Fla andanti-FIj3antisera, respectively; 1978).The mitochondrial subunit from the bovine source was Lanes B and D,the same quantity of mitochondria from MDY2102 determined by protein sequence analysis of the mature subimmunoprecipitated, respectively, with anti-Fla andanti-F1p. unit and therefore, did not contain the transient pre-piece which is removed upon delivery into the organelle (Maccec1980). In order to address the question of in vivo co-assembly chini et al., 1979). We have recently shown that this preof F1subunit precursors with soluble factors in the cytoplasm, sequence functions to target and import the precursor subunit an immunoprecipitation analysis was performed. Mitochon- into mitochondria (Emr et al., 1985): dria prepared from the wild type and atp2::LEU2 deletion It has been proposed that the nonhomologous regions in hosts whichhadbeenuniformlylabeled with 35S04were the NHz-terminal end of the F,P-subunit protein are probably quantitatively immunoprecipitated with antiserum directed not important for catalysis (Runswick and Walker, 1983). against either the FIB- or Fla-subunits (Fig. 8). Lack of in The present analysis isinaccordwith this prediction. A vivo expression of the F1P-subunitdoes not alter in any deletion between residues27 and 35 ofthe FIP-subunitprotein significant manner the apparent level or stability of the Fla- can still target and assemble a functional FIB complex within

A

a-

P-

B C D

15463

Fl-ATPase ,0-SubunitSequence the organelle. Studies currently in progress willdetermine the extent to which deletions within the amino-terminal end of the mature subunit will be tolerated for the in vivo assembly of a functional enzyme and the selection of second site mutations which maysuppress assembly defects or nonfunctional subunits. The specificpoint examined in thepresent study concerned the role ofthe single cysteine residue located at residue 29 of the precursor subunit. Analysis of the bovine mitochondrial FIP-subunit by different groups has indicated the presence of either one (Knowles and Penefsky, 1972; Brooks and Senior, 1972) or no cysteine residues (Runswick and Walker, 1983). Since a single cysteine in the yeast subunit was located near the proposed processing site of the precursor we considered the possibility that thecysteine may function as anintermediate in the import of the protein into mitochondria in the same manner as the secretion of the major lipoprotein to the outer membrane of E. coli (Inukai et al., 1984).Clearly, analysis of the in-frame deletion which removes this residue revealed that it is not required for in vivo assembly of the functional ATPase complex. It has been proposedin earlier studies (Nelson and Schatz, 1979) that the coordination of assembly events for subunits of the ATPase complex in organelle membranes must occur in such a manner that the insertion of the functional FO portion of the enzyme is controlled. The insertion of Fo proteins into a bilayer generates a proton channel which in the absence of the appropriate partner proteins renders the membrane unable to catalyze oxidative phosphorylation (Todd et al., 1981). In previous studies various yeast FlATPase mutants all expressed nonfunctional subunits which were assembled into detergent extractable complexes (Todd et al., 1979). Studies in E. coli on the other hand have demonstrated that theassembly of the Fo proteins of the proton ATPase into membranes may occur independently of the F1 polypeptides (Decker et al., 1982). The state 3 respiration rates of the mutant mitochondria were essentially the same as either the wild type control or the mutant expressing a plasmid encoded wild-type subunit. In addition, the stimulation of respiration in each of the mitochondrial preparations to approximately the same extent by uncoupler indicated that the membranes prepared from the deletion mutant were no more leaky to protonsthan themembranes prepared from the controls. Thus, the assembly of a functional proton channel of the Fo portion of the complex is notobserved in mitochondria lacking a FIP-subunit. Although the in vivo delivery of individual precursor proteins into mitochondria is believed to occur, there has been some speculation that there may be pre-assembly of Fl precursors prior to their import. Quantitation of the steady-state level of Fla-subunit present in mitochondria devoid of any FIB-subunit indicates that thein vivo delivery and import of the two largest subunits of the ATPase complex may occur independently of each other. Several laboratories have now independently described soluble components present in rabbitreticulocyte lysate (Argon et al., 1983; Miura et al., 1983; Firqaira et al., 1984) that can be replaced in some cases by a yeast cytosolic fraction (Ohta and Schatz, 1984) which are required for in vitro import of cytoplasmic precursors into mitochondria. The observation that single nuclear conditional mutants in yeast accumulate different precursor ATPase subunits at the nonpermissive temperature (Yaffe and Schatz, 1984) would further suggest that common cellular components like those present in the

cell-free translation system are operating in vivo to recognize different precursor subunits. The studies described herewould indicate that if a common cytoplasmic receptor element is operating in vivo it can individually bind and deliver a- and 0-subunit precursor molecules to mitochondria. Acknowledgments-We are grateful to Dr. S. Emr for his assistance with the gene fusions. The expert technical assistance of Mac Biggs, Marjorie Britten, and Janet Kendall is gratefully appreciated. REFERENCES Argon, C., Lusty, C. J., and Shore, G. C. (1983) J. BioL Chem. 258,6667-6670 Bennetzen, J., and Hall, B. (1982) J. BioE Chem. 257,3026-3031 Bitar, K. (1982) Bwchem. Biophys. Res. Commun. 109,30-35 Bohni, P., Daum G., and Schatz G. (1983) J. Biol. Chem. 258,4937-4943 Boutry, M., and Douglas, M. (19k) J. Biol. Chem. 258,15214-15219 Broach, J., Strathern, J., and Hicks, J. (1979) Gene (Amst.) 8 , 121-133 Brooks, J., and Senior, A. (1972) Biochemistry 11,4675-4678 Casadaban, M., and Cohen, S. (1980) J.Mol. Bwl. 138,179-207 Daum, G., Bohni, P., and Schatz, G. (1982) J. Biol. Chem. 257,13028-13033 Decker, K.,Brusilow,W., Gunsalus, R., and Simoni, R. (1982) J. Bacteriol. 152,815-821

Douglas, M., and Takeda,M. (1985) Trends Biochem. Sei. 10,192-194 Douglas, M., Koh, Y., Ebner, E., Agsteribbe, E., and Schatz, G. (1979a) J.Biol. Chem. 254,1335-1339 Douglas, M., Finkelstein, D., and Butow, R. (1979b) Methods Enzymol. 56,5866

Douglas, M., Geller, G., and Emr, S. (1984) Proc. Nutl. Acad. Sci. U. S. A. 81,3983-3987 Emr, S., Vassarotti, A., Geller, B.,Takeda, M., Garrett, J., and Douglas, M. (1985) J. Cell. Bwl. in press .". Esch. F.. and Allison. W. (1978) J. Biol. Chem. 253.6100-filOfi Estabrook, R. ( 1 9 6 5 ) ' M e t h Enzyml. 1 0 , 4 1 2 7 Firqaira, F., Hendrick, J., Kalousek, F., Draus, J., and Rosenberg, L. (1984) I

~~~

~

Science 226,1319-1322

Gillham, N. (1978) Organelle Heredity, Raven Press, New York Hay, R., Bohni, P., and Gasser, S. (1984) Biochim. Bzophys. Acta 779,65-87 Hase, T.,Muller, U., Riezman, H., and Schatz, G. (1984) EMBO J. 3 , 315721M

H s y E., Pesold-Hurt, B., and Schatz, G. (1984) EMBO J. 3,3149-3156 Inouye, S., Franceschini, T., Sato, M., Itakura, K., and Inouye, M. (1983) EMBO J. 2,87-91 Inukai, M., Ghrayeb, J., Nakamura, K., and Inouye, M. (1984) J. Biol. Chem. 259,757-760

Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983) J. Bacteriol. 153,1631138

K&zawa, H. Kayano, T., Kiyasu, T., and Futai, M. (1982) Biochem. Biophys. Res. Comm& 105,1257-1264 Kanazawa H. Noumi T., Oka, N., and Futai, M. (1983) Arch. Biochem. Biophys.' 22i, 596-6b8 Knowles, A., and Penefsky, H. (1972) J. Bwl. Chem. 247,6624-6630 Krebbers, E., Larrinua, I., McIntosh, L., and Bogorad, L. (1982) Nucleic Acids R ~ -10.4985-5nn2 -~, . - - - - - "

Kreic-G. (1981) Annu. Reu. Biochem. 50,317-348 McAda, P., and Douglas, M. (1982) J. Biol. Chem. 257,3177-3182 Macceccbini, M., Rudin, Y., Blobel, G., and Schatz, G. (1979) Proc. Nutl. Acad. Sci. U. S. A. 76,343-347 Maniatis, T., Fritsch, E., and Sambrook, J. (1982) Molecular Cloning: A Luborutory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Miura, S., Mori, M., and Tatibana,M. (1983) J. Biol. Chem. 2 5 8 , 66'714674 Miller, J. H.(1972) Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Nelson, N., and Schatz, G. (1979) Proc. Nutl. Acad. Sei. U.S. A. 76,43654369 Neupert, W., and Schatz, G. (1981) Trends Bwchem. Sci. 6,l-i Noumi, T., Futai, M., and Kanazawa, H. (1984) J. Biol. Chem. 259, 1007110075

Ohta, S., and Schatz, G. (1984) EMBO J. 3,651-657 Rothstein, R. (1983) Methods Enzymol. 101,202-211 Runswick, M., and Walker, M. (1983) J. Biol. Chem. 258,3081-3089 Saltzgaber-Muller,J., Kunapuli, S., and Douglas, M. (1983) J.Biol. Chem. 258, 11465-11470

Sanger, F.,Nicklen, S., and Coulson, A. (1977) Proc. NutL Acad. Sei. U. S. A. 74.5463454137 --- ~I~

~~~

Saraste, M., Gay, N., Eberle, A., Runswick, M., and Walker, J. (1981) Nucleic

Acids Res. 9,5287-5296 Schatz, G., and Butow, R. (1983) Cell 32,316-318 Sherman, F., Fink, G., and Lawrence, C. (1979) Methods in Yeast Genetics,

Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Shinozaki, K., Deno, H., Yato, A., and Sugiura, M. (1983) Gene (Amst.) 24, 147-155

Szekely E. and Montgomery D. (1984) Mol. Cell. Biol. 4,939-946 Todd, d., McAda, P., and Dodglas M. (1979) J. Biol. Chem. 254,11134-11141 Todd, R., Buck, M., and Dou las M. (1981) J.Bwl. Chem. 256,9037-9043 Towbin, H., Stalhelin, T., an8 GArdon, J. (1979) Proc. Natl. Acud. Sci. U.S. A. 7 ~425n-mm . - -, " " " "

Walter, P., and Blobel, 0. (1981) J. Cell BioL 91,551-556 Winter, G., and Fields S. (1980) Nucleic Acids Res. 8,1965-1974 Yaffe, M., and Schatz,'G. (1984) Proc. Nutl. Acad. Sei. U. S. A. 81,4819-4823 Yoshida, M., Allison, W., Eseb, F., and Futai, M. (1982) J. BioL Chem. 2 5 7 , 10033-10037

Zimmerman R., and Neupert W. (1980) Eur. J. Biochem. 109 217-229 Zurawski, G.', and Clegg, M. (i984) Nucleic Acids Res. 12,254912559 Continued onnext page.

Fl-ATPase @-SubunitSequence Supplement to

ATp2

Nuclear Genes Coding the Yeast Mitochondrial Adenosine Triphosphatase Complex: The Catalytic Subunits of the Fl-ATPase are Imported Independently

509 aa

c -

"

by .

Masaharu Takeda, Alessio Vassarotti and Michael G. Douglas Experimental Procedures Strains and Media The yeast strainsused were: Saccharomyces cerevisiae strain SEY2102 (MAT: leu2-3 leu2-112 ura3-52 suc2- 9 his4-519 sal21 and MDY2102 (MATa leu2-3 leu2-112 ura3-52 suc2- 9 his4-519 -gal2 atp2::LEUZ). Strain MDY2102 was constructed by using the one step gene transplacement technique (Rothstein, 1983) as described in Figure 6.

.

Y

A

I

-

TAG' ( 1527)

IATG

Figure 2. DNA Sequencing strategy. Restriction sites located within the ATP2gene were utilized to sequence approximately65% of the geneatits 3' end. Completion of the 5' region of ATP2 utilized overlapping Sst-BamBI fragments which were selected asdescribed in Figure1. The fragments were ligated into I413 lop8 and processed for DNA sequence analysis as described inExperimental Procedures. The hatched portionof ATP2 represents the region coding the F 6-subunit presequence. numbers in parenthesis indicate baselpairs from the start ATp2of for the unique restriction sites shown.

The E. coli strains used were: MC1066 (F- Alac X74 galU galKrpsLhsdR trpc9830 leuB600 pyrP::Tn5) (Casadaban and Cohen, 1980) and JMlOl (P- Alac pro S U ~ EtraD36).

E. coli containing various plasmids were grown in LB c o n t a T n i G T 0 u g h 1 ampicillin (Miller, 1972). Yeast were grown on minimal medium (YNB) supplemented with the appropriate a 1979. nutritional requirements and carbon source, Sherman &et For mitochondrial preparations log phase cells g r o w i z I nliquid DNA Sequence Analysis Ligation, transfection and culture on minimal medium were supplemented with one third volume Purification methods for M13mp8 and mp9 performed were as of YP medium(2% Yeast Extract, 2% Bactopeptone) 4 hrs prior to Published (Winter, G. and Fields, S., 1980). Primer extension harvest. dideoxv chain termination used the universal 15-nucleotide primer al, 1977). Sequence analysis (New EnglandBiolabs) (Sanger, F. of deletionsnear the 5' end of ATP2 zilized a 17-nucleotide Plasmid Analysis and Transformations- Transformation of primer 5"GCGTTCAAAATAGCGGG-3' provided by Dr. S . Horvath, Cal yeast(Ito, H. al, 1983)and E. (Maniatisetal,1982) Tech, whichhybridized at codons 60-65 of the gene. was as published with minormodiTication. PreparaEoii-of plasmid utilized an alkaline-sodium DNA on a small scale and large scale ATP2 Reconstructions- The plasmid pAV0-10 used for dodecyl sulfate method (Maniatis et al, 1982). Restriction reconstructing the ATP2 gene is a derivative of plasmid pSEYlOl endonuclease (New EnglandB i o l a b s r d ~ e s t i o n sand ligations with 1 9 8 T A BamHI fragment containing the carboxy (Douglas et T4 DNA ligase (Bethesda Research Labs) were performed in buffers 300 bp of noncodingDNA 3 ' to the terminal E 9 codons of ATP2 and aene was liaated into t h e n i a u e BamBI site in pSEY101. The recommended by the supplier. DNA restriction digests and DNA 6onstruitioi was selected in Ghich the 5' end of the was as fragment isolation from low gelling temperature agarose fragment was proximal to the unique ECoRI site of the-smid. previously described (Saltzgaber et al, 1983). Digestions with This plasmid harboring the ATP2 fragment was then digested wlth the exonuclease Ba131 (NewE n g l a n ~ B ~ l a b swere ) performed at PvuII which removes almost -of the gene present in the 23 ' C . olasmid. Since the Bam site oresent at the3 ' end of the ATPZ was

-

a,

A =

brief Ba131 digestion was performed to remove the remaining DNA 5 ' of thePVUII site and destroy the 3' end BamHIsite Of 7 hcfore . reliaation ~ " of the olasmid. The resulting plasmid (PAVO-10) contained ;~f;a$m&t~of;he gene coding its bp Of 3 ' carboxy terminal 129 residues plus greater 250 than noncoding DNA Containing all its transcription termination signals The Construct contained unique EcoRI and BamAI restriction sites for the direct religation ofDNAATP2 coding plus its 5' n o n x n g region. The the complete5' end of the gene plasmid retained the 2 micron azigin for high copy replication in yeast plus the gene for selection in yeast. h ~ DM& ~ .."_

E

"""

Hpo I

Hpa I

+I+' I

Barn HI

BamHI \ \ \

I

-z-i

I

\

I

/ \

Pvun I

mmHI

I

Figure 1.

pSEYlOl

t !

Preparation of ATP2DNA fragments containing different x 0 terminal codingregion. lengths of the 2, 1983) The 2.3 kb BamAI fragment from pJ14-1 (Saltzgaher containing 1200 bp 5 ' of ATP2 and 1050 bp of ATP2 codxng DNA was ligated into the BamHT s x of pBR322. Theysulting plasmid pBr14B2 was opened with PstI which cuts ATP2 adjacent to the Ban site in the gene. The linearized D N A 7 0 wl was then time digestedwiththeexonucleaseBa131(NewEnglandBiolabs). Digestions were performed at 23°C for different times in 2OOnM NaC1, 12mM CaCl2, l2mH MgCl 2OmM Tris-HC1, pH 8.1, lmM EDTA. Reactionswereterminated 'in phenol/chloroformfollowedby ethanol precipitation, The resulting DNA was then cut with ECORI al, 1984). cut with EcoRI and ligated into pSEYlOl (Douglas and SmaI. Ligation mixtures were transformed into E. coli MC1066 and plated onto LB Xgal plate8 containing 50 pg/%l ampicillin. Isolated dark blue colonies were selected and plasmid DNA6 were screened for the appropriate sized DNA to provide convenientDNA sequence overlaps.

-

I

b

/ BarnHI

I

I

ATPZ'

4 BamHI

I

/ I

\

\

B

I

LEU2 H T P Z '

m Ly

-P2

ATP2' leu2-

BomHI

I

a t p r LEU2'

Fi ure 6 . Gene disruption ofE . A 'modified form of plasmid pBR14-BZ (pVu322-82) containing a unique PVUII site at the extreme amino terminus of ATP2 was used as the site for the insertion of a EpaI fragmen-rom YEP13 The LEU2 gene. (Broach al, 1979) containing theyeast resulting construction yielded, upon digestion with BamRI, a LEU2 gene flanked by ATP2 DNA. T_ransformation of this linear DNB fragmentinto the-ast leu2 strain SEY2102 generated glycerol negative transformants (ROthStein, 1983). One of these transformants M ~ Y 2 1 0 2 was characterized by physical and genetic methods t o confirm that the disruption didoccur a t (not shown).

ATPZ

e

Fl-ATPase /3-SubunitSequence

-

Miscellaneous yeastfrom prepared Mitochondria were spheroplasts as previously described (Daum et al, 1982). Extraction of the soluble F.-ATPase from i s x a z d mitochondrial membranes using chloroform has a s ublished (Douglas &! 197%). Mitochondrial ATPase and (38P) ATP exchange actlvltles was performed a s previously published (Boutry and Douglas,1983). Mitochondrial respiration and determination of respiratory control ratios wasas previously described (Todd et al,1981). R-galactosidase activities were determined as prexoFly (Douglas published et al, 1984). to transfer Protein nitrocellulose used?i;iii% modification of puSlished methods (Towbin et &, 1979). Detection of antigenboundbyspecific antisera on nitrocellulose available 63i1.6 utilized a commercially 48+4.0 horseradish peroxidase-goat-antirabbit antibody conjugate SDS gels and autoradiography (BioRad). Resolution of samples on was performed a s previously vblished (Douglas 19792,). Antiserum to individually phLrfied F -ATPase subunits was generatedinrabbits as previouslydescribed(Douglas 6 1979a).

eta,

a,

TABLE I1

F -ATPase Mitochondrial Membranes Lacking the 5-subunit Exhibit UnCOUpleK Sensitive Respiratory control

SEX2102 MDY2102 Strain Respiration Rates' -CCCP +CCCP Respiratory Ratio control 32P.-ATP E han e mgl "P. zxchanged/min +oligomycin

21832

24159.0

3.855.15 4.575.51

N.D. N.D.

41.4 1.13

TABLE I Codon

usage

in ATp2

Phe uuu 9 ser ucu 11 TYK uau 8 TVr UAC 3 Phe uuc E Leu UUA 16 Ser UCA 7 Stp UAA 0 Leu UUG 23 Ser UCG 4 Stp UAG Trp 1 UGG 1 Pro CCU E His CAU 6 Leu CUU 5 Leu CUC 1 Pro CCC 1 His CAC 1 pro cca 14 Leu CUI 5 EEiTZZE Leu CUG 1 pro CCG 3 Gln CAG 2 Thr ACU 16 A m AAT 4 Tle AUU 21 " Thr ACC 11 Ile AUC 12 Asn AAC 8 Ile AUA 2 LYS AAA 12 ThK ACA 6 ACG 1 Met AUG 7 Thr LVS AAG 16 Val GUU 20 AI^ GCU 17 ASP GAU 17 Val GUC 20 Ala GCC 22 ASP GAC E Ala GCA 6 Val GUA 0 G1U GAA37 G1U GAG 1 Val GUG 5 Ala GCG 0

"-

cys UGU cys UGC Stp UGA

1 0 0

AKg Arg Arg arg ser Ser Arg AKg GIY Gly Gly Gly

6

CGU CGC CGA CGG AGU AGC AGA AGG

0

o

0

1 0 19 2 GGU 42 GGC 1 GGA 1 GGG 2

The underlined codons are those defined as the preferred an ATP2 codon bias index of codons in yeast. Calculation of 0 . 5 7 was pereofmed according to B e n n E n and Hall, 19EZ, which excluded methionine, tryptophan and aspartic acid residues.

'ng atom O/nin.mg, Freshly Prepared mitochondria from the parental type and atp2-::LEU2 host were suspended at 0.8mg per ml in air saturated 0.6N Mannitol, 20mN Tris-glycylglycine pH7.2, lOmM Na Succinate, 2mg/ml bovine serumalbumin (defatted). After a linear respiration rate was established 23'C, at10,M CCCP was added followed by determination of the uncoupled rate. The 5 6 0 ng atom O/ml concentration of oxytJ)n at 23°C was estimated at (Estabrook, 1965) P.-ATP exchange rates were measured as described in Expe;imenth Procedures. N.D. indicates no detectable incorporation above background.