Nuclear Hormone Receptors Involved in Neoplasia: Erb A Exhibits a ...

Vol. 13, No. 4

MOLECULAR AND CELLULAR BIOLOGY, Apr. 1993, p. 2366-2376

0270-7306/93/042366-11$02.00/0 Copyright © 1993, American Society for Microbiology

Nuclear Hormone Receptors Involved in Neoplasia: Erb A Exhibits a Novel DNA Sequence Specificity Determined by Amino Acids Outside of the Zinc-Finger Domain HONGWU CHEN, ZELJKA SMIT-McBRIDE, STEPHANIE LEWIS, MOHAMMED SHARIF, AND MARTIN L. PRIVALSKY*

Department of Microbiology, University of California at Davis, Davis, California 95616 Received 22 October 1992/Returned for modification 31 December 1992/Accepted 12 January 1993

The erb A oncogene is a dominant negative allele of a thyroid hormone receptor gene and acts in the cancer cell by encoding a transcriptional repressor. We demonstrate here that the DNA sequence recognition properties of the oncogenic form of the erb A protein are significantly altered from those of the normal thyroid hormone receptors and more closely resemble those of the retinoic acid receptors; this alteration appears to play an important role in defining the targets of erb A action in neoplasia. Unexpectedly, the novel DNA recognition properties of erb A are encoded by an N-terminal region not previously implicated as playing this function in current models of receptor-DNA interaction. Two N-terminal erb A amino acids in particular, histidine 12 and cysteine 32, contribute to this phenomenon, acting in conjunction with amino acids in the zinc finger domain. The effects of the N-terminal domain can be observed at the level of both DNA binding and transcriptional modulation. Our results indicate that unanticipated determinants within the nuclear hormone receptors participate in DNA sequence recognition and may contribute to the differential target gene specificity displayed by different receptor forms.

Despite this progress, the precise molecular mechanism underlying DNA recognition by the nuclear hormone receptors remains incompletely understood. Thyroid hormone receptors, for example, can activate transcription from halfsites arranged as divergent repeats, as inverted repeats, as direct repeats with a 4-base spacing, or as mixtures of these orientations, a phenomenon that defies ready conceptualization (reviewed in reference 32). In addition, the thyroid hormone receptors, RARs, and vitamin D3 receptor are known to bind to DNA not only as receptor homodimers but also in the form of heterodimers with other auxiliary factors (reviewed in reference 32). At least one class of these auxiliary factors, the RXR proteins, are themselves receptors (23, 25, 28, 48, 50). As is true of many other components of signal transduction, nuclear hormone receptors can also manifest themselves as oncogenes. Aberrant alleles of retinoic acid receptors are associated with certain human promyelocytic leukemias and hepatocarcinomas, and the v-erb A oncogene of avian erythroblastosis virus (AEV) is derived from a gene for a thyroid hormone receptor (8, 9, 17, 22, 34, 46). We are interested in understanding the actions of the viral erb A (v-erb A) oncogene. v-erb A blocks the differentiation of infected erythroleukemia cells and alters the growth properties of infected fibroblasts (14, 17, 38). The protein encoded by the v-erb A oncogene has sustained small N- and C-terminal deletions and 13 internal amino acid differences relative to the normal avian thyroid hormone receptor (c-erb Aao-1 protein) (Fig. 1). Because of the deletion and five amino acid substitutions in its C terminus, the v-erb A protein is unable to activate transcription in vertebrate cells, and it has been proposed that v-erb A functions in the cancer cell as a dominant negative inhibitor of thyroid hormone receptor function (5, 7, 35, 49). However, the sequence of the zinc finger domain of the v-erb A protein is also different from that of c-erb A, and we have previously hypothesized

The nuclear hormone receptors act as highly abbreviated signal transduction pathways; each receptor binds to specific sites within the DNA genome (denoted hormone response elements) and regulates the transcription of adjacent target genes in response to cognate hormone (10, 15, 18, 32). This family of ligand-regulated transcription factors includes the steroid receptors, retinoic acid receptors (RARs), and thyroid hormone receptors and shares a common modular structure consisting of a central DNA-binding domain linked to a C-terminal hormone-binding domain (10). The DNAbinding domain is dominated by a zinc finger motif consisting of two ax-helices oriented by interactions with zinc atoms (21, 26, 39). The corresponding hormone response elements on the DNA are usually composed of multiple copies of a consensus hexanucleotide (denoted a half-site), and, reflecting this multiplicity, the receptors can bind to DNA as dimers (1, 11-13, 16, 24, 29, 44). Amino acids in the first aL-helix are thought to play the key role in half-site recognition by making direct contacts with bases within the major groove of the DNA (26). Alteration of amino acids within the P-box portion of the first a-helix, in particular, alters the half-site specificity of the receptor (6, 27, 43). The spacing and orientation of the DNA half-sites represents an additional component of the DNA recognition code. Indeed, the vitamin D3 receptor, thyroid hormone receptors, and RARs all possess identical P-box amino acids (EGCK£G) and can recognize identical half-sites (AGGTCA) but differ in their abilities to bind to DNA when these half-site repeats are separated by spacers of different lengths (12, 29, 44, 45, 45a). A D-box amino acid sequence in the zinc finger domain of the steroid receptors participates in dimerization and may be involved in this recognition of the spacing of the half-site repeats (26, 29, 44).

*

Corresponding author. 2366

ONCOGENIC erb A DISPLAYS NOVEL DNA RECOGNITION

VOL. 13, 1993 c-erb Aa v-erb A

iZ-f inger

I

Hormone

Binding

I

'

%

a t@;g.8;gWgagXl' A

' '

erbAA1111"

A

1-,

A

78

C-E-G-C-K -G-F -F

C K- Y-D-G-C-C-V

c-erb Aa

C-E-G-C-K -5--F-F

C T-Y-D-G-C-C-V

v-erb A

P-box D-box FIG. 1. Schematic of the c-erb A and v-erb A proteins. The chicken c-erb Aa polypeptide/thyroid hormone receptor (top) and the v-erb A protein (bottom) are presented (34). The locations of Nand C-terminal deletions, the fusion of retroviral gag sequences to v-erb A, and the internal amino acid differences between v-erb A and c-erb Aa (vertical bars) are illustrated. The locations and amino acid sequences of the P- and D-box portions of the DNA-binding (zinc finger [Z-finger]) domains of the avian c-erb Aa and v-erb A proteins are presented below. The numbering scheme begins with the first v-erb A-specific codon in the gag-v-erb A coding sequence.

that changes in the DNA-binding specificity of the v-erb A polypeptide may enable it to act in the cancer cell by repressing RAR function (2, 41). In the present study, we have delineated the DNA-binding properties of the v-erb A oncogene protein and demonstrated that they are indeed distinct from those of the c-erb A (thyroid hormone receptor) protein and more closely resemble those of the RARs. Unexpectedly, the structural basis behind the differences in DNA recognition by the erb A proteins does not map within the zinc finger domain but instead lies upstream in a region not heretofore thought to control the specificity of base pair recognition by the nuclear hormone receptors. Our results indicate that previous structural models of DNA recognition by nuclear hormone receptors may be incomplete and that unanticipated receptor determinants participate in target gene specificity. MATERIALS AND METHODS

Plasmids and oligonucleotides. The inverted-repeat orientations of the different response elements were composed of oligonucleotides of the general structure 5'-TCGAGATCT CAGGT~iICATGACCTGAGATC-3', with the underlined nucleotides replaced by AGGaCATGtCCT, AGGcCATGg CCT, AGGgCATGcCCT, or AGaTCATGAtCT for the various half-site derivatives tested here. These sequences are self-complementary, and after annealing, the doublestranded molecules were separated from the hairpin and unannealed DNA strands by electrophoresis prior to use. The direct-repeat orientations were constructed from the following oligonucleotides: DR1 (5'-TCGACTCAGGiTCAC

AGGTCAGAG-3'), DR3 (TCGACTCAGGTCAACGAGG

TCAGAG), DR4 (TCGACTCAGGTCACAGGAGGTCAG AG), DR4z (TCGACTCAGGTCATIlCAGGTCAGAG), 4ADR4 (TCGACTCAGGACACAGGAGGACAGAG), and DR5 (TCGACTCASLGTCACCGGAAAicCAGAG). The direct repeats were each annealed to a corresponding complementary oligonucleotide before use. For mobility shift assays, the oligonucleotides were end labeled by fill-in with 32P-deoxynucleotides and the Klenow fragment of DNA polymerase. For use in the yeast system, the different oligonucleotides were introduced into a unique XhoI site in

2367

the ASS reporter vector (33). Yeast reporter plasmids containing two insertions of each inverted-repeat oligonucleotide, or one insertion of each direct-repeat oligonucleotide, were used in the P-galactosidase assays. All the direct repeats were oriented in the same direction relative to the CYCl promoter. Reporters bearing single inserts of the inverted repeats exhibited reduced 3-galactosidase expression but otherwise yielded the same relative results as the dual inserts. Construction of the pGl-human c-erb AP and pG3 v-erb A yeast expression plasmids was previously reported (33). Mutant v-erb A alleles S61G, T78K, and the S61G,T78K double (2, 20) were introduced into the pG3 vector by exchanging appropriate SstI-SstI fragments with the wildtype construct. The H12R and C32Y v-erb A alleles were created by polymerase chain reaction-mediated mutagenesis, using as templates either the wild-type v-erb A allele or the S61G,T78K mutant allele. All mutations were confirmed by DNA sequence analysis. A c-erb Aa yeast expression vector was created by converting an N-terminal EcoRI site in pCEAII (34) to a BamHI site, adding a SalI site to the 3' end, and introducing the resulting BamHI-SalI (partial) fragment containing the entire chicken c-erb Aa coding region into the appropriately cleaved pG3 vector. Chimeras between the v-erb A and chicken c-erb Aa genes were created by exchanging equivalent restriction fragments from the corresponding pG3 vectors and employing conserved Sall or BstEII sites. The RAR,B gene, the generous gift of P. Chambon and A. Dejean was introduced into the pGl yeast vector as a BamHI-BamHI fragment originating from the pSG5-RARP clone (3). Yeast assays. The appropriate reporter and expression vectors were introduced into Saccharomyces cerevisiae BJ2168 by a polyethylene glycol-lithium acetate procedure, and stable double transformants were isolated and maintained on S-medium lacking uracil and tryptophan (33). trans-activation assays were performed by growing the transformants overnight in S-medium with or without hormone (10 to 20 p,M 3,3',5-triiodothyroacetic acid or 10 ,M all-trans-retinoic acid). The cells were then harvested, lysed, and assayed for ,-galactosidase activity as previously described (33). The enzyme activity was normalized to the optical density of the culture at 600 nm to control for slight differences in cell number. Virtually all the data presented represent the averaged results of at least two assays performed on at least two separate yeast transformants. Creation and use of the baculovirus and bacterial expression systems. A KpnI-KpnI fragment containing the v-erb A gene was inserted into the baculovirus transfer vector pVL1392, and a BamHI-BamHI fragment containing the human thyroid hormone receptor c-erb AP1 gene was inserted into the closely related pVL1393 transfer vector such that the erb A genes were flanked by sequences derived from the baculovirus polyhedron locus. In vivo recombinants between the plasmid and anAutographa californica nuclear polyhedrosis virus (AcNPV) genome were isolated and were confirmed by Southern hybridization analysis. Sf9 cells infected with the AcNPV/v-erb A recombinant produced large quantities of the anticipated 75,000-apparent-molecular-weight v-erb A protein. Similarly, lysates of Sf9 cells infected with the AcNPV/c-erb A recombinant contained an approximately 50,000-apparent-molecular-weight polypeptide corresponding to the c-erb AP protein product. The v-erb A and c-erb A polypeptides accumulated in infected cells to estimated levels of 2 to 5% of the total protein. Polymerase chain reaction was used to create NcoI and HindlIl sites bracket-

2368

CHEN ET AL.

ing the human RAR,B gene, and the resulting restriction fragment was inserted into pGEX-KG for expression of the RARP protein in Escherichia coli (19). Nuclear extracts were prepared from baculovirus-infected Sf9 cells or AEV-infected erythroid cells by a modification of a previously described method (40). After homogenization, the nuclei were collected by centrifugation at 14,000 x g for 20 s at 4°C and the nuclear pellet was resuspended in 1 ml of nuclear resuspension buffer [20 mM N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES; pH 7.9), 0.4 M NaCl, 1 mM EDTA, 1 mM ethylene glycol-bis(,-aminoethyl ether)-N,N,N',N'-tetraacetic acid dithiothreitol (EGTA), 20% glycerol, 1 mM phenylmethylsulfonyl fluoride, 10,g of leupeptin per ml, 5,ug of aprotinin per ml, 10p,g of pepstatin per ml, 2 mM benzamidine] per 108 cells. The suspension was rocked vigorously at 4°C for 30 min, and the resulting extract was clarified by centrifugation at 20,000 x g for 20 min, frozen in liquid nitrogen, and stored at -80°C before use in the mobility shift assays. To isolate RAR, for use in the mobility shift assays, E. coli HB101 containing the pGEX-RAR, vector was grown to log phase in 1 liter of medium and induced with 0.5 mM isopropyl-,-D-thiogalactopyranoside (IPTG), lysed in a French press, and the resulting glutathione-S-transferase (GST)-RARP fusion protein was isolated on a glutathioneagarose column (19). The RARi fusion protein was subsequently eluted with 2 ml of a glutathione-containing buffer. Electrophoretic mobility shift assays. Usually, 1 p,l of the baculovirus-infected cell nuclear extract or 2 [lI of the purified GST-RARP protein was used in each mobility shift assay. Protein samples were mixed with 15 ,lI of binding buffer containing 10 mM Tris-Cl (pH 7.5), 50 mM KC1, 1 mM dithiothreitol, 2 ,ug of poly(dI-dC), 200 ,ug of bovine serum albumin, and 5% glycerol and incubated for 5 min at 25°C. Approximately 40,000 cpm (1 to 5 ng) of radiolabeled oligonucleotide was added to each binding reaction, and the samples were incubated for an additional 20 min at 25°C. The samples were loaded into wells in a 1.2-mm-thick vertical 4.5% polyacrylamide gel apparatus, and electrophoresis was performed in a 0.5 x Tris-borate buffer at room temperature at 200 V for 75 min. The gels were then dried and autorad-

iographed. RESULTS The v-erb A and c-erb A proteins recognize distinct sets of hormone response elements. The P-box within the zinc finger domain of the v-erb A protein encodes a serine at codon 61, whereas all known c-erb A alleles encode a glycine at this position (Fig. 1). We have proposed that a resulting change in the DNA-binding specificity of the v-erb A protein may contribute to its oncogenic properties (2, 41). The homologous amino acid in the glucocorticoid receptor makes contact with the fourth base pair in the glucocorticoid response element half-site (26). We therefore compared the ability of the v-erb A and c-erb A proteins to recognize derivatives of the thyroid hormone response element (TRE) half-site altered at the fourth base position (AGGNCA). We also tested an additional oligonucleotide with a third-position change (AGATCA), designed to facilitate comparisons with glucocorticoid response elements (AGAACA). We first studied inverted-repeat orientations of the half-sites, a topology recognized by both c-erb A and v-erb A proteins (5, 16). To allow parallel comparisons of v-erb A and c-erb A function, we initially characterized the effects of these different hormone response elements in S. cerevisiae; de-

A.

I

CO 6 0 'F 5 0-

40

cm 3 0c

20 10

0

B.

o~

MOL. CELL. BIOL.

v-erb A

nCO CD

25

20 15

0,

10 54

(0

0

4

0

.

In

C. 0

C

0 c

ch c-erb A a

8

-

6

-

C=

4

0n

-1

2

U

54

-1 4,

~~~~~~0

FIG. 2. Activation of gene expression in S. cerevisiae by v-erb A and c-erb A proteins by using inverted-repeat orientations of different half-sites. Yeast isolates containing a reporter plasmid linked to different response elements and expressing the human (hu) c-erb AP (A), v-erb A (B), or chicken (ch) c-erb Aa (C) protein were grown in the presence (-) or absence (13) of triac hormone and were assayed for 3-galactosidase production. The response elements within the reporter plasmids were composed of inverted repeats, either of the

AGGTCA consensus sequence (left lanes) or of the variations of this half-site illustrated, where dashes represent identities with the consensus sequence. The expression of a reporter plasmid without any response element ("none") was also assayed as a negative control.

spite their divergent actions on transcription in animal cells, both the v-erb A and c-erb A proteins are activators of gene expression in S. cerevisiae (33). Yeast cells were stably transformed by two episomes: an expression plasmid encoding the erb A allele of interest, and a reporter plasmid containing a 3-galactosidase reporter gene linked to a minimal promoter and an appropriate hormone response element. In this manner, the ability of the erb A proteins to activate transcription was coupled to P-galactosidase expression. Both v-erb A and the human c-erb A,B proteins efficiently activated expression of a reporter containing an inverted repeat of a consensus AGGTCA half-site (Fig. 2A and B). In contrast, no activation by either protein was

VOL. 13, 1993

ONCOGENIC erb A DISPLAYS NOVEL DNA RECOGNITION

observed with a reporter lacking a hormone response element (Fig. 2A and B) or with a reporter containing a glucocorticoid response element (data not shown). Changing the third base pair in the response element to an A (AG

ATCA) also abolished activation by either the v-erb A

2369

A. 1 2 3 4 5 6 7 8 9 10 1112 13

or

c-erb A protein (Fig. 2A and B). Changes to the fourth base pair in the half-site revealed a dramatic divergence in the behaviors of the c-erb A and v-erb A proteins. This difference was most evident with the AGGACA sequence reporter, which was strongly activated by the c-erb A protein but was not recognized at all by the v-erb A allelic form (compare Fig. 2A and B). The c-erb AP protein also activated reporter gene expression linked to an AGGCCA or an AGG-jCA sequence (only weakly for the latter) (Fig. 2A). In contrast, the v-erb A protein activated strongly only on the AGGTCA consensus and weakly on an AGG£QCA sequence and was unable to activate expression from response elements possessing any other nucleotide at the fourth position (Fig. 2B). In our initial experiments we used a human c-erb AP gene, yet the v-erb A allele is thought to be derived from a chicken c-erb Act gene, with which it shares greater structural relatedness (34). We therefore repeated these assays with the avian c-erb Aot allele (Fig. 2C). Although the absolute level of reporter gene activation was lower than that seen for the other alleles, the c-erb Act protein clearly shared the ability of the human c-erb AP isoform to recognize both the AGGTCA consensus and the AGGACA half-site. Some minor differences in half-site preference between the c-erb AP and c-erb Aot proteins were observed, most notably an inversion in the relative ability to utilize an AGGCCA relative to an AGG£jCA half-site. Nonetheless, the distinct half-site specificity observed for the v-erb A and c-erb A proteins appeared to reflect a difference between viral and cellular alleles rather than a distinction between the c-erb Aot and c-erb A,B isoforms or a species-related peculiarity. The differences in response element recognition observed in S. cerevisiae reflect differences in DNA binding. The differing activities of v-erb A and c-erb A polypeptides on disparate reporter half-sites might reflect actual differences in DNA binding or might be manifested at some later step necessary for transcriptional activation. We next tested the DNAbinding properties of the v-erb A and c-erb A proteins in vitro by using an electrophoretic migration shift assay. The results closely paralleled the yeast expression studies. Both the v-erb A and c-erb AP proteins strongly bound to an inverted repeat containing the AGGTCA consensus (Fig. 3A, lanes 1, 6, 11, and 12), but only the c-erb AP protein also bound to the AGGACA and AGGCCA variants (lanes 2 and 7 and lanes 4 and 9, respectively). An inverted repeat of AGGGCA was weakly bound by both the c-erb A and v-erb A proteins (lanes 5 and 10), and inverted repeats of AGA TCA were not bound by either protein (lanes 3 and 8). On the basis of results obtained with antibodies, different probes, and mixtures of different receptors, we interpret the upper band in each lane as representing two erb A protein molecules bound to each oligonucleotide and the lower band as indicative of single half-site occupancy (references 12 and 45a and data not shown). These results could be duplicated over a range of v-erb A and c-erb A polypeptide concentrations (data not shown). The thyroid hormone receptors, RARs, and vitamin D3 receptors can bind to DNA in association with auxiliary proteins present in a variety of cells, and this heterodimer formation both increases the affinity of the receptor for the DNA and augments gene activation (references 23, 25, 28,

so

ow -

aImmaLMo*-4 11*ism 4

0

I

< I

0I

I I

II

I v-erb

O Cl ' ( CD 11