II Recipient of Grant 1-814 from The Robert A. Welch Foundation. To whom reprint requests should be sent: ...... Genome (Kroon,. A., and Saccone, C., eds) pp.
THEJOURNAL OF BIOLOGICAL CHEMISTRY
Vol. 261, No. 32, Issue of November 15, pp. 15126-15133,1986 Printed in U.S.A.
0 1986 by The American Society of Biological Chemists, Inc.
Nuclear Genes Encodingthe Yeast Mitochondrial ATPase Complex ANALYSIS OF ATPl CODING THE Fl-ATPase a-SUBUNIT AND ITS ASSEMBLY* (Received for publication, May 27, 1986)
Masaharu TakedaS, Wen-Ji Chen,Jo SaltzgaberQ,and MichaelG. Douglasll From the Departmentof Biochemistry, Southwestern Graduateschool of Biomedical Sciences, University of Texas Health Science Center, D a h s , Texas 75235 .
Mitochondria prepared from the yeast nuclear pet subunits in the catalysis of ATP synthesisor breakdown mutant N9-84 lack a detectable F1-ATPase activity. suggest that the catalytic sites within the catalytic core are Genetic complementation of this mutant with apool of reversible and that cooperative interactions occurbetween yeast genomicDNA in the yeastEscherichia coli shut- these sites(Cross, 1981). Independent data indicate that there tle vector YEpl3 restored its growth on a nonferment- are three exchangeable nucleotide sites in F, which interact able carbon source. Mitochondria prepared from the in a fashion such that cooperativity between sites is essential transformed host contained an 8-fold higher than nor- for catalytic function (Gresser et aL, 1982). mal level oftheF1a-subunitandrestoredATPase In the present study, genetic complementation and bioactivity to 50%that of the wild-type strain. Deletion chemical analysis of a yeast pet mutant indicate that the and nucleotide sequence analysis of the complementing absence of F1-ATPase activity in this strain is due to the DNA on the plasmid revealed a coding sequence designated ATPl for a protein of 544 amino acids which expression of a defective F1a-subunit. Thenuclear pet mutant exhibits 60 and 54%direct protein sequence homology N9-84 (Tzagoloff et al., 1975), which is unable to grow on a nonfermentable carbon source, can be rescued for growth on with the proton-translocating ATPase a-subunits from tobacco chloroplast and E. coli, respectively. In vitro glycerol by the yeast gene ATPl which encodes the mitochonexpression and mitochondrial import experiments us- drial F1-ATPase a-subunit. The ATPl-encodedprotein is ing this ATPl sequence showed that additional amino-highly homologous with the a-subunitsof proton-translocatATPases from other sources except that it contains an terminal sequences not present in the comparable ing plant and bacterial subunits function as transient sequences additional transient sequence at its amino terminus, which we show is responsible for its import into mitochondria. The for import. availability of ATPl and other genes encoding the mitochondrial F,-ATPase subunits in yeast (Takeda et al., 1985) now provides the probes necessary for a detailed structure-function The ATPase complex of the mitochondrial inner membrane analysis of the different subunits in energy transduction and consists of protein subunits synthesized in the mitochondrial the construction of mutants which test current models of matrix andcytoplasm (Dujon, 1981). The mitochondrial com- subunit cooperativity. plex, like that characterized from other sources, appears to be structurally andfunctionally conserved (Futai andKanazawa, EXPERIMENTALPROCEDURES 1983;Walker et al., 1985).Analysis of genes encoding different Strains and Media-The yeast strains used in this study were DC5 subunits of the enzyme from sources as divergent as Esche- MATa leu 2-3 leu 2-112 his 3 can 1-11and N9-84 MATa pet C258 richia coli and mammals indicates that theprimary sequence (a gift from A. Tzagoloff, Columbia University (Tzagoloff etal., of proteins which constitute the catalytic core of the F1- 1975)). XJYl2 MATa leu 2-3 leu 2-112 pet can 1-11 was isolated ATPase a-, /3-,and y-subunits as well as subunits of the following sporulation of a N9-84 X DC5 diploid and back-crossed twice with DC5. Yeast cells were grown on minimal medium supplemembrane sector Fo arehomologous. with appropriate nutritional requirements (Sherman et al., The yeast mitochondrial complex, like that of the proton- mented 1979) or YP media (1%Bacto-yeast extract, 2% Bacto-peptone contranslocating complexes from other sources, exhibits an taining 2% (w/v) dextrose, galactose, or glycerol). DNA pools were a3:/33:yl subunit stoichiometry of its three largest subunits propagated in E. coli strain RR1 (F- pro leu thi lacy strR r-m(Todd et al., 1980). Current models of the function of these endol-). DNA manipulations were performed in MC1066 (F- lac X74
* This investigation was supported by National Institutes of Health Grants GM25648 and GM36536. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EMBLDataBankwith accession numbeds) 502603. $ Present address: Dept. of Biochemistry, Yamagata Univ., School of Medicine, Zao-lida, Yamagata, Japan 990-23. Present address: New England Nuclear, 85 Wells Ave., Newton, MA 02159. II Recipient of Grant 1-814 from The Robert A. Welch Foundation. To whom reprint requests should be sent: Dept. of Biochemistry, Southwestern Graduate School of Biomedical Sciences, Univ. of Texas Health Science Center, 5323 Harry Hines Blvd., Dallas, T X 75235.
gal U gal k rps L hsd R trp C9830 leu B600 pyr F:Tn5). M13 phage and sequencing templates were prepared in JMlOl (F- lac pro supE tra D36). E. coli harboring various plasmids and phage was maintained on media as we have previously described (Takeda et al., 1985; Adrian et al., 1986). DNA Methods and Transformations-A recombinant plasmid pool of yeast genomic DNA in the yeast E. coli shuttle vector YEpl3, a gift from B. Hall, University of Washington, Seattle, was used as previously described (O’Malley et al., 1982; Saltzgaber et al., 1983). DNA transformation into Saccharomyces cerevisiae utilized the lithium acetate-polyethylene glycol method (It0 et al., 1983). Restriction endonuclease digestions and ligations with T, DNA ligase were performed according to directions of the commercial supplier. Isolation of DNA, agarose gel electrophoresis, and E. coli transformations were performed with minor modification of published methods (Maniatis et al., 1982). DNA sequence analysis was carried out by the dideoxy chain termination method (Sanger et al., 1980). Analysis of DNA sequences utilized the program of Queen and Korn (1984).
15126
15127
ATP1 Encodes the Fl-ATPase cy-Subunit LinkedTranscriptionTranslation and Mitochondrial ImportTranslatable mRNA specific for ATPl utilized the coding sequence of the gene adjacentto thepromoter for bacteriophageT, polymerase (Tabor and Richardson, 1985). An AatII site just 5’of the ATPl translational start site was ligatedinto theSmaI site of the polylinker sequenceof the tran~riptionplasmid pT7-1 (seefigurelegends). Prior to transcription, theplasmid was linearizedat a unique BamHI site 3’ of ATP1. A capped full-lengthATPl transcript was generated as follows. The transcription reaction included, in a 50-gl reaction, 40 mM Tris-HCl (pH 8.01,15 mM MgCh, 5 mM ~thiothreitol,500 pg/ml bovine serum albumin, 50 units of RNasin (Promega Biotec), 5 mM GpppG, 2-3 pg of linearized DNA,and 60 units of T7polymerase 10 (International Biotechnologies Inc.). Following an incubation of min at 37 “C to allow for the formation of cap structures, GTPwas added to 5 mM (Konarska et aL, 1984), andthe mixture was incubated for an additional30 min. RNA prepared this in manner wastranslated in a nuclease-treated reticulocytelysate with modifications as previously published (McAda and Douglas, 1982). Miscellaneous-Mitochondriawerepreparedfromyeastspheroplasts as described previously (Daum et a i , 1982). Sodium dodecyl sulfate-polyacrylamidegelelectrophoresis was performed as published (Douglas et al., 1979a, 1979b). Ouchterlony plates and immunotitrations were aswe have previously described (Todd etaL, 1979). Rabbitpolyclonalantiserumspecific for each of thethreelarge subunits of the yeast F,-ATPase have been previously characterized (Maccecchini eta t , 1979). Protein was determinedby a modification (Todd etaL, 1979) of the Lowry method (Lowry etaL, 1951). Materials-Nuclease-treated reticulocyte lysate was obtainedfrom PromegaBiotec. [~SIMethionine(1000 Cilmmol) was fromNew EnglandNuclear.OligomycinandEfrapeptinwereobtainedfrom Sigma and Lilly, respectively, and dissolvedin methanol.
U
s
v
B
B E S m a S ti
# 2pDNA
FIG. 1. Restriction map of pJY 12-5.Following transformation of the yeast pet mutantXJY 12 to growth on glycerol and Leu+ media, plasmid DNA prepared from yeast transformants was propagated in E. coli and analyzed as described under “Experimental Procedures.” Shown is the restriction mapof plasmid pJY12-5 which was utilized for further analysis inthis study. The plasmid shownis YEpl3 (10.3 kb)containing5.6kb of yeastgenomic DNA withintheunique BamHI site of this vector: B, BarnHI; S, Sa& E, EcoRI, H, HindIII.
formants which exhibited a slower than expected but detectable growth on the nonfermentable carbonsource were further The yeast nuclear pet mutant (N9-84) has been previously analyzed. Analysis of plasmids rescued from these transformcharacterized (Tzagoloff et al., 1975). This mutantwas shown ants which exhibited cotransformation of the Leu+ and Gly’ to specifically lack a detectable mitochondrial F,-ATPase markers revealed that they contained inserts which exhibited activity yet stillexhibit respirationrates andenzymatic activ- a common internal restriction fragment. Since all of the ities associated with the different respiratory complexes of transformants regenerated more slowly than we normally the inner membrane which were at least 70% that of the observe for complementation of growth on glycerol, the comparental strain.Genetic analysisof this mutantindicated that plementing plasmid harboring the largest insert within the it was a single nuclear semidominant allele. Diploids hetero- unique BamHI site of YEpl3 was used for further analysis. zygous for the N9-84 mutation grew at slightly reduced rates This plasmid, designated pJY12-5 (Fig. l),restored growth of comparedwith diploids heterozygous for other pet alleles XJY12 on glycerol; however,the doubling time for the transwhich lack a detectable F,-ATPase activity. Analysis of the formant (305 & 15 min) was markedly slower than thatof the mitochondrial ATPase activities from heterozygous diploids wild-type strain (140 & 10 min) grown under identical condiharboring the pet N9-84 allele revealed that they contained tions. No measurable growth of XJY12 transformed with the F,-ATPase activitieswhich were reduced relative to either the shuttle vector YEpl3 was detected under these conditions. wild-type haploid or diploid (not shown). In previous studies We suspect that this reduced rate of growth of the transfor(Takeda et al.,1985) from this laboratory, we have character- mant was due to thesemidominant pet allele in XJY12 noted ized yeast mutantsin ATP2 encoding the F,-ATPase @- previously. Since this might be due to co-assembly of a nonsubunit. These studiesrevealed that expression of a defective functional subunit in the ATPase within mitochondria, the &subunit interferes with the assembly of a wild-type subunit levels of the catalytic core subunits inF, were quantitated. First, mitochondria prepared from the transformant and to the extent that mitochondria harboring both the mutant and wild-type subunits contain only 15-20% of the wild- the pet mutant exhibited similar protein profiles when distypemitochondrialF,-ATPaseactivity (Saltzgaber et al., played on SDS‘ gels (Fig. 2). Most apparent, however, was 1983). This observation taken together with data that the pet the presence of an abundant mitochondrial protein in the N9-84 allele exhibited a semidominant effect on the level of XJYl2 transformant mitochondria which co-migrated with the mitochondrial ATPase in the diploid suggested that this the mature Fl a-subunit protein. Mitochondria prepared from mutation defined the gene encoding another subunit of this the wild-type strain (DC5) exhibited an apparently equivalent ATPase complex which effectively competed with the assem- level of the F,-ATPase a- and @-subunits,whereas the mutant XJYl2 mitochondria contained an apparent level of the CYbly of the wild-type subunit. In order to select the gene complementing the pet N9-84 subunit which was reduced from that of the parental strain. allele, strain constructions were performed to place this pet The amount of F, @-subunit in XJY12 appeared to be the mutation and theleu 2-3 leu 2-112 mutation into thehaploid same as that of the parental strain. Additional analyses (not strain (see “Experimental Procedures”). The resulting mutant shown) which utilized antiserum specific for the %-subunit (XJY12) was then transformed with a pool of wild-type yeast confirmed the presence of reduced and increased levels of the mitochondria, genomic RNAcarried in the yeast E. coli shuttle vehicle a-subunit in themutantandtransformant respectively. YEpl3 (see ”ExperimentalProcedures”). A total of30004500 Leu’ transformants which grew on minimal dextrose plates for 3 days were replicate-plated to YPmedium containTheabbreviationsused are: SDS,sodiumdodecylsulfate;kb, ing glycerol. After 5 days of incubation at 30 “C, six trans- kilobase; bp, base pair. RESULTS
~~~
ATP1 Encodes the Fl-ATPase a-Subunit
15128
A B C D E -w-”
I “””
456’
78.
TABLEI Quantitatwn of Fl-ATPase subunitsin mitochondria Determination of the relative amount of each subunit associated with isolated mitochondria utilized Ouchterlony plates consistingof 1%agarose, 0.14 M NaCl, 0.01 M Tris (pH 8.01, and Triton X-100 added to a final concentration of 1%(w/v). In each case, 20pl of unfractionated antiserum specific foreither of the three largest subunits of the enzyme were loaded in the center well; and 20 pl of serially diluted mitochondria, 1.0 mg/ml initial protein (Lowry et al., 1951), in 0.14 M NaC1, 0.01 M Tris-HC1 (pH 8.0), 1%Triton X-100 were addedto the external wells. Precipitation bands were allowedto develop in a moistened chamber for2 days, at which time the lowest amount of mitochondrial protein requiredto form a visible immunoprecipitation line wasrecorded. The numbersin the upperpanel represent the lowest amount of mitochondrial protein addedto the well which yields an immunoprecipitation band. For each subunitspecific antiserum, the relative amountof subunit present compared to the control was calculated by dividing the minimum pg ofDC5 (YEpl3) mitochondria necessary for end-point titration by that for each mitochondrion assayed in the set. Mitochondriawere prepared as described under “Experimental Procedures” from cells grown on Yeast nitrogen base medium (Difco) maintaining selection for Leu+ and 2% galactose as the carbon source (Shermanet al., 1979). Strain
Plasmid
9-
FIG. 2. Specific overproduction of the F1-ATPasea-subunit in mitochondria. Mitochondria were prepared from wild-type, mutant, and transformant yeast strains following growth for Leu+ selection on YNB mediacontaining 2% galactose as carbon source. Shown on anSDS-12.5% aremitochondrialprofilesfollowingseparation acrylamidegel and then staining withCoomassieBlue. Lune A, purifiedATPasecomplex; lanes E and E, DC5 transformed with YEp13; lane C, XJYl2 transformed with YEpl3; lane D, XJYl2 transformed with pJY12-5.
Subunit-specific antiserum F1 a pg
DC5 XJY12 DC5 XJ125
YEpl3 1.25 10.0 YEpl31.25 5.0pJYl21.25 5.0pJYl2 1.25
FI B FI Y mitochondrial protein
0.625 1.25 0.156 0.078
10.0
Normalized data”
DC5 YEpl3 1 1 XJYl2 YEpl3 0.5 1 pJYl2 4 1 DC5 XJ125 pJYl2 8 1 a Values normalized for each subunit to DC5 (YEpl3).
1 1 2 2
Second, in order to quantitate the level of a-, p-, and ysubunits present in these mitochondria, end-point immunoTABLEI1 titrations were performed (Table I). Serial dilutions of mitoAnalysis of mitochondrial ATPase activities chondria prepared from XJYl2 and the transformant with pJY12-5 were titrated against antiserum specific for each of Mitochondrial F1-ATPasespecific activity the three largest subunits of the F1-ATPase. In eachcase, the Strain Plasmid relative amount of eachsubunitpresentinthedifferent Plus No Plus Plus inhibitor EfraDeutin olieomvcin anti-F. preparations was defined by the lowest amount of mitochondrial protein which would produce a detectable immunopreXJYl2 YEpl30.12 0.15 0.19 0.14 XJY12 pJYl2 2.13 1.47 0.37 0.22 cipitation line ona n Ouchterlony plate. This immunotitration DC5 YEpl3 3.97 0.24 0.17 0.40 analysis revealed that the level of Fl-ATPase p- and yDC5 pJYl20.18 4.23 0.76 0.23 subunits remained relatively constant among the different as pmol of Pi released min” mgof mito“Values are expressed mitochondrial preparations. However, the end-point signal as describedfor for the a-subunit was produced with eight times less mito- chondrialprotein”.Mitochondriawereprepared Table I and analyzedforinhibitorsensitivityasdescribedunder chondriafromthetransformantthanfromthe wild-type “Experimental Procedures.” Mitochondria were incubated with instrain. On the other hand, twice the amountof mitochondrial hibitors Efrapeptin (0.1pglml), oligomycin (1pglml), or anti-F, IgG protein from XJYl2 mitochondria was required to produce (2 pl/ml) in assay buffer for5 min at 30 “C prior to the initiation of the same end-point signal as that of the parental mitochon- the enzyme assay. The anti-F1 antiserum IgG fraction was dialyzed dria. These data confirm the results shown Fig. in 2 that the against 0.14 M NaCl, 20mM Tris-HC1 (pH7.2) to remove endogenous phosphate. The final protein concentration of the IgG fraction was steady-state level of the a-subunit in XJY12 mitochondria 25 mg/ml. Addition of rabbit IgG processedin the same manner from was about half that of wild-type and that the transformant the preimmunized animal did not significantly change values from mitochondria contained approximately eight times the level those obtained inthe absence of inhibitors. of the F1 a-subunit of the parental strain. The changes in the level of a-subunit present in mitochondria did not signifi- mutant XJYlZ contained a level of ATPase activity which cantly affect the steady-statelevel of the other major subunitswasbarelymeasurable. Thisbasalactivity was, however, of the F1-ATPase. This provides further support for the notion insensitive to theFl-ATPase-specific inhibitors and therefore that individual subunits of the Fl-ATPase are independently probably represented a ATP hydrolytic activity of another importedintomitochondria (see alsoBurnesand Lewin, kind. The activityof the mutantwas less than 4% that of the 1986). wild-type parental strain DC5 grown on the same carbon The pet mutant N9-84 was originally selected for these source. ATPaseactivities of the transformant whichwas complementation studies because it lacked a detectable mi- competent for growth on a nonfermentable carbon source tochondrial ATPase activity. T o define the extent to which increased dramatically to a level which was approximately 50% that of the wild-type strain. The activities determined the enzyme activity was restored in the transformant mitochondria, ATPase activitieswere determined (Table 11).The under these conditions were sensitive to Efrapeptin and oli-
ATPl Encodes the Fs-ATPase ~
-
S
~
u
~
~
~
15129
that it contained a continuous open reading frame which translated into a protein sequence exhibiting greater than 60% homology with an ATPase a-subunit sequence determined previously in tobacco chloroplasts (Deno et al., 1983). Completion of the DNA sequence was performed utilizing the strategy shown in Fig. 4 (Appendix). The gene lacked convenient restriction sites and required the subcloning of Sau3A DNA fragments near the 5’- and 3”regions of the gene. The complete sequence of the fragment from the EcoRI site to the end of the complementing yeast DNA fragment is shown in Fig. 5 (Appendix). Within this sequence of 2385 bp is contained one open reading frame which will encode a protein of 544 amino acids. The translated sequence is highly homologous with the ATPase a-subunit sequences described earlier (Gay and Walker, 1981; Kanasawa et al., 1981; Den0 et al., 1983; Walker et al., 1985). The predicted sequence from yeast exhibits a direct protein sequence homology of 60 and 54% when compared with the analogous subunits from tobacco chloroplast and E. coli, respectively (not shown). The predicted size of the protein (58,485 daltons) is essentially identical to that observed for the yeast F1-ATPase cu-subunit precursor defined in earlier studies (Maccecchini et al., 1979). Calculation of a Codon Bias Index value of 7.2 predicts that this DNA encodes a mRNA which is as abundant as that encoding the ATP2gene product (Takeda et al., 1985). Independent analysis has in fact demonstrated that the mRNAs encoded by these DNAs are coordinately regulated and expressed to approximately the same extent under derepressing conditions (Szekely and Montgomery, 1984). We propose ATPl as the name of this gene encoding the F, a-subunit, subunit 1 of the mitochon~ial adenosine triphospha~se. Further analysis of the sequence 5’ to theATPl translational start site revealed the presence of a second reading frame located at position -446 (Fig. 5, Appendix). Translation of this region yields a hydrophobic protein of predicted size 6,760 daltons which does not exhibit any apparent homology to any known protein. This open reading frame is not responsible for complementation of XJY12 mutant based on the observation (Fig. 3) that DNA fragments containing this region (but not ATPI-coding DNA) will not restore growth of XJY12 on glycerol. Mitochon~ialF1-ATPase subunits in contrast to those of E. coli and chloroplast are synthesized and assembled in different intracellular compartments. Independent studies have shown that the Fl-ATPase subunits imported into miH B S S B H E P GLY ~ c h o n ~contain ia a transient presequence at their amino rn b\\\\\\W + terminus in the cytoplasm which is processed within mitochondria (Maccecchini et al., 1979). In the case of the F,ATPase@-subunit(Emr et al., 1986), like other imported subunits (Hurt et aL, 1984) into yeast mitochondria, this I I + transient presequence is required for targeting the precursor subunit to itssite of assembly within the organelle. As shown I 4 in Fig.6A, the sequence of ATP1 from yeast contains an 0 1 2 3 4 5 6 7 K b additional 36 amino-terminal residues when compared with FIG. 3. Deletion mapping ATPl on pJY12-5. Shown at the those from E. coli and tobacco chloroplast. This additional top is the regionofpJY12-5containing a5.9-kbinsertofyeast sequence exhibits properties described earlier for the presethin line. The hotckd line is the quences of other mitochondrially imported protein. In the genomicDNArepresentedasa HindIII-PuuII region of the YEpl3 plasmid which is pBR322 DNA. case of ATPI, this sequence contains basic residues, lacks Insertion into the unique BarnHI site of YEpl3 has retained BamHI a site proximal to the H i d 1 1 sites in the starting vector and has lost acidic residues, and contains a slightly higher than average the BarnHI site (3‘-end of the insert shown) proximal to the unique abundance of hydroxylated amino acids. This sequence like PuuII site in YEpl3. The ~rangementofrestriction sites shown presequences previously characterized to target proteins to madepossible thesubcloning of thefragmentsindicatedusing mitochondria contains basic residues distributed such that an BarnHI, HindIII, and PuuII as indicated into YEpl3. These constructs were then tested for their ability to complement the nuclear amphipathicstructure (Douglas et al., 1986) is potentially pet mutation in XJY12. Leu+ transformanta harboring YEpl3 with generated (Fig. 6, lower panel). In the case of the ATPl the indicated DNA fragments were scored for their ability to grow on presequence, projection of the predicted a-helical stretchfrom YP medium containing glycerol. residues 5-23 yields a strong segregation of charged residues gomycin, specific inhibitors of the mitochondrial complex (Douglas et al., 1979a, 1979b). One unexplained observation in thepresent studywere data indicating that the oligomycin-sensitive ATPase activity of the transformant was restored to approximately 50% of the wiid-type; however, it grew poorly on the mit~hondrial dependent carbon source. The reduced growth efficiency may reflect interference by the defective a-subunit still expressed in the host for correct assembly with the functional subunit in the complex. The Fl-ATPase a-subunit is still expressed in the mutant and most likely co-assembles with the wildtype copy to yield a “hybrid” ATPase complex. This assembly contains anactive Fl-ATPase, yet is defective in some manner to efficiently catalyze energy transduction through the remainder of the membrane-bound enzyme. Studies are currentlyin progress to measure the forward reaction (ATP synthetic capacity)of the membrane-bound complexes in each case. In order to confirm that the complementing plasmid does itself encode additional copies of the F, a-subunit and does not affect in some manner increased expression or reduced rates of degradation of the chromosomally encoded subunit, we characterized the complementing DNA in pJY12-5. For this, we initially analyzed various overlapping fragments of the insert DNA for their ability to support growth of the mutant XJY12 on glycerol. As shown in Fig.3, a 4.8-kb BarnHI-PuuII restriction fragment carrying 3.1 kb of yeast DNA in addition to 1.7 kb of vector DNA complemented the pet mutation to the same extent as pJ12-5. Two additional observations indicated that the complementing gene mapped to a region of the complementing DNA near a unique HindIII site within the complementing DNA fragment. First, earlier studies had shown that an EcoRI-Hind111 fragment within this complementing DNAwill hybridize a 1.7-kb mRNA which is coordinately regulated in the same manner as the ATP2 gene encoding the Fl-ATPase P-subunit (Szekely and Montgomery, 1984). Second, the introduction of deletions at the HindIII sitenear the middle of the complementing fragment prevented its genetic complemen~tion. We subcloned various restriction fragments of the insert DNA into M13 for sequence analysis and comparison with the published primary sequence of the a-subunitfrom protontranslocating ATPases of different sources. Analysis of the DNA sequence from the 609-bp Sal-Hind fragment indicated
---
-
ATPl Encodes the Fl-ATPasea-Subunit
15130 A.
Tobacco Chl. E. coli
S,Cerevisiae M L A R T A A I R S L S R T L I 20
10
30
40
50
B.
Yeast F1 a-subunit precursor
26-AAALASTRRL-35
Yeast Cytochrome c peroxidase precursor
63-AAALASTTPL-72
A
L t
4
1
' I/
A
T
L
lT
FIG. 6. Additional sequence of ATPl exhibits properties of other proteins which are imported into mitochondria. A, the amino-terminal sequence of ATPl is aligned with the amino-terminal residues of E. the coli uncA sequences coding the a-subunit. This alignment indicates that 36 additional residues are present in the mitochondrial precursor. B, within this additional sequence of the ATPl gene product is a 10-residue sequence which exhibits a perfect match with the presequence of the precursor to the yeast cytochromec peroxidase at the site where it is processed (Kaput et al., 1982). Lower panel, display of the additional sequence on a helical plot (Schulz and Schirmer,1979)reveals that the ATP1 presequence exhibits the potential for forming an amphipathic helix like the presequence of the yeast ATP2 gene product encodingthe F,-ATPase &subunit precursor. Previous studies have documented thatthis ATP2 sequence is required for transport of proteins into mitochondria.
to one quadrant of the structure in thesame manner as that for the presequence of the FI /?-precursor. Previous analysis of the size of the precursor and mature forms of the yeast F1-ATPase a-subunit indicates that they differ by approximately 3000 daltons. The processing of this precursor like that for other mitochondrially imported precursors is proposed to be catalyzed by a soluble metalloprotease which is localized in the matrix (Bohniet ah, 1980,1983; McAda and Douglas, 1982). In the case of the F, a-subunit precursor, this enzyme is proposed to remove approximately 30-35 residues from the amino terminus (Maccecchini et al., 1979). To date, analysis of the amino-terminal endsof different imported proteins which have been matured following mitochon~ialimport suggests that sequence specificity at the processing site may play a limited role (Reid, 1985). Surprisingly, a comparison of the primary sequence of the a-subunit precursor with the amino-terminal region of other mitochondrially imported precursors in yeast revealed a significant match (Fig. 6 B ) with the processing site region of the cytochrome c peroxidase precursor (Kaput et al., 1982). This extent of homology within any region of the amino terminus of mitochondrially imported proteins is rather unusual. This region of homology is at the site proposed to be cleaved by a membrane-localized protease which is distinct from that of the metalloprotease (Ohashi et al., 1982; Kaput et a i , 1982).
Other studies, however, have demonstrated that the a-subunit can be apparently correctly matured in solution by the partially purified chelator-sensitive enzyme from matrix extracts (Bohni et al., 1983). Based on the predicted size of the asubunit presequence (-3500 daltons, see Fig. 7) andthe additional observation that this is essentially the number of extra residues present when compared with like subunits from other sources, we propose that the site of cleavage is within the region of homology to the cytochrome c peroxidase precursor. In order to confirm the size of the F1 a-subunit precursor and therole of this presequence for its import into mitochondria,the ATPl genewas ligated into the plasmid pT7-1 adjacent to the T7 promoter. This construct (Fig. 7, upper panel), when linearized at a restriction site beyond the termination codon of ATPl, provides a template for the in vitro synthesis of a full-length ATPl transcript by purified T7 RNA polymerase. Translation in a rabbit reticulocyte lysate yields a single translation product of -61,000 daltons which is efficiently imported into isolated mitochon~ia and processed to a mature product of -58,000 daltons within the organelle. DISCUSSION
The present study has characterized for the first time the gene encoding the a-subunit precursor of a mitochondrial
ATPl Encodes the Fl-ATPase a-Subunit
15131
Sal I
transport through the membrane(Roise et al., 1986; Douglas et al., 1986). Hind IU E c o R I Sal I Hind IU Structure-function analysis of the a-subunit of a protonI I I 1 4 translocating ATPase is best described for the enzyme from T7 h~ ATP 4 5 4 4 a a E. coli (Futai and Kanazawa,1983). In this host, the uncA4Ol mutation results froma single base changeto replace a serine ATG TAA IOObp at position 373 in the a-subunit with a phenylalanine (Noumi et al., 1984). The subunit assembles apparently normally; however, the purifiedF, particle from this mutant exhibits no detectable ATPase activityor ATP synthetase activity in the A B C D E membrane. Although the mutant enzyme bound nucleotides as the wild-type enzyme,additional studies to the same extent indicated that the mutant subunit was unable to induceconPre F,a- I formationalchanges which were reported byfluorescent ' probes bound specifically to the@-subunit. Determination of Mature the primarysequence of the yeast a-subunit revealed that the region whichcontains this essential serine residue for function in the E. coli subunit is within a highly conserved region in FIG.7. Mitochondrial import of the ATPl gene product. A the yeast as well as the chloroplast enzyme(Fig. 8). The pet 6.7-kb EcoRI fragment from pJY 12-5 containing ATPl and pBR322 allele inXJY12, like the uncA4Ol mutant, assembles a n sequences including the CoZEI origin and the p-lactamase gene was religated and propagated in E. coli. This plasmid was opened at an ATPase complex with no detectable activity. Immunological AatII site 155 bp 5' of the ATPl start and the PuuII within pBR322, quantitation of the amount of mutant subunit in the XJYl2 treated briefly with BaB1, and ligated into the SmaI site of transcrip- mitochondria indicated that itwas reduced to approximately tion vector pT7-13 (Bethesda Research Laboratories). Transcription half that present in the wild-type enzyme. In this analysis, of the linearized plasmid by T7 polymerase and translation in retic- essentially identicallevels of @-subunitwere detected. Deterulocytelysate are as describedunder"ExperimentalProcedures." mination of the level of a-subunit and ATPase activity in the Shown at the top is the T7 promoter and EcoRI site of the pT7-1 wild-type polylinker adjacentto the ATPl start. The BamHI, SalI, and H i d 1 1 mutant transformed with the pJY12 harboring the ATPl gene on a multicopy plasmid revealed that the mutant sites at the 3'-end of the fragment are from the remainder of the pT7-1 polylinker. Cell-free translation of RNA synthesized in vitro subunit apparently assembled with the enzyme such that it yields a single product of 61,000 daltons ( l a n e E ) which is imported interfered with the function of the wild-type protein. In the and specificallyprocessed to a singlematurespecies of -58,000 transformant, we observed that thelevel of F,-ATPase activdaltons. Following import for various times, duplicate samples of ity presentwas 50% that of the wild-type host (Table11) even mitochondria were held on ice. One sample was treated for 10 min with proteinase K (25 pg/ml) followed by addition of 0.001 M phen- under conditions in which the level of a-subunit present in ylmethylsulfonyl fluoride to each sample and analysis by SDS gel mitochondria (Fig. 2 and Table I) was approximately %fold autoradiography. Lanes C and D, import for 5 min at 22 "C minus greater than thatof the wild-type strain. In spiteof this, the and plus proteasetreatment; lanes A and B, import for10 min minus transformant grew slowly on a mitochondrial dependent carand plus protease treatment. M ,amino acids. bon source, indicating that the mutant a-subunit representing an estimated10-2055 of the total a-subunit present exhibited proton-translocating ATPase. This energy-transducingcom- anegativeeffect on the function of the plasmid-encoded plex appears to behighly conserved with regard to the struc- subunit. It should be noted that overexpression of the plasture stoichiometry and functionof its subunits. Therefore,it mid-encoded a-subunit did not affect the activity or growth was expectedthat the primary sequence of this subunitwhich of the wild-type host strain on a nonfermentablecarbon constitutes part of the catalytic core of the enzyme would source, indicating that the presence of increased levels of the exhibit a high degree of homology with the comparable sub- plasmid-encoded a-subunit in mitochondriadid not interfere units from bacteria, chloroplasts, and animal mitochondria with the functionof the wild-type subunit in theorganelle. (Walker et al., 1985). Earlier studies from this laboratory have shown that the The only departureby the mitochondrial subunit from the stoichiometry of the a-, @-, and y-subunits within the yeast basic size and sequence constraints for this subunit from mitochondrial ATPasecomplex, like thatof the proton-transother sourceswas the presenceof a n additional 36 residues at locating ATPases from othersources, is present ina stoichithe amino terminus. Earlier studies have documented that ometry of 3:3:1 (Todd et al., 1980). Subfractionationand this sequence constitutes a transient species on the precursor which is necessary for its correct localization to themitochonCatalytic Site drial matrix. Thissequence is removed by a specific metallo- F, -ATPase a subunit protease following its import (Maccecchini et al., 1979; Bohni G I R P A I N V G L S V S R V G S A A O et al., 1983). The F, a-subunit transientpresequence described Yeast here exhibits structural features in common with the preseE. coli G I R P A V N P G I S V S R V G G A A O quence of other imported proteins which have been documented tocatalyze the localization of even non-mitochondrial TobaccoChl. G I R P A I N V G I S V S R V G S A A 0 proteins (Hurtet al., 1984; Emr et al., 1986) into theorganelle. - The presequence of ATPl, like the other presequenceswhich FIG.8. Sequence homology of ATPl sequences at the active direct delivery to the mitochondrial matrix,hydrophilic is and basic. In addition, the ATPl presequence lacks any acidic site of the F1a-subunit. Serine 373 located withinthe a-subunit of residues and exhibits the potential for the formation of am- the E. coli proton-translocating ATPaseisrequiredforfunction (Noumi et al., 1984).Alignment of sequences from tobacco chloroplast phipathic structures which segregate the positively charged and yeast on this residue (box) illustrates that the primary sequence residues to one side of the protein (Fig. 6). Current models of this region is conserved. Direct primary sequence homology bepropose that the formation of an amphipathic structure by tween yeast and E. coli or tobacco chloroplast for the entire subunit is 54 and 5976, respectively. the presequence is necessary for its function in promoting
-
""_
0
" " " " "
15132
ATP1 Encodes the Fl-ATPase &-Subunit
(Strathern, J., Jones, E., and Broach, J., eds) pp. 505-635, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY Emr, S., Vassarotti, A., Garrett, J., Geller, B., Take&, M., and Douglas, M. (1986)J. Cell Biol. 102,523-533 Futai, M., and Kanazawa, H. (1983)Microbwl. Rev. 47,285-312 Gay, N., and Walker, J. (1981)Nucleic Acids Res. 9,2187-2194 Gresser, M., Myers, J., and Boyer, P. (1982)J. Biol. Chem. 257, 12030-12038 Hurt, E., Pesold-Hurt, B., and Schatz, G. (1984)FEBS Lett. 178, 306-310 Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983)J. Bacterial. 153,163-168 Kanazawa, H.,Kayano, T., Mabuchi, K., andFutai, M. (1981) Biochem. Biophys. Res. Commun. 103,604-612 Kaput, J., Goltz, S., and Blobel, G. (1982)J. Biol. Chem 257,1505415058 Konarska, M., Padgett, R., and Sharp,P. (1984)Cell 38,731-736 Lowry, 0. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) J.Bwl. Chem. 193,265-275 Maniatis, T., Fritsch, E., and Sambrook, J. (1982)Molecular Cloning; A Laboratory Manual, Cold Spring HarborLaboratory, Cold Spring Harbor, NY Maceecchini, M., Rudin, Y., Blobel, G., and Schatz, G. (1979)Proc. Natl. Acad. Sci. U. S. A. 76,343-347 McAda, P., and Douglas, M. (1982)J. BWL Chem. 267,3177-3182 Noumi, T., Futai, M., and Kanazawa, H. (1984)J. Biol. Chem. 259, 10076-10079 Ohashi, A., Gibson, J., Gregor, I., and Schatz, G. (1982)J. Biol. Chem. 257,13042-13047 Acknowledgments-We are grateful to Marjorie Britten andLaura O’Malley, K., Pratt, P., Robertson, J., Lilly, M., and Douglas, M. Vallier for expert technical assistance and to Mark McCammon and (1982)J. Biol. Chem. 257,2097-2103 Ati Vassarotti for helpful discussions. Queen, C., and Korn, L. (1984)Nucleic Acids Res. 12,581-599 Reid, G. (1985)Curr. Top. Membr. Tramp. 24,295-336 REFERENCES Roise, D., Horvath, S., Tomich, J., Richards, J., and Schatz, G. (1986) EMBO J. 5,1327-1334 Adrian, G., McCammon, M., Montgomery, D., and Douglas, M. (1986) Saltzgaber-Muller, J., Kunapuli, S., and Douglas, M. (1983)J. Biol. Mol. Cell. Biol. 6,626-634 Chem. 258,11465-11470 Bohni, P., Gasser, S., Leaver, C., and Schatz, G. (1980) in The Sanger, F., Coulson, A., Barrell, B., Smith, A., and Roe, B. (1980)J. Organization and Expression of the ~ i ~ ~Genome n d(Kroon, r ~ Mol. Biol. 143,161-178 A., and Saccone, C., eds) pp. 375-381,Elsevier Scientific Publishing Schulz, G., and Schirmer, R. (1979)Principles of Protein Structure, Co., Amsterdam Springer-Verlag, New York Bohni, P., Daum, G., and Schatz, G. (1983)J. Biol. Chem. 258,4937- Sherman, F., Fink, G., and Lawrence, C. (1979)Methods in Yeast 4943 Genetics: A ~ ~ r a Manual, t o ~pp. 1-98, Cofd Spring Harbor Burnes, D., and Lewin, A. (1986)J. Biol. Chem. 261, 12066-12073 Laboratory, Cold Spring Harbor, NY Cross, R. (1981)Annu. Rev. Biochem. 50,681-714 Szekely, E., and Montgomery, D. (1984)Mol. Cell. BioZ. 4,939-946 Daum, G., Bohni, P., and Schatz, G. (1982)J. Biol. Chem. 257, Tabor. S.. and Richardson., C . (1985) , , Proc. Natl. Acad. Sei. U. S. A. 13028-13033 82,’1074-1078 Deno, H., Shinozaki, K., and Sugiura, M. (1983)Nucleic Acids Res. Takeda. M.. Vassarotti., A... and Douglas. M. G. (1985) . . J. BWL Chem. 11,2185-2191 260,‘15458-15465 Douglas, M. G., Koh, Y., Ebner, E., Agsteribbe, E., and Schatz, G. Todd. R. D.. McAda. P. C.. and Douglas. M. G. (1979) , . J. Biol. Chem. (1979a)J. BWL Chem. 254,1335-1339 25~,11134-1114i Douglas, M., Finkelstein, D., and Butow, R. (197913)Methods En- Todd, R. D., Griesenbeck, T. H., and Douglas, M.G. (1980)J. Biol. zymol. 56,58-65 Chem. 265,5461-5467 Douglas, M., McCammon, M., and Vassarotti, A. (1986)Microbwl. TzagoIoff, A., Akai, A., and Needleman, E. B. (1975)J. Bioi. Chem. Rev. 50,166-178 250,8228-8235 Dujon, B. (1981)in The Molecular Biology of Yeust Saccharomyces Walker, J., Fearnley, I., Gay, N., Gibson, B., Northrop, F., Powell, S., Runswick, M., Sarask, M., and Tybulewicz, V. (1985)J. MOL BioL J. Lawson and M. Douglas, manuscript in preparation.
reconstitution studies indicate that thethree largest subunits are required to yield an active F,-ATPase activity. The yeast mitochondrial F1-ATPase containing only the a-, p-, and ysubunits exhibits a very active ATPase activity (Douglas et aL, 1979a, 1979b).It is proposed that the yeast ATPase, like that from bovine and bacterial sources, contains three active sites, each of which acts in catalysis of the forward or reverse reaction of the enzyme. The availability of the genes encoding the catalytic core subunits of the mitochondrial ATPase complex in yeast now provides a convenient and well-characterized system for the analysis of their structure-function relationships. In yeast, genetic manipulations for the site-directed insertion of mutant alleles in place of the wild-type copyare now routine. In this andearlier work (Saltzgaber et al., 1982; Takeda et al., 1985),the nuclear genes encodingthe a- and 8subunits of the catalytic core have been characterized at the nucleotide level. The single nuclear genes encoding the y- and c-subunits of the yeast complex have recently been isolated? Thus, the selective construction and insertion of mutations into the genes encoding these subunits of the yeast enzyme and theisolation of yeast mutants which harbor compensating mutations in other subunits provide i m p o ~ n new t tests for subunit function and themechanisms of energy transduction.
I
-
,
I
15133
ATPl Encodes the F,-ATPase a-Subunit APPENDIX 131 FIG. 4. Nucleotide sequencedetermination of ATPI. Sequence analysis was performed on 2.7 kb of the complementing DNA beginning with the EcoRI site designated. DNA sequence analysis by the method of Sanger et al. (1980) utilized several restriction sites as indicated. The numbers beneath the designated restriction sites represent their distance from the EcoRI site. The lower portion indicates the ATPl open reading frame of 544 codons beginning at residue 569. The hatched portinn of the gene designates the coding region of the presequence of the F1 a-subunit precursor which is removed in the mature form of the subunit.
121 GAA GGT GAA TTGGTC AAG AGA ACC glu gly glu l e u Val lye arg thr
151
leu glyarg
GAC GCTTTA
valval asp
ala
GGT AAC CCTATT
leu
gly
GAT GGT AAA GGTCCTATT
GAC GCT
asn ile pro asp glylys gly pro ile asp ala 171
161 GCC GGT CGTTCA
AGA GCT CAA GTC AAA GCA CCA GGTATT
T T G CCA AGA AGA
TCT GTCCAT
ala gly arg eer arg ala gln val lys ala pro gly ileleu pro argarg ser val his 191 GAA CCA GTT CAA ACC GGT TTG A M GCC GTT GAC GCC TTGGTCCCT ATC GGT AGA GGT CAA g l u pro val gln thr gly leu lys alaasp val ala leu val pro ile gly arg gly gln
181
nu: ATTATT
AGA GAG
arg g h leu
231
GAT GTC CCA GTC GGT CCA GGC CTT slyasn ile val asp vel pro val gly pro sly leu
141 TTG GGT AGA GTTGTC
201
ATP 1
f544oo)
GGT AAT ATTGTT
211 GGT GAT CGT CAA ACA GGT AAG ACT GCTGTC
GCC TTA GAC ACC ATC
ile ile gly arg asp glo thr gly lys chr alaalaVal leu aspthr ile
221 TTG AAT CAA AAG AGA TGG AAT AAC GGT AGT GAC GAA TCC AAG AAA CTT TACTGTGTTTAC
leu asn gln lye erg trp a m asn gly ser asp glu ser lys lysleu tyr CYC val tyr 251
241 MA AGA TCT ACC GTT GCT CAA TTG GTC CM ACT I T G GAA CAA CAT Val ala val gly gln arg lysoer thr Val ala gln l e u val g l n thc leu glu gln his
GTT GCC GTT GGACAA
271
261 CAC GCC ATG AAG TACTCTATTATT GTT GCA GCT ACT GCA TCT GAA GCC GCTCCT CTA CAA asp ala a t lys tyrser ile i l e Val ala ala thr ala 6er glu ala ala pro l e u s l n
291
281
TAC TTG GCT CCA TTT ACT GCC GCA TCCATT GGT GAA TGG TTC AGA GAT AAT GGA AAG CAC cyr l e u ala pro phe thr ala alaser ile gly glu trp phe srg asp asn gly lys his
311
301 GAC GAT TTG TCC AAG GCAAGC CTC GCA TAC CGT CAA TTATCC TTG tyr PEP asp leu 8er lys a l a ser lau ala tyrarg gln leu ser leu ala leu ile Val
GCTTTGATCGTCTAT
FIG. 5. Nucleotidesequence of ATPI, Shown is the DNA sequence of the sense strand extending from 569 bp upstream of the ATPl open reading frame to 188 bp beyond the TAA termination codon. A single open reading frame of 544 codons is shown which exhibits greaterthan 50%direct protein sequence homology with the a-subunits sequenced from other sources.
*
-568
*
-500
GAATTCGCmCCTTTTTG~AGCATTCmTT~TCATTTCT~CCTGmCTC~CGCTGATTGGT~C
*
*
t
391
*
1:
CCGGGTGATGCffiTTGCGGCCGGCCCTffiCAATCAGATCCCTTT~TGGGCCCGGTGCGCTTCTACCCCTT
*
*
*
-400
* *
*
*
*
*
*
*
*
351
341
AGA Tn: CTA GAA AGAGCG GCT AAG Cll' TCT GAA AAG GAA GGT TCTGCTTCTTTAACTGCT arg leu leuglu arg a l a ala lyeleu ser glu lys glu gly sec sly set leu thr a l a
371
TTGCCT 1EU
GTT ATT GAA ACC CAA GGT GGT GAT GTC TCC GCT TATATT CCA ACC AAT G l T ATT glu thr gln gly glyasp val ser ala tyr ile pro thr a m Val ile
pro valile
381 TCCATT
ACC GATGCT
CAA ATT TTC TTG
G M GCT G M TTATTC
TAC AAG GGT ATC AGA CCT
401
411 AAC GTT GGT TTG TCCGTTTCTCGT GTC GGTTCCGCTGCT CM GTT M G GCTTTG ala ile asn Val gly leuser val ser arg v a l gly mr ala alagln val lys ala leu
421
*
$ -200 TAGCTCTTCAATTCGTCTTATTAGAT~;XTCCATCCATCTTACCTTAGCTTAGTTGTCTCCTCTCTT~TT~AA
*
CAT TCA
GCCATT
-300
AGACTTCAA~TTCAATTCA~TCCCCTTCCCTTCMTA~~AGAGATATTATACTGT~
*
GAT GTC TTT TACTTG
8er ile thrasp ala gln ile phe leu glu ala glu leu phe tyr lys gly erg ile pro
CACGCC~ACGCCTTTTTCCGAATCTCGTATTTATTGTAATTATTATACAT~TCATATCAAATTCACATC
*
331
361
*
h
321
ATG TTG AGG CGT CCG CCT GGT CGT GAA GCC TAC CCTCGT
met leu arg arg pro pro glyarg glu ala cyr pro gly asp val pheleu tyrhis 8er
431
AAG CAA GTCGCTGGTTCC TTG AAA TTG TTT TTGGCT CAA TAC ACA GAA GTCGCTGCT TTT lys gln vel ala gly ser leu lys leu phe leu ala gln tyr arg glu Val ala ala phe
441 451 GAT TTA GAT GCCTCC ACC AAG CAA ACT TTG G T T AGA GGT CAAAGA ala gln phe gly ser asp leuasp a l a ser Chr lysg l n thr la"v a l arg gly gln arg
C T T A T T T C T C A T A T A T T A C C ~ C A G G C A T A T A T A C T C G A C G T C A A G ~ ~ G ~ G ~ C C C T CGCT A T CAA A TTC GGTTCC
*
*
-100
AIWAATATAATCGAGMGT~ITmTCCTCATCGCGAACCATTAGTATAACAGATTGA~GlT~GffCTATAAC
*
*
461
471
TTG ACT CAA TTG TTG AAGCAAAAC CAA TAT TCT CCT TTG GCT ACA GAA GAA CAG TCC ATG leu thr g l n leu leu lys gln asn gln tyr ser pro leu ala thr glu glu gln ser met
*
TATCGCMGAAWLGTAAC~GCACATATAATA
481
1 ATG TTGGCT met
CGT ACT GCT GCT ATTCGTTCTCTATCG
AGA ACT CTA ATT AAC TCT ACC AAG
leu alaarg thr alaala ile arg ser leu ser arg thr leu ileas8 Ser thc lys
21
191 GGT GTT AAT GGT CAT TCT GGA TGG TAT GAA CTA TCA AGA ATTGGT GAA TTT ile ileala gly Val asn gly his 6er gly trp tyrg l u leu ner arg ile gly g l u phe
ATTATCGCC
501
31
511
GCC GCA AGA CCT GCC GCTGCT GCT TTG GCT TCC ACC AGAAGA TTG GCT TCC ACC AAG GCA alaarg pro alaala ala ala leu ala set thr %rg arg leu ala ser thr lys ala
GAG TCCTCCTTT TTG TCCTATCTC AAA TCC AAT CAC AAT GAG CTT TTG ACC GAA ATT AGA g l u Per 6er phe leu ser Lyr leu lysser asn his a m glu leu l e u thr glu ilearg
41
521 531 GAA AAG GGT GAA TTG TCT AAA GAA TTGTTG GCA TCT CTA AAG ACT GCTACT GAA TCA TTT glu lYs glY glu leu ser lys glu leu leu ala ser leu lya mera l a thr glu ser phe
ala
51
CAA CCC ACA GAA GTTTCCTCC
gln pro thr glu val ser
ATC TTA GAG GAA AGA ATT AAG GGT GTG TCC GAC GAG GCC leu glu glu arg ile lys gly valser asp glu a l a
S ~ ile T
541
71
61
AAT T T G AAC GAA ACT GGT AGA GTTCTT GCA GTCGGT leuasn glu thr glyarg val leu ala Val
asn
GAT GGT ATT GCT CGTGTT T I T GGT gly gasp l y ile ala arg val phe gly
91 ATT CAG GCT GAA G M TTGGTC GAG TTC TCCTCT GGT GTT asn ile gln ala glu glu leu val glu pheser ser gly v a l 170 101 111 TTG AAC TTG GAG CCTGGT CAA GTCCGTATC GTT CTTTTC GGT TCCGAT l e u asn leu glupro gly gln val gly ile leu Valphe glyser asp
ACT TTT TAA
IO 20 30 40 50 TGTGAACTCAAAAAAATATGAATATAAGGTACGTCTAIWAAGAAATGT
sa
81
TTG AACAAC
MA GGT ATG GCT
leu
lys gly met ala 160 150 140
as"
GTT GCC
Val ala thr pheNON
60 70 90 100 110 120 AAATATAGGAAATTTACGG~CATAACTAAATTTAAAGGTGCAGGC~CMTAACCTG~ 130
180
AATCTAATATCTTAGGATTTTTATTTCA~ATTATATA~ATTATTATTCTAGTGGTA~ AGA CTG GTT AAA
arg leu Val lys
FIG. 5.-continued
