www.springerlink.com/Chin J Cancer Res 20(4): 237-242, 2008
237
Basic Research
Nucleosome Positions and Differential Methylation Status of Various Regions within MLH1 CpG Island BAI Hua (白桦),
ZHOU Jing (周静),
DENG Da-jun (邓大君)*
Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education), Department of Aetiology, Peking University School of Oncology, Beijing Cancer Hospital & Institute, Beijing 100142, China CLC number: R3, Q754
Document code: A
Article ID: 1000-9604(2008)04-0237-07
10.1007/s11670-008-0237-3 ABSTRACT Objective: To determine the relationship between nucleosome positions and formation of differential methylation of the reported region A, B, C, and D within the MLH1 CpG island. Methods: Methylation of the MLH1 promoter was analyzed by combined of bisulfite restriction assay. Chromatin of RKO and MGC803 cells were extracted and digested by MNase. Mononucleosomal DNA fragment was isolated and used as templates for detection of nucleosomal distribution by a battery of quantitative PCRs covering the full MLH1 promoter region. Results: The MLH1 was methylated in RKO and unmethylated in MGC803. At the region B, where methylation of CpG sites did not correlated with transcription of this gene well, qPCR product of the M-3 (-599nt ~ -475nt) fragment was amplified in both RKO and MGC803 cells. However, at the region C and D within the core promoter, where methylation of CpG sites correlated with loss of MLH1 transcription well, the M-7 (-257nt ~ -153nt) and M-8 (-189nt ~ -71nt) fragments were amplified remarkably only in RKO cells. Conclusion: Nucleosome may be the basic unit for both CpG methylation and methylation-related regulation of gene transcription. Methylation status of CpG sites within the same nucleosome may be homogeneous; between different nucleosomes, homogeneous or heterogeneous. Key words: Nucleosome position; Methylation; MLH1; CpG Island
In eukaryotic cells, the nucleosome is the structural unit for genomic organization. Its core particle is the universally repeating unit in chromatin. These structures reveal an octameric histone core around which 147 base pairs of DNA are wrapped in 1.65 superhelical turns. The histone octamer itself is composed of two copies each of the four histone proteins, H2A, H2B, H3, and H4. Two neighboring nucleosomes are connected by a linker DNA (30-90bp) and the histone H1. This kind of structure enables the nucleosome compress or extent along with the gene duplication, transcription, recombination, and repair[1,2]. Methylation of CpG islands within the MLH1 ⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯⎯ Received: Aug 28, 2008; Accepted: Oct. 9, 2008. This work was supported by the National Natural Science Foundation of China (No. 30571056) and the National “973” Basic Research Program of China (No. 2005CB522403). * Author to whom correspondence should be addressed. E-mail:
[email protected]
promoter region inactivates the transcription of this gene. Aberrant MLH1 methylation is a frequent event in the digestive system tumors[3-5]. According to the correlation between methylation intensity of each CpG site and transcription, the MLH1 CpG island is divided into four regions (A-D): the methylation status of 8 key CpG sites in the region C is reversely correlated with transcription completely. The methylations in the region B and D are partially correlated with transcription, but the region A does not correlate with transcription[6]. The mechanisms of the formation of differential methylation with the CpG islands are unclear. In the present study, the position of nucleosomes within the CpG Island was detected. A close relationship between nucleosome position and differential methylation was observed.
MATERIALS AND METHODS Cell Lines
238
www.springerlink.com/Chin J Cancer Res 20(4): 237-242, 2008
Human colorectal carcinoma cell line RKO and gastric carcinoma cell line MGC803 were grown in 1640 medium (Gibco) supplemented with 10% FBS (PAA), 100U/ml Penicillin, 100 mg/L Streptomycin at 37 °C in 5% CO2 atmosphere.
was used as the template. The qPCR was performed using the LightCycler FastStart DNA Master SYBR Green I kit (Applied Biosystems). Real-time PCR assays were performed in duplicates in 48-well optical plates. For each 25 μl reaction, 50 ng nucleosome DNA was supplied with 12.5 μl 2X LightCycler FastStart DNA Master and 900 nmol/L primers. The PCR condition was as follows: after an initial incubation step at 95 °C, 40 amplification cycles of 95 °C for 10 sec, 60 °C (for HPRT) or 62 °C (for MLH1) for 10 sec, and a final extension cycle of 72 °C for 20 sec. In order to validate the specificity, the products were size- fractionated on a 3% agarose gel (Figure 3). The cycle threshold (CT) was read for each qPCR reaction. An average CT was calculated based on two CTs of the duplicate reactions. The lesser average CT value was used as internal control to calculate the relative ΔCT value for each amplicon. The relative copy number of every amplicon was calculated with the 2-ΔCT.
Preparation of Chromatin and Mono-nucleosomal DNA Cells were grown in culture flasks, trypsinized when confluent and gently pelleted at 1000 g in a centrifuge. They were then washed gently once in solution A (150 mmol/L sucrose, 80 mmol/L KCl, 35 mmol/L HEPES [pH 7.4], 5 mmol/L K2HPO4, 5 mmol/L MgCl2, 0.5 mmol/L CaCl2) and once in solution B (150 mmol/L sucrose, 80 mmol/L KCl, 35 mmol/L HEPES [pH 7.4], 5 mmol/L K2HPO4, 5 mmol/L MgCl2, 2 mmol/L CaCl2), resuspended at 200 μl solution B plus 0.4% NP-40 (Sigma), gently mixed with MNase (Sigma C8897) 0.25 U, and incubated at room temperature for 5 min[7]. The digestion was stopped by adding 600 μl of DNA lysis buffer (50 mmol/L Tris [pH 8.0], 150 mmol/L NaCl, 25 mmol/L EDTA [pH 8.0], 0.5% sodium dodecyl sulfate [SDS], 200 μg of proteinase K/ml), and the lysate was then incubated overnight at 37 °C. MNase-treated DNA was then isolated by standard phenol extraction and ethanol precipitation techniques, resuspended in 15μl TE buffer (10 mmol/L Tris, 1 mmol/L EDTA [pH 8.0]), and stored at 4 °C. MNase-treated DNA was size-fractionated on a 2% agarose gel for 30 min and the 150 bp length product was incised and purified with QIAEX II Gel extraction Kit (QIAGEN). The purifyied product was then electrophoresis again at 10% polypropylene gel. The 150 bp product was incised and purified again. The second purifyied product was dissolved in TE buffer to a final concentration of 0.1 μg/μl. PCR Primer Sets The locations and sequences of each primer set used to detect copy number of each fragment within the HPRT promoter (-662nt ~ +13nt [transcription start site, +1], Genbank gi 89161218) or the MLH1 promoter (-750nt ~ -71nt, Genbank gi 89161205) were demonstrated in Table 1, Figure 1A, and 2A. Primer sets were designed to amplify 90bp~ 130bp sections on each gene. Each PCR product overlaps the neighboring amplified regions by approximately 30bp. The PCR products of HPRT and MLH1 were numbered, and the size of each region amplified was listed in Table 1. Quantitative PCR (qPCR) Fifty nanogram of purified mono-nucleosome DNA
Combined of Bisulfite Restriction Assay (COBRA) Genomic DNA samples were extracted from RKO and MGC803 cells with conventional phenol: chloroform protocol. The NaHSO3 treatment (Promega Wizard DNA Clean-Up System, A7280) was used to convert the unmethylated cytosines in the DNA samples. The strand specific PCR and BstUI (New England Biolabs) digestion were performed as described previously[5] (Figure 4). RESULTS AND DISCUSSION Validation of Nucleosome Positioning by qPCR Current methods to localize nucleosome include low-flow indirect end labeling, DNA methylation enzyme modification, qPCR, and high-flow oligonucleotides chip[7,8,10]. All of these assays are based on the successful preparation of mono-nucleosome DNA. Comparing with core nucleosomal DNA, DNA locating outside of the core region is extraordinary sensitive to nuclease digestion. Therefore, the MNase enzyme was used to prepare mono-nucleosome in the present study. The core mono-nucleosome DNA was successfully extracted from gel with different size fragments after two round purifications (Figure 5). Chen and Yang used indirect end labeling to locate the nucleosome positions of the HPRT promoter[7]. They observed that in cell line with HPRT transcription, there existed intense nucleosome distribution signal at the -260nt ~ -460nt and -460nt ~ -660nt regions (Figure 1, nucleosome-1 and nucleosome-2). In the -260nt ~ +90nt region, only weak nucleosome distribution signal was
www.springerlink.com/Chin J Cancer Res 20(4): 237-242, 2008
239
observed (Figure 1A, nucleosome-3 and nucleosome-4). We found both RKO and MGC803 cells expressed HPRT (data not shown) and that PCR products with high relative copy number were amplified from both the H-2 and H-4 fragments corresponding to the nucleosome-1 and nucleosome-2 exactly. In addition, high amount of PCR products could not be amplified from the H-6 and
H-7 fragments corresponding to nucleosome-3 and nucleosome-4 (Figure 1B). These results indicate that results of nucleosome positioning by qPCR are consistent with those of indirect end labeling assay very well. Thus, the qPCR assay was used to analyze the distribution of nucleosome within the MLH1 promoter.
Table 1. PCR primer sequences, locations, and product size of HPRT and MLH1 genes Primer set
H-1
H-2
H-3
H-4
H-5
H-6
H-7
M-1
M-2
M-3
M-4
M-5
M-6
M-7
M-8 *
Primer sequence HPRT-1F: 5’-atatgctcattttagtgaggcaa-3’ HPRT-1R:5’-tcagggtacacatctgagagga-3’ HPRT-2F: 5’-cagagcagttaagtgtctctcag-3’ HPRT-2R: 5’-cccaaacccttaactggttgt-3’ HPRT-3F: 5’-aagcactgggccaagagtcag-3’ HPRT-3R: 5’-gctcttcgggttccagtcatc-3’ HPRT-4F: 5’-atgactggaacccgaagagc-3’ HPRT-4R: 5’-cct ttccctcccaactcagtc-3’ HPRT-5F: 5’-gccctctgaataggagactgagt-3’ HPRT-5R: 5’-cctaccagtttgcaggctcac-3’ HPRT-6F: 5’- ggctacctagtgagcctgcaaa -3’ HPRT-6R: 5’-cctgaagctgaggagaagca -3’ HPRT-7F: 5’-gagccctcaggcgaacctct-3’ HPRT-7R: 5’-tgcgggtcgccataacgga-3’ MLH1-1F: 5’-cctgcacgagcagctctctc-3’ MLH1-1R: 5’-aggctgagcacgaatactacga-3’ MLH1-2F: 5’-cgccacataccgctcgtagt-3’ MLH1-2R: 5’-gccctgtgcctggtctgtc-3’ MLH1-3F: 5’-cgcgggtagctacgatgag-3’ MLH1-3R: 5’-atggaagtcgacgaggctct-3’ MLH1-4F: 5’-aataacgctgggtccactcg-3’ MLH1-4R: 5’-ttgcggcctttctaacgttg-3’ MLH1-5F: 5’-tgggcgtcatccacattctg-3’ MLH1-5R: 5’-tgaggtgatctggcgcagag-3’ MLH1-6F: 5’-ttccggcatctctgctccta-3’ MLH1-6R:
5’-cctagaaggatatgcgcttgc-3’
MLH1-7F: 5’-ataggaagagcggacagcgat-3’ MLH1-7R: 5’-tctgtgggttgctgggtctct-3’ MLH1-8F: 5’-ttcagggagggacgaagagac-3’ MLH1-8R: 5’-agctgtagcttacgccatcca-3’
Amplicon location*
Product size (bp)
CTs for RKO
CTs for MGC803
-662nt ~ -567nt
96
22.27
24.17
-604nt ~ -517nt
88
21.39**
21.20**
-510nt ~ -403nt
108
22.05
24.01
-424nt ~ -314nt
111
21.35
21.17
-344nt ~ -232nt
113
24.03
24.07
-254nt ~ -104nt
125
35.07
34.28
-128nt ~ +13nt
135
26.11
25.90
-750nt ~ -623nt
128
24.39
24.97
-658nt ~ -556nt
103
24.87
23.40
-599nt ~ -475nt
125
23.24**
21.89**
-527nt ~ -402nt
126
24.68
23.30
-464nt ~ -341nt
124
23.37
26.04
-321nt ~ -206nt
116
25.19
25.89
-257nt ~ -153nt
105
22.32
26.26
-189nt ~ -71nt
119
23.14
25.38
Transcription start site, +1; ** Internal control CT used to calculate relative ΔCT and the relative copy number of every amplicons for each cell
line, respectively
240
www.springerlink.com/Chin J Cancer Res 20(4): 237-242, 2008
Fig. 1. Illustration of nucleosome positions and amplicon locations within the HPRT promoter. A: Gray ellipses, positions of four nucleosomes according to Chen and Yang’s report[7]; Black letters and black lines, locations of 7 pairs of primers and corresponding amplicons to identify the nucleosome position by quantitative PCRs; Grey double arrow dashed line, the core promoter region; Black bars, CpG sites; TSS, transcription start site. B: Quantitative PCRs. Relative copy ratio was calculated with the formula [the cycle threshold (Ct) of the tested fragment: Ct of the H-2 fragment] for each cell line, respectively.
Fig. 2. Illustration of nucleosome position and amplicon location within the MLH1 promoter A: Gray double solid arrow lines, the four regions segregated according to methylation frequency by Deng et al.[6]; Shadow filled rectangles (qPCR-1~qPCR-4), positions of four fragments within the promoter reported by Lin et al.[8]; Black letters and black lines, locations of 8 pairs of primers and corresponding amplicons to identify the nucleosome position by quantitative PCRs; Grey double arrow dashed line, the core promoter region[9]. Black bars, CpG sites; Gray bars, eight key CpG sites; TSS, transcription start site. B: Gray ellipses, positions of three nucleosomes according to the present study. C: Quantitative PCRs. Relative copy ratio was calculated with the formula [the cycle threshold (Ct) of the tested fragment: Ct of the M-3 fragment] for each cell line, respectively.
www.springerlink.com/Chin J Cancer Res 20(4): 237-242, 2008
241
Fig. 3. Electrophoresis graph of real-time PCR products. A: MLH1 products in RKO and MGC803 cell lines. B: HPRT products in RKO and MGC803 cell lines. M1-R and M1-8: represent M1 primer product in RKO and MGC803, respectively. H1-R and H1-8: represent H1 primer product in RKO and MGC803, respectively.
Nucleosome Position in the MLH1 Promoter with Differential CpG Methylation
Fig. 4. Methylation status of the MLH1 CpG Islands in RKO and MGC803 cell lines by combination of bisulfite-Bst UI restriction assay (COBRA). The length of undigested PCR product is 294 bp. The two fragments of digested product are 206 bp and 88 bp, respectively.
Fig.5. Nucleosomal DNA digestion and purified mono-nucleosomal DNA fragment. A: Micrococcal nuclease (MNase) digestion of RKO and MGC803 chromatin to produce mono-nucleosomal and multi-nucleosomal DNA ladders showed by 2% agrose gel electrophoresis. B: 10% polyacrylamide gel (PAGE) electrophoresis of first-round purified mono-nucleosomal DNA fragments. C: 2% agrose gel electrophoresis of second-round purified mono-nucleosomal DNA fragments. The dashed rectangles indicate the cut regions on gel. Lane 1 and lane 2: RKO cell line; Lane 3 and lane 4: MGC803 cell line
It was reported that methylation of CpG sites within the MLH1 promoter was not homogeneous, and could be separated into four regions (A-D), according to the relationship between the methylation status and loss of transcription in 24 human colon cancer cell lines[6]. CpG sites at the region A (-711nt ~ -577nt) in cells, with or without MLH1 transcription, are always methylated; at the region B (-552nt ~ -266nt) and the region D (-109nt ~ +15nt) are partially methylated and partially correlated with the transcription; 8 CpG sites at the region C (-248nt ~ -178nt) are methylated only in cells without the transcription. The phenomenon of heterogeneous methylation of CpG sites also exits in solid tumor[3]. Similar phenomenon could also be observed in the CpG islands of other genes[11-12]. Histone modifications interact with DNA methylation each other and play an important role in the regulation of transcription. Theoretically, methylation status of CpG sites within the same nucleosome should be homogeneous, if any. It has not been studied whether the methylation regional difference in the CpG Island is possibly caused by different location of nucleosome. In the present study, we detected the methylation status at key CpG sites at the region C of the MLH1 CpG islands by BstUI-COBRA and found that it was not methylated in MGC803 cells (Figure 4). The methylated MLH1 was observed in RKO cells as previously report[6]. Thus, both cells were used in the following nucleosome positioning experiments. Above two-round purified mono-nucleosomal DNA from RKO and MGC803 cells were used as the templates of a battery of qPCRs to locate nucleosomes continuously throughout the whole CpG Island (Figure 2A). The qPCR results showed that primer M-3, M-5, M-7 and M-8 had corresponding products for the MLH1-methylated RKO cells; but only M-3, for the MLH1-unmethylated MGC803 cells (Figure 2C). The results suggested that there is a nucleosome
242
www.springerlink.com/Chin J Cancer Res 20(4): 237-242, 2008
within the promoter region B in both cells, but there are nucleosomes within the region C and D only in RKO cells (Figure 2B). When we summarized our research work, Lin et al. reported similar results on nucleosome positioning within the MLH1 promoter (Figure 2A)[8]. They also observed strong nucleosome signal at the fragment M-3 (corresponding to their qPCR-1) both in the MLH1-methylated RKO cells and the MLH1unmethylated LD419 cells. Moreover, the nucleosome signal at the fragment M-8 (corresponding to their qPCR-3) was observed only in RKO cells. However, they did not detect nucleosome positions within the whole CpG island of MLH1 gene. It was reported that the promoter region -323nt ~ -98nt is the core promoter region[9]. Interestingly, we found that all eight key CpG sites at the region C within the core promoter were located within the same nucleosome corresponding to the M-7 and M-8 fragments. According to that methylation of these key CpGs was correlated to transcription silence of this gene closely and that the nucleosome was only detectable in the MLH1-methylated RKO cells, but was not in the MLH1-unmethylated MGC803 cells, we suggest that methylation-promoted formation of the crucial nucleosome in the core promoter region may be a crucial step during the epigenetic silence of gene transcription. Taken together, the present study indicates that nucleosome may be the basic unit of both CpG methylation and methylation-related regulation of gene transcription. Methylation of CpG sites within the same nucleosome may be homogeneous and methylation of CpG sites between different nucleosomes may be homogeneous or heterogeneous.
[2]
REFERENCES [1]
Luger K, Mader AW, Richmond RK, et al. Crystal structure of the nucleosome core particle at 2.8 A° resolution[J]. Nature 1997; 389: 251-60.
Li B, Carey M, Workman JL. The role of chromatin during transcription[J]. Cell 2007; 128: 707-19. [3] Deng G, Peng E, Gum J, et al. Methylation of MLH1 promoter correlates with the gene silencing with a region-specific manner in colorectal cancer[J]. Br J Cancer 2002; 86: 574-9. [4] Mei M, Deng DJ, Liu TH, et al. Macrosatellite instability results from inactivation of MLH1 gene in sporadic insulinomas and its clinical implications [J]. Clin Cancer Res 2009; 15: (in press). [5] Deng DJ, Zhou J, Zhu BD, et al. Silencing-specific methylation and single nucleotide polymorphism of MLH1 promoter in gastric carcinomas[J]. World J Gastroenterol 2003; 9: 26-9. [6] Deng GR, Chen A, Hong J, et al. Methylation of CpG in a small region of the hMLH1 promoter invariably correlates with the absence of gene expression[J]. Cancer Res 1999; 59: 2029-33. [7] Chen C, Yang TP. Nucleosomes are translationally positioned on the active allele and rotationally positioned on the inactive allele of the HPRT promoter[J]. Mol Cell Biol 2001; 22: 7682-95. [8] Lin J C, Jeong S, Liang GN, et al. Role of nucleosome occupancy in the epigenetic silencing of the MLH1 CpG island[J]. Cancer Cell 2007; 12: 432-44. [9] Arita M, Zhong XL, Min ZH, et al. Multiple sites required for expression in 5’-flanking region of the MLH1 gene[J]. Gene 2003; 306: 57-65. [10] Whitehouse L, Rando OJ, Delrow JD, et al. Chromatin remodeling at promoters suppresses antisense transcription[J]. Nature 2007; 450:1031-6. [11] Graff JR, Herman JG, Myohanen S, et al. Mapping patterns of CpG island methylation in normal and neoplastic cells implicates both upstream and downstream regions in de novo methylation[J]. J Biol Chem 1997; 272: 22322–9. [12] Agathanggelou1 A, Honorio1 S, Macartney DP, et al. Methylation associated inactivation of RASSF1A from region 3p21.3 in lung, breast and ovarian tumors[J]. Oncogene 2001; 20:1509-18.
