Oct 28, 1985 - glutamine amide transfer domain to a primitive NH,- dependent CTP synthetase. The major 5' end of pyrG. mRNA was localized to a position ...
VOl. 261, No , 12, Issue of April 25, pp. 5568-5574.1986 Printed in U.S.A.
THEJOURNALOF BIOLOGICAL CHEMISTRY Q 1986 by The American Society of BiologicalChemists, Inc.
Nucleotide Sequenceof Escherichia coti pyrG Encoding CTP Synthetase* (Received for publication, October 28, 1985)
Manli Weng, Christopher A. MakaroffS, and Howard Zalkin From the Department of Biochemistry, Purdue University, West Lafayette,Indiana 47907
The amino acid sequence of Escherichia coli CTP esis to investigate the role of amino acid residues that are synthetase was derived from the nucleotide sequence important for glutamine amide transfer function (13-15). In of pyrG. The derived amino acid sequence, confirmedthe absence of crystallographic data, identification of conat the N terminus by protein sequencing, predicts a served amino acids in a homologous domain from different subunit of 544 amino acids having a calculated M, of enzymes provides a basis for identifying potentially functional 60,300 after removal of the initiator methionine. A residues to be replaced by mutagenesis (15). In addition, glutamine amide transfer domain was identified which analysis of the pattern for fusion of the glutamine amide extends from approximately amino acid residue 300 to transfer domain to other functional domains has led to a the C terminus of the molecule. The CTP synthetase model for the evolution of amidotransferases having the caglutamine amide transfer domain contains three conserved regions similar to those in GMP synthetase, pacity to utilize NH, and glutamine (8). For these reasons, anthranilate synthase,p-aminobenzoate synthase, and sequences of additiond glutamine amidotransferases are of carbamoyl-P synthetase. The CTP synthetase struc- interest. ture supports a model for gene fusion of a trpG-relatedIn this paper, we report the nucleotide sequence of pyrG glutamine amide transfer domainto a primitive NH,- and the derived CTP synthetase amino acid sequence. The dependent CTP synthetase. The major 5’ end of pyrG CTP synthetase glutamine amide transfer domain contains mRNA was localized to a position approximately 48 three conserved regions similar to those in anthranilate synbase pairs upstream of the translation initiation codon. thase, p-aminobenzoate synthase, GMP synthetase, and carTranslation of the gene eno, encoding enolase, is initi- bamoyl-P synthetase. The CTP synthetase glutamine amide ated 89 base pairs downstream of pyrG. ThepyrG-eno transfer domain is located at the C-terminal end of the junction is characterized by multiple mRNA species molecule, encoded by DNA at the3’ end of the gene, consistwhich are ascribed to monocistronic pyrG and/or eno ent with a model (8) for evolution by gene fusion to augment mRNAs and a pyrG eno polycistronic mRNA. the function of an NHa-dependent enzyme. Experiments to map the 5‘ and 3’ ends of the pyrG mRNA led to thefinding that eno,which encodes enolase, is 89 bpl downstream of PYrG. CTP synthetase is a glutamine amidotransferase that catEXPERIMENTAL PROCEDURES’ alyzes the terminalreactionin the de nouo pathway for pyrimidine nucleotide synthesis: UTP + ATP glutamine + RESULTS CTP + ADP + Pi + glutamate. Similar to other glutamine amidotransferases (I), NH, can replace glutamine in which Subcloning pyrG-Plasmid pNF1519 contains pyrG in a case the products are CTP, ADP, and Pi. Escherichia coli 4.3-kb PstI fragment of E. coli DNA cloned in pBR322 (Fig. CTP synthetase is a complex regulatory enzyme that exhibits 1).pyrG was subcloned into vector pUC8 as shown in Fig. 1. both positive and negative cooperative effects and is subject Plasmid pMWl was obtained by ligation of a mixture of to allosteric activation by GTP (2). Activation by GTP results BamHIfragments from pNF1519 into the BamHIsite of from an increased rate of formation of a covalent glutaminyl pUC8. Selection for pyrG+ was by functional complementaenzyme catalytic intermediate.Accordingly, the NH3-depend- tion of p y a in strainJF646. Plasmid pMW5 was constructed ent reaction is unaffected by GTP. There is no evidence for by ligating the 2.6-kb SalI-PstI segment of E. coli DNA from regulation of the expression of the gene pyrG which encodes pMW1into the SalI andPstI polylinker sitesin pUC8. CTP synthetase in E. coli (3). Further subcloning indicated that DNA at the BamHI and The primary structurerequired for glutamine amide trans- KpnI sites in pMW5 was essential for pyrG function. fer has been obtained for a number of amidotransferases (4DNA Sequenee-The DNA sequence of pyrG was initially 10). Recent sequence analyses of cloned amidotransferase determined using fragments isolated from plasmid pMW5. genes have established the existence of two families of gluta- RsaI, HpaII, or TaqI digests of plasmid pMW5 or of the SalImine amide transfer domains, each of approximately 190-200 amino acids (8-12). We have employed site-directed mutagen* The abbreviations used are: bp, base pair; kb, kilobase pair.
+
* This work wassupported by United States Public Health Service Grant GM24658. This is Journal Paper No. 10,525 from the Purdue University Agricultural Experiment Station. The costs of publication of this article were defrayed in partby the payment of page charges. This article must therefore be hereby marked “aduertkement” in accordance with 18 U.S.C. Section 1734 solelyto indicate this fact. t; Recipient of National Institutes of Health Predoctoral Training Grant GM07211.
Portions of this paper (including “Experimental Procedures” and Figs. 1, 2, 4, 5, and 6) are presented in miniprint at the end of this paper. Miniprint iseasily read with the aid of a standard magnifying glass. Full size photocopies are available from the Journal of Biological Chemistry, 9650 Rockville Pike, Bethesda, MD 20814. Request Document No. 85M-3563, cite the authors, and include a check or money order for $4.40 per set of photocopies. Full size photocopies are also included in the microfilm edition of the Journal that is available from Waverly Press.
5568
pyrG Nucleotide Sequence PstI insertwere ligated into M13mp18 or M13mp19 (Fig.2 A ) . In addition, specific subfragments were isolated from digests that were obtained using restriction enzymes having 6-bp recognition sequences (Fig. 2B). Finally, the exonuclease I11 procedure (26) was employed to obtain a set of overlapping sequences from NruI-BamHI and BumHI-PstI segments of the cloned DNA (Fig. 2C). The DNA sequence shown in Fig. 3 extendsfrom 11 bpupstream of the NruI site to the downstream PstI site at nucleotide 2442. The entiresequence was determined on both DNA strands from overlapping fragments. The derived amino acid sequence of CTP synthetase is shown in Fig. 3. The protein chain of 545 amino acid residues has a calculated molecular weight of 60,450. At nucleotides 2074-2076, an ATG initiatesan open reading frame that extends 123 codons to the 3‘ end of the cloned E. coli DNA. By screening protein data banks, the downstream sequence was found to be homologous with that of yeast enolase. Thus, E. coli eno is 89 bp downstream from py&. CTP Synthetase-Enzyme was purified to homogeneity from cells bearing plasmid pMW5. A single stained protein band was obtained bysodium dodecyl sulfate-polyacrylamide gel electrophoresis. By comparison with proteins of known molecular weight, the CTP synthetase subunit had an estimated molecular weight of 60,000 (Fig.4). The N-terminal amino acid sequence of CTP synthetase was determined by automated Edman degradation. The data for 24 cycles were indicative of a pure protein. In the first cycle, a complex mixture was obtained, apparently containing methionine, threonine, and a residue similar to alanine. From cycles 2 through 24, the sequence was identical with that shown in Fig. 3 from Thr-3 toLeu-25. We conclude that Met1 was removed by processing and the N terminus of the mature enzyme is threonine2 or a modified form of threonine. pyrG mRNA-The 5‘ end of pyrG mRNA was mapped by the nuclease S1 procedure (29). A 462-nucleotide NruIBumHI DNA probe was used which extends from nucleotides 12-473 (Figs. 2 and 3). The probe was labeled with Ia-”P] dCTP by primer extension or the double-stranded fragment was isolated and 5’ end-labeled with [y3’P]ATP and polynucleotide kinase. The results of nuclease S1 mapping are shown in Fig. 5. Two protected fragments of coding strand DNA were obtained (Fig. 5A, lune 2). Noncoding strand DNA did not anneal toRNA and was completely digested (Fig. 5A, lune 4). To confirm that the two transcripts extend into the pyrG coding sequence, nuclease S1 mapping was repeated using the 5’ end-labeled NruI-BumHI probe. Fig. 5B shows that the same two protected fragments were obtained. The size of the major protected fragment is about175 nucleotides, and the minor one approximately 255 nucleotides. More precise mapping was obtained by using a DNA sequencing ladder as a size standard (Fig. 5C). Theseresults confirm those obtained with restrictionfragment size standards, Corresponding sites for transcription initiation are overlined in Fig. 3. The 3’ end of pyrG mRNA was mapped with a KpnI-PstI DNA probe that extends from nucleotides 1663-2442 (Figs. 2 and 3). The results of nuclease S1 mapping are shown in Fig. 6. The major products obtained fromthe coding strand were undigested probe and a fragment of approximately 400 nucleotides (Fig. 6, lune 2). Minor fragments of approximately 420, 530, and 650 nucleotides were also obtained. The same pattern of fragments was obtained when the nuclease S1 concentration was increased 3-fold (data not shown). The noncoding strand DNA probe didnot annealto RNA and was completely digested (Fig.6,lune 4). These results indicate
5569
that there are multiple species of pyrG and eno mRNA. An mRNA that anneals andfully protects the probe is suggestive of polycistronic pyrG e m mRNA. DISCUSSION
The nucleotide sequence of E. coli pyrG was determined in order to extend our analysis of the relationship of glutamine amidotransferase structure to function. Recent sequence analyses indicate that different amidotransferases contain one of two distinct glutamine amide transfer domains (8-12). In all amidotransferases, a glutamine amide transfer domain is combined by various arrangements with a domain that catalyzes an NH3-dependent biosynthetic reaction. This combination endows glutamine amidotransferases with the capacity to catalyze a glutamine-dependent as well as an NH3-dependent biosynthetic reaction, both in vitro and in vivo (13, 14). Both types of glutamine amide transfer domain utilize an active site cysteine to form a covalent glutaminyl intermediate for catalysis of amide transfer (13, 14). Amidophosphoribosyltransferase (11) and glucosamine-6-P synthase (12) have a highly conserved glutamine amide transfer domain of approximately 190 amino acids that ischaracterized by an N-terminal active site cysteine. The second type of glutamine amide transfer domain, in GMP synthetase (30), carbamoyl-P synthetase (7, lo), anthranilate synthase (5), and p-aminobenzoate synthase (9), shown in Fig. 7, hasthree conserved segments. The active site cysteine in segment 2 is usually at a position approximately 80 to 90 amino acids from the N terminus of the domain. The alignment in Fig. 7 localizes the CTP synthetase glutamine amide transfer domain and establishes its similarity to thatin carbamoyl-P synthetase, GMP synthetase, anthranilate synthase, andp-aminobenzoate synthase. Using current nomenclature, the CTP synthetase glutamine amide transfer domain is trpG-related (8). In GMP synthetase, anthranilate synthase component 11, and p-aminobenzoate synthase subunit 11,the homologous trpG-related glutamine amide transfer domain (8)is initiated at theN-terminal residue of the protein chain. By noting that the first block of conserved sequence occurs 46-54 residues from the beginning of the domain in the three preceding enzymes, we estimate that the CTPsynthetase glutamine amide transfer domain begins approximately at amino acids 292 to 300. Amino acid residues 1 to approximately 300 should contribute the structure needed for catalyzing the NH3-dependent reaction. The glutamine amide transfer domain is fused onto the C-terminalend of the enzyme. Likewise, in carbamoyl-P synthetase, the glutamine amide transfer domain is fused onto the C-terminal end of a protein chain,except that thefunction of the N-terminall85amino-acid segment is unknown. The conservation of amino acids in region 2 is sufficiently high to predict that the conserved cysteine, residue 379 in CTP synthetase, functions to form the covalent glutaminyl intermediate as has been shown for Cys-84 in anthranilate synthase component I1 (14). Likewise, CTP synthetase His515 in region 3 is implicated in the proton transfer that is required for ionization of Cys-379 (15). Whereas previous experiments have provided evidence for catalytic roles of cysteinyl and histidyl side chains in regions 2 and 3, respectively, there is no evidence bearing on the possible role of region 1 in glutamine amide transfer. In a previous analysis of the pattern for fusion of the glutamine amide transfer domain to other protein chains, a model was proposed to explain the evolution of glutamine amidotransferases from primitive NH3-dependent enzymes (8).According to thismodel, after duplication, genes encoding
pyrG Nucleotide Sequence
5570 40
30
20
10
GAGCGTCGTT
TTCGCGAAGT
GGAGCGTATT
90
80
GTTGCCGCGC 110
100
50
60
120
130
AATGACAGGT GTGGACTGGA
TAAGGGAATT AAACAATGGA AGAAGTCTGG CAACAGGTAA AACGGCAGGA AATTGATCTC 190
180
1150 70
GCGCCATTTG 220 250
160
TGTCATTTTT (240 2)
TAAATGACAA
GCGCTTGATT
270
GAAAGTTTGT ATTTTCTCAC TCCTGATTTC AATAGTGCGC TGGCGAAGAG GAGGGATAAT 2 90
ATGTTCGGGT
330 300
(1) 320
ATACTGCTTT
340
310
CCCGTCTTGG
TTATTCCATC
140
ACGCGGTCAA
210 200 ACATTTACCC CAAAGGGGCT TGCGTCAAAA 260
230
70
GTTGACCTCG
280
GGCACAGGTC 350
CCTAACTTCT C E T T C A G C GTCTTTTCAA
380
410
ATG ACA ACG AAC TAT ATT TTT GTG ACC GGC GGG TCC GTC TCT GTA CTG GGT AAA GGC ATT Met Thr Thr Asn Tyr Ile Phe Val Thr Gly Gly Val Val Ser Ser Leu Gly Lys Gly Ile 10
20
440
470
GCC GCA GCC TCC CTC GCA GCC ATT CTT GAA GCC CGT GGC CTC AAT GTGAAA ACC ATC ATG Ala Ala Ala Ser Leu Ala Ala Ile Glu LeuAla Arg Gly Leu Asn Val Thr Ile Met Lys 30 40 500
530
CTG GAT CCG TAC ATC AAC GAT GTC CCAGGT ACT ATG AGC CCA ATC CAA CAC GGG GAA GTG Leu Asp Pro Tyr Ile Asn Val Asp Pro GlyMetThr Ser Pro IleGlo H i s Gly Glu Val 50
590
60
5 60
TTC GTT ACT GAA GAC GGC GCT GAA ACC GAC CTG GAC CTG GGG CAC TAC GAG CGT TTC ATT Phe Val ThrGlu Asp Gly AlaGlu Thr Asp Leu Asp Leu Gly H i s Tyr Glu Arg Phe Ile 70
80
620
650
CGT ACC AAA ATG AGC CGC CGC AAC AAC TTC ACC ACG CGTGGT ATC TAC TCT GAC GTT CTG Arg Thr Lys Met Ser Arg Arg Asn Asn Phe Thr Gly Thr Arg Ile Tyr Ser Asp Val Leu 90
100
680
710
CGT AAA GAA CGC CGC GGT GAC TAC CTC GGC GCA ACC GTG CAG GTT ATT CCG CAC ATC ACT Arg Lys Glu Arg Arg Gly Asp Tyr Leu Gly Ala ThrGln ValVal Ile P r o H i s Ile Thr 110
120
740
77 0
AAC GCA ATC AAA GAG CGC GTG CTG GAA GGT GGC GAA GGT CAT GAC GTA GTA CTG GTA GAA Asn Ala Ile LysGlu Arg Val LeuG l u Gly GlyGlu Gly His Asp Val Val Leu Val Glu 130
140
800
830
ATC GGC GGT ACA GTA GGT GAT ATC GAA TCC TTG CCG TTC CTC GAA GCG ATT CCC CAG ATG Ile Gly Gly Thr Val Gly AspGlu IleSer Leu Pro Phe Leu G l u Ala Ile Arg Gln Met 150
160
860
890
GCT GTT GAA ATT GGC CGT GAG CAC ACT CTG TTT ATG CAC CTG ACG CTG ATG GTG Ala Val Glu Ile Gly Arg Glu His Thr Leu PheMet H i s Leu Thr Leu Val Pro Tyr Met
CCG
TAC
170
180
920
950
GCA GCG TCT GGT GAA GTCAAA ACC AAA CCG ACT CAG CAC TCT GTA AAA GAG CTG CTC TCC Ala Ala Ser GlyGlu Val Lys Thr Lys Pro Thr Gln H i s Ser Val LysGlu Leu Leu Ser 190 980
200
1010
ATC GGT ATC CAG CCT GAC ATC CTG ATT TGT CGT TCA GAT GCT CGC GTT CCG GCG AAC GAA Ile Gly IleGln Pro Asp Ile Leu Ile Cys Arg Ser Asp Arg Ala Val Pro Glu Ala Asn 210
220
1040
1070
CGT CCG AAG ATT GCA TTG TGT TTC AAT GTT CCG GAA AAA GCG GTT ATT TCT CTG AAA GAC Arg Ala Lys Ile Ala Leu Phe Cys Asn ValG lPro u Lys Ala Val Ile Ser Leu Lys Asp 230
1100
240
1130
GTC GAT TCC ATC TAT AAA ATT CCG GGC CTG TTG AAA TCTGGG CAGCTG GACGAT TAT ATT Val Asp Ser Ile Tyr Lys Ile Pro Gly Leu Leu Lys Ser Gln Gly Leu Asp Asp Tyr Ile 250
260
1160
1190
TGT AAA CGA TTC AGCTTA AAC TGC CCG GAA GCG AAT CTG TCC GAA TGG GAA GTT GAG ATC Cys Lys Arg Phe Ser Leu Asn Cys Pro Glu Ala Asn Leu SerGlu Trp GluGln Val Ile 270
1220
1250
TTC GAA GAA GCG AAC CCG GTA AGT GAA GTC GGT ACC ATG ATC GTC GGC AAG TAC ATT GAA Phe Glu Glu Ala Asn Pro Val Ser Glu Val Thr Ile Gly Met Val Gly Lys TyrG l uIle 2 90
280
300
FIG. 3. Nucleotide sequence of E. coli p y r G , flanking regions, and translated amino acid sequence of CTP synthetase. The translated sequence of an N-terminal segment of enolase is downstream of CTP synthetase. Underlined sequences included pyrG ribosome binding site, e m ribosome binding site. Regions corresponding to themajor and minor mRNA 5’ ends are overlined and numbered ( I ) and (Z),respectively.
pyrG Nucleotide Sequence 1280
C T GC C GG A TG C TT A T L e u P r o A s pA l a
AAA TCAGTGATCGAAGCACTG T y r L y s Ser V a l I l e G l u A l a 310
5571
1310 AAA CACGGT GGG CTG AAG AATCGT Leu L y s H i s G l y G l y L e u L y s A s n A r g 320
1340 GTC AGC G T C AAC ATCAAACTGATCGATTCACAAGATGTTGAAACGCGC V a l Ser V a l A s n I l e Lys Leu I l e A s p Ser G l n A s p V a l G l u 330
1370 GGG CTTGAAATC Thr A r g G l y L e u Glu Ile 340
1400 C T T AAAGGTCTGGACGCAATCCTCGTACCTGGCGGTTTCGGCTATCGTGGCGTAGAACGC L e uL y sG l yL e uA s pA l a I l e Leu V a l P r o G l y G l y Phe G l y T y r A r g G l y V a l G l u 3 50 ATGATTACGACCGCGCGT Met I l e T h r T h r A l a A r g
1460 TTT GCGCGT GAG AAC AATATTCCTTATCTGGGCATTTGCCTG Phe A l a A r g G l u A s n A s n I l e P r o Tyr L e uG l y 310
1520 GGT ATG CAG GTGGCGTTAATTGATTACGCTCGCCATGTTGCC G l y Met G l n V a l A l a L e u I l e A s p T y r A l aA r gH i sV a lA l aA s n 390
1430 Gly 360
1490 I l e C y sL e u 380
1550 AAC ATG GAG AAC GCCAAC Met G l uA s nA l a Asn 400
1580 1610 T C T ACG GAA T T TG T GC C AG A CT G T AAG TACCCGGTTGTGGCGCTGATTACCGAGTGGCGC S e r T h r G l u Phe V a l P r o A s pC y sL y s Tyr Pro V a lV a lA l a Leu I l e Thr G l u T r p A r g 410 420 GAT GAA AAC GGC AAC G T T GAA G T TC G T A s pG l uA s nG l yA s nV a lG l uV a lA r g
1640 AGC GAG AAG AGC Ser G l u L y s 430
1700 CTCGGCGCACAGCAGTGCCAGTTGGTTGACGAT L e uG l yA l aG l nG l nC y s G l n L e uV a lA s pA s p 4 50
1670 GATCTCGGCGGTACCATGCGT Ser A s p L e u G l y G l y T h r Met A r g 440
1730 AGC CTGGTTCGCCAGCTGTACAATGCG Ser L e u V a l A r g G l n L e u Tyr A s n A l a 460
1760 CCGACAATTGTT GAG CGTCATCGT CAC CGTTACGAAGTC AAC AAC Pro Thr I l e V a l G l u A r g His A r g His A r g T y r G l u V a l A s n A s n 470 1820 ATTGAAGATGCAGGTCTGCGCGTTCGGGCGCGTTCC Ile Glu A s p A l a G l y L e u A r g V a l A r g A l a A r g 4 90
1790 ACTCTGTTGAAA CAG Ser Leu Leu L y s Gln 4 80 1850
GGG GATGAT CAG T T GG T C Ser G l y A s p A s p G l n L e u V a l G l u
1880 ATCGAAGTTCCGAATCACCCGTGGTTCGTGGCTTGCCAGTTCCATCCG I l e G l u V a l P r o A s n H i s P r o T r p Phe V a l A l a C y s G l n 510
GAGATC Ile 500
1910 GAG T T TA C TT C T Phe H i s P r o G l u Phe Thr Ser 520 1970 AGC GAG T T C CAG Ser G l u Phe G l n 540
1940 ACTCCACGTGATGGT CACCCGCTG TTT GCAGGCTTTGTG AAAGCCGCC T h r Pro A r g A s p G l y H i s Pro L e u Phe A l a G l y Phe V a l L y s A l a A l a 530
1998 2008 2018 2028 AAA C G T CAGGCGAAGTAAGTAAAAAAGTTAGAGCGGCAACGTACCCTGGGTACGCGTTGTTTGTCTGG L y sA r g G l n A l a L y s End
2048 2058 2068 AGTTTCAGTTTAACTAGTGACTTGAGGAAAACCTAATGTCCAAAATCGTAAAAATCATCGGT Met Ser L y s I l e V a lL y s
2038
2100 Ile Ile
Gly
2 1 30 2160 C G T GAAATCATCGACTCCCGTGGTAACCCGACTGTTGAAGCCGAAGTACATCTGGAGGGT A r g G l u I l e I l e A s p Ser A r g G l y A s n Pro Thr V a l Glu A l a G l u V a l H i s L e u G l u G l y
2190 2220 GGTTTCGTCGGTATGGCAGCTGCTCCGTCAGGTGCTTCTACTGGTTCCCGTGAAGCTCTG G l y Phe V a l G l y Met A l a A l a A l a Pro Ser G l y A l a Ser Thr G l y Ser A r g G l u A l a L e u
2250 GAACTGCGCGATGGCGACAAATCCCGTTTCCTGGGTAAAGGCGTAACCAAAGCTGTTGCT G l uL e uA r gA s pG l yA s p Lys Ser A r g Phe L e u G l y Lys G l y V a l GCGGTA AAC GGC A l aV a lA s nG l y
2280 Thr Lys A l a V a l A l a
2310 CCGATCGCTCAGGCGCTGATTGGCAAAGATGCTAAAGATCAGGCTGGC Pro I l e A l a G l n A l a L e u I l e G l yL y sA s pA l aL y sA s p
2370 ATTGAC AAGATCATGATCGACCTGGACGGCACCGAAAACAAATCCAAATTCGGCGCGAAC I l e A s p L y s I l e Met I l e A s p Leu A s p G l y Thr G l u A s n L y s 2430 GCA ATC CTG G C T GTA T C T CTG G C T AAC GCC AAA G C T G C TG C A A l a I l e L e u A l a V a l Ser Leu A l a A s n A l a Lys A l a A l a A l a
FIG.3-continued.
2340 Gln A l a G l y
2400
S e r Lys Phe G l y A l a A s n
5572
pyrG Nucleotide Sequence
FIG. 7. Alignment of amino acids in three conserved segments of the glutamine amide transfer domain in E. coli GMP synthetase (GMPS) (8, 30), anthranilate synthasecomponent I1 (AS II) (5), p aminobenzoate synthase subunit11(PABS) (9). carbamoyl-P synthetase(CPS) (7), and CTP synthetase
(CTPS). The numbers between dashes indicate the number of amino acids from the N terminus (NH,),between segments, and to the COZterminus ( C O m or to the end of the domain (/). The numbering system at the top, as used previously (8),counts all positions, including gaps, from the start of the domain. a glutamine amide transfer domain translocated adjacent to pyrG eno mRNA annealed to theprobe and protected against operons encoding existing NH3-dependent enzymes. It was nuclease S1 digestion. An alternative possibility, not presently suggested that the patternsof fusion were apparently deter- excluded, is thattwo overlapping monocistronic pyrG and eno mined by the inability of a glutamine amide transfer domain RNA molecules can anneal to theprobe forming a tripartate to translocate contiguous to a promoter. The arrangement of nuclease S1-resistant structure(37). The other major mRNA the glutamine amide transfer domain inCTP synthetase of approximately 400 nucleotides should correspond either to conforms to this model. Nuclease S1 mapping indicates that a pyrG transcript having a 3' end at approximately nucleotide the major pyrG promoter is proximal to the translationiniti- 2059 or an eno transcript having a 5' end at approximately ation codon. No other genes intervene between the promoter nucleotide 2040. Likewise, the minor mRNA species of 420, and pyrG. The position of the glutamine amide transfer do- 530, and 650 nucleotides either terminate distal to pyrG or main in CTP synthetase is consistentwith translocation and initiate upstream of eno. Further experiments are required to fusion of a trpG-related glutamine amide transfer domain to determine whether multiple pyrG and eno mRNA molecules of an existingpyrG coding sequence arise from transcription termination afterpyrG and transcripthe 3' promoter distal end tion initiation prior to eno or whether a primary pyrG eno of approximately 300 amino acids. To explain the trpG (5, 31, 32) and pabA (9) gene fusion mRNA undergoes processing. Since pyrG expression appears pattern inseveral microorganisms, it was proposed that trpG- to be constitutive (3), there areno obvious regulatory barriers related gene fusions onto the 3' end of an existing gene were to a polycistronic pyrG eno transcriptional unit. unfavorable compared to 5' end fusions (8).It is now apparent Acknowledgments-We thank James Friesen for providing pyrG that 3' end trpG-related gene fusions occur in carbamoyl-P synthetase (7, 33) and CTP synthetase. It is uncertain why plasmid pNF1519 and E. coli strain JF646, Mark Hermodson for 3' end trpG or trpG-related gene fusions did not occur with sequenator analyses, and Dan Ebbole for insightful discussions. trpE or pabB, respectively. REFERENCES Previously, evidence was reported (34) that E. coli CTP 1. Buchanan, J. M. (1973) Adu. Enzymol. Relat. Areas Mol. Biol. synthetase is a dimer (Mr= approximately 105,000) of iden39,91-183 tical subunits that undergoes aggregation to a tetramer of M, 2. Koshland, D. E., Jr., and Levitzki, A. (1974) The Enzymes 1 0 , = approximately 210,000. Asubunit Mr = approximately 539-559 50,000 was determined by polyacrylamide gel electrophoresis 3. O'Donovan, G., and Neuhard, J. (1970) Bacteriol. Rev. 34,278343 in 8 M urea. The present experiments indicate a calculated 4. Kawamura, M., Keim, P. S., Goto, Y., Zalkin, H., and Heinrikson, M , = 60,450 for the primary translation product. Removal of R. L. (1983) J. Bwl. Chem. 253,4659-4668 the initiator methionine residue should yield a protein chain 5. Nichols, B. P., Miozzari, G. F., van Cleemput, M., Bennett, G. having a calculated M, = 60,300. The calculated value of N., and Yanofsky, C. (1980) J. Mol. Biol. 142,503-517 60,300 is consistent with the results of sodium dodecyl sulfate6. Kaplan, J. B., and Nichols, B. P. (1983) J. Mol. Biol. 168, 451polyacrylamide gel electrophoresis. NHAerminal protein se468 7. Piette, J., Nyunoya, H., Lusty, C. J., Cunin, R., Weyens, G., quencing verities that the correct initiator methionine was Crabeel, M., Charlier, D., Glansdorff, N., and PiBrard, A. (1984) identified. Proc. Natl. Acad. Sci. U.S. A. 81,4134-4138 Analysis of the pyrG 3' flanking sequence indicates an ATG 8. Zalkin, H., Argos, P., Narayana, S. V. L., Tiedeman, A. A., and translation start 86 bp downstream from the pyrG TAA Smith, J. M. (1985) J. Biol. Chem. 260,3350-3354 translation termination triplet. The ATG, position 2074, is 9. Kaplan, J. B., Merkel, W. K., and Nichols, B. P. (1985) J. Mol. preceded by a ribosome binding site (underlined) and starts Bid. 183,327-340 an open reading frame that extends to the endof the cloned 10. Werner, M., Feller, A., and PiBrard, A. (1985) Eur. J. Biochem. 146,371-381 E. coli DNA. The translated sequence exhibits 57% identity 11. Tso, J.Y., Zalkin, H., van Cleemput, M., Yanofsky, C., and with yeast enolase (35) and thus identifies E. coli e m immeSmith, J. M. (1982) J. Biol. Chem. 2 5 7 , 3525-3531 diately downstream of pyrG. The gene order on the E. coli 12. Walker, J. E., Gay, N. J., Saraste, M., and Eberle, A. N. (1984) linkage map (36) a t min 59, pyrG relA relXeno, must therefore Biochem. J. 2 2 4 , 799-815 be revised to e m pyrG re& (16) based on DNA sequence 13. Mantsala, P., and Zalkin, H. (1984) J. Bid. Chem. 2 5 9 , 1423014236 analysis. Nuclease S1 mapping of the pyrG eno boundary indicates 14. Paluh, J. L., Zalkin, H., Betsch, D., and Weith, H. L. (1985) J. Bwl. Chem. 2 6 0 , 1889-1894 multiple species of mRNA. One of the major products of this 15. Amuro, N., Paluh, J. L., and Zalkin, H. (1985) J. Bwl. Chem. mapping experiment was the fully protected probe. The con260,14844-14849 ventional interpretation of this result is that a polycistronic 16. Friesen, J. D., An, G., and Fiil, N. P. (1978) Cell 15,1187-1197
pyrG Nucleotide Sequence 17. Birnboim, H. C., and Doly, J. (1979) Nucleic Acids Res. 7,15131525 18. Vogel, H. J., and Bonner, D. M. (1956) J. Bwl. Chem. 218,97102 19. Anderson. P. M. (1983) Biochemistry 22.3285-3292 20. Long, C. W., and Pardee, A. B. (1967) J. Bwl. Chem. 242,47154721 21. Layne, E.(1957) Methods Enzymol. 3,447-454 22. Laemmli, U.K.(1970) Nature 227,680-685 23. Mahoney, W. C., Hogg, R. W., and Hermodson, M. A. (1981) J. Riol. Chem. 256,4350-4356 24. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,5463-5467 25. Biggen, M.D.,Gibson, T. J., and Hong, G.F. (1983) P m . Natl. Acad. Sci. U. S. A. 80,3963-3965 26. Henikoff, S. (1984) Gene (Amst.)28,351-359 27. Queen, C., and Korn, L. J. (1984) Nucleic Acids Res. 12,581-599 28. Jinks-Robertson, S., Course, R. L., and Nomura, M. (1983) Cell 33,865-867
5573
29. Berk, A. J., and Sharp, P. A. (1978) P m . Natl. Acad. Sci. U.S. A. 75,1274-1278 30. Tiedeman, A., Smith, J. M., and Zalkin, H. (1985) J. Biol. C k m . 260,8676-8679 31. Schechtman, M. C., and Yanofsky, C. (1983) J. Mol. Appl. Genet. 2.83-99 32. Zalkin, H., Paluh, J. L., van Cleemput, M., Moye. W. S., and Yanofsky, C. (1984) J. Bwl. Chem. 269,3985-3992 33. Nyunoya. H., and Lusty, C. J. (1984) J. Riol. Chem. 259,97909798 34. Levitzki, A., Stallcup, W. B., and Koshland. D. E.,Jr. (1971) Biochemistry 10,3371-3378 35. Holland, M. J., Holland, J. P., Thill, G . P.. and Jackson, K. A. (1981) J. Bwl. Chem. 256,1385-1395 36. Bachmann, B. J., and Low, K. B. (1980) Microbial. Rev. 44, 156 37. Lopata, M. A., Sollner-Webb. B., and Cleveland, D. W. (1985) Mol. Cell Bwl. 5.2842-2846
Supplsmtary Wltnrial to Nucleotide S.quence of Escherichia c o l i p y f f i Encoding ClQ SynthnIsa
R n l i Yang. Christopher A. Wlkamff,
IM Itward Zalkin
EXPERIMOITU PROCEWRES
-
Subcloning p ~ f f i Strain J F 6 1 I s a pyrimidine rulotmph that rrquims y t i d i n for Pro*th. was SUMloned frm pNF1519. a pBR322 d e r i r a t l r e . t o WC8. playids were selected i n s t r a i n JF646, g m n w i t h u r a c i l . by cDnplentation of the ChrOnYlseMl @ mutation.
m'
&'
-
CTP synthetase us purified t o electrophoretic honopwity by the Crude extracts of plasmid-bearing s t r a i n J F W c o n t a l d rppmxCTP svnthecase the r d . .ok.nvl-