Nucleotide Sequence of HBI, a Novel ... - Journal of Virology

JOURNAL OF VIROLOGY, Dec. 1985, p. 969-977 0022-538X/85/120969-09$02.00/0 Copyright © 1985, American Society for Microbiology

Vol. 56, No. 3

Nucleotide Sequence of HBI, a Novel Recombinant MC29 Derivative with Altered Pathogenic Properties DOUGLAS R. SMITH,' BJORN VENNSTROM,2 MICHAEL J. HAYMAN,' AND PAULA J. ENRIETTOl*

Imperial Cancer Research Fund Laboratories, Dominion House, St. Bartholomew's Hospital, London, EC1A 7BE England,' and European Molecular Biology Laboratories, 6900 Heidelberg, Federal Republic of Germany2 Received 24 June 1985/Accepted 21 August 1985

HBI is a recombinant avian retrovirus with novel pathogenic properties that was derived from the myc-containing virus MC29. In contrast to MC29, which causes endotheliomas in chickens, HBI induces lymphoid tumors. The results of molecular cloning and nucleotide sequencing of HBI reported here show that the virus contains sequences derived from both c-myc and ring-neck pheasant virus, in addition to MC29. The 3' half of the myc gene was largely replaced by c-myc sequences, and most of the long terminal repeat and gag regions were replaced by ring-neck pheasant virus sequences. The long terminal repeat contained a triplicate sequence which was homologous to the core enhancer sequence of the simian virus 40 72-base-pair repeat. The significance of these changes in relation to the unusual biological properties of the virus are discussed.

The avian acute leukemia retrovirus MC29 (myelocytomatosis virus) is capable of inducing a variety of tumors when injected into newborn chickens and can also transform cultured macrophages and fibroblasts in vitro (3, 18, 20, 31, 43). The tumorigenic potential of the virus is conferred by the v-myc oncogene which replaces portions of the viral gag, pol, and env genes (30, 42, 46). The viral genome exists as a stably integrated provirus in infected cells. From this a single mRNA species is transcribed which is subsequently translated into a 110-kilodalton (kDa) gag-myc fusion protein (5). MC29 has been reported at various times to induce a wide spectrum of tumors in chickens, including liver and kidney tumors, myelocytomas, and carcinomas (20, 31). Laboratory strains tested recently, however, have shown a more restricted pathogenicity, inducing mostly endotheliomas and occasionally myelocytomas (16). The v-myc gene is homologous to and most likely derived from a cellular gene c-myc, which has also been implicated in neoplasia. c-myc has been shown to be amplified and overexpressed in cells derived from a number of human tumors, including the promyelocytic cell line HL60 (12), a colon carcinoma cell line of neuroendocrine origin (2), several small cell lung cancer cell lines (27), and gastric adenocarcinoma cells (47). c-myc has also been shown to be activated by promoter insertion in avian leukosis virusinduced chicken B-cell lymphomas (19, 32, 33). In addition, it has been found in close proximity to the breakpoints of plasmacytomas (for a review, see reference 41). An apparent difference in tumor types associated with c-myc and v-myc expression (lymphoid and endothelioid, respectively) led us to investigate a novel MC29 variant called HBI. This virus has undergone recombination in the myc region and causes primarily lymphoid tumors, which is in striking contrast to MC29 (17). HBI is derived from a transformation-defective MC29 mutant, tdlOH, which has a 600-base-pair deletion in the 3' half of the myc gene (7, 15). It was isolated following passage of tdlOH in chick bone marrow cells by virtue of having regained the ability to transform macrophages (36). A brief outline of the isolation is given in Fig. 1. The gag-myc protein product of HBI (108 kDa) is similar in size to that of *

MC29; the tdlOH protein is considerably smaller (90 kDa) (37, 38). Tryptic peptide analysis has shown that the HBI protein regained myc-specific peptides that were lost in tdlOH (36). Furthermore, restriction endonuclease mapping of a genomic HBI provirus showed that the virus contained a full-sized myc gene (36). Although there were no restriction site alterations in myc, there were a small number of differences in the long terminal repeat (LTR) and gag regions when compared with MC29 (6, 36). These may contribute to some of the unusual biological properties of the virus. To identify regions of the viral genome responsible for the altered oncogenic spectrum and to better understand the detailed structure of the virus, we cloned and sequenced part of an HBI provirus and compared it with MC29 and c-myc sequences. We also sequenced part of the helper virus used in the isolation of HBI, ring-neck pheasant virus (RPV) and compared HBI with this as well. It is clear from this analysis that HBI is made up of a combination of MC29, c-myc, and RPV sequences. These results allow speculation about the region of the virus that is important for the altered pathogenicity and provide information that will enable these ideas to be tested.

MATERIALS AND METHODS Cells and viruses. The nonproducer cell line HBI clone 3 was used as a source of HBI proviral DNA in this study. The generation and propagation of HBI virus has been described previously (36). Cloning of the HBI clone 3 provirus. High-molecularweight DNA was isolated from HBI clone 3 cells and partially digested with restriction endonuclease Sau3A as described by Maniatis et al. (29). Digested DNA was size fractionated on a 10 to 40% sucrose gradient, and the fractions were then run on an agarose gel and Southern blotted (49). The blot was probed with a nick-translated plasmid probe p-myc PstI which contains a 1.5-kilobase (kb) PstI fragment derived from the myc gene of the MC29 clone, MC38 (51). Fractions containing DNA between 15 and 20 kb in length were pooled and ethanol precipitated. The lambda phage vector Charon 28 (40) was cut with restriction endonuclease BamHI (Biolabs) following the specifications of the manufacturer. BamHI arms were then prepared by fractionation on 10 to 40% sucrose gradients

Corresponding author. 969

970

SMITH ET AL.

td 1OH VIRUS RESCUED FROM A QUAIL NONPRODUCER CELL LINE USING RPV AS HELPER

VIRUS PLATED ONTO CHICK BONE MARROW CELLS

MACROPHAGE COLONIES ISOLATED AND PURIFIED

HBI VIRUS RESCUED USING RPV AS HELPER

VIRUS PLATED ONTO QUAIL CELLS; NONPRODUCER CELL LINE ISOLATED

HBI PROVIRUS RESTRICTION MAPPED AND CLONED

FIG. 1. Derivation of HBI. A summary of the isolation of HBI virus is shown. The procedures have been reported in detail previously (36).

(29). Purified phage arms and Sau3A-digested HBI clone 3 DNA were ligated and packaged as described by Maniatis et al. (29). Packaged phage were used to infect indicator bacteria DP50 supF and plated. The resulting plaques were screened with the plasmid probe p-myc PstI. Positive plaques were isolated and purified, and phage DNA was prepared and digested with the appropriate enzymes to identify HBI proviral DNA. Proviral DNA from one such clone was then subcloned into the HindIII site of the plasmid vector pUC8 (52) for further analysis (this subclone was designated pUH9). Nucleotide sequence determination. Fragments of HBI DNA from plasmid pUH9 were subcloned into M13 mplO and mpll and sequenced by the dideoxy chain termination method with a-thio[35S]dATP essentially as described previously (4, 44). The clones consisted of ClaI-BamHI and random AluI fragments from the gag-myc region 3' to the XhoI site (Fig. 2) and XbaI-EcoRI, EcoRI-SstI, and BamHISstI fragments from the 5' end of the cloned provirus. A similar strategy was used to determine the sequence of the 5' LTR and gag region of RPV DNA from plasmid pRPV (kindly supplied by W. S. Hayward). These sequences were then compared and aligned with the Q5 MC29 sequence described previously (25, 39). About 60% of the sequences were read off both DNA strands, and most of the remaining sequences were sequenced at least twice from independent clones. Transfection of chicken embryo fibroblasts and rescue of HBI virus. Chicken embryo fibroblasts were prepared as described previously (53) and were grown in Dulbecco modified Eagle medium containing 10% tryptose phosphate broth, 5% calf serum, and 1% chick serum. The day before transfection a primary culture of chicken embryo fibroblasts was subcultured at a density of approximately 106 cells per 60-mm dish. The next day cells were transfected with cloned proviral DNA (1, 5, and 10 ,ug) by the calcium phosphate procedure of Stow and Wilkie (50). The following day transfected cells were treated in one of the following two ways. Some cells were overlayed with 0.8% agar in Dulbecco modified Eagle medium, foci were picked and grown in Dulbecco modified Eagle medium, and the resulting

J. VIROL.

cultures were subsequently superinfected with the helper virus tdB77 to rescue HBI virus. Alternatively, cultures were split the day following transfection and superinfected with helper virus tdB77. Supernatants from superinfected cultures were assayed for fibroblast and macrophage-transforming ability as described previously (3, 43) using chick embryo fibroblast or chick bone marrow cultures. Immunoprecipitation of transfected chicken embryo fibroblasts. Chicken embryo fibroblasts transfected with pUH9 DNA and superinfected with tdB77 were labeled for 20 min with [35S]methionine (150 ,uCi/ml; Amersham Corp., Arlington Heights, Ill.) and immunoprecipitated as described previously (36). Antisera used in these experiments were obtained from tumor-bearing rats which had been immunized by injection with MC29-transformed rat 1 cells (34). The resulting antisera recognized both gag and myc determinants on the 110-kDa gag-myc protein. Antibodies recognizing gag determinants were removed by absorbing antisera with viral structural proteins. This serum is designated as absorbed tumor-bearing rat serum. Immunoprecipitates were analyzed on sodium dodecyl sulfate-polyacrylamide gels as described by Laemmli (23). RESULTS A brief summary of the isolation of HBI (36) is given in Fig. 1. Although this has been described previously, it is presented here as an aid to discussion on the possible origin of sequences found in HBI (see below). A total of three independent macrophage colonies were isolated, one of which was used as a source of HBI. HBI virus was rescued from the macrophages by cocultivation with chicken embryo fibroblasts followed by superinfection with RPV. Cloning and characterization of HBI proviral DNA. The HBI nonproducer quail embryo fibroblast cell line, clone 3, was analyzed and found to contain only a single integrated provirus. Restriction mapping of this provirus by Southern blotting with various probes has been done previously (36). High-molecular-weight genomic DNA from this cell line was prepared, partially digested with restriction endonuclease Sau3A, fractionated on sucrose gradients, and cloned into BamHI arms from the lambda phage vector Charon 28. A total of 12 clones containing various portions of the integrated proviral genome were isolated from approximately 300,000 phage plaques. Only one of these, termed Charon 28 H9, contained the entire myc gene in a fragment of the expected size (approximately 12.5 kb). A 9.5-kb HindIII subfragment from this clone was then subcloned into plasmid pUC8 to form plasmid pUH9. The HindlIl fragment was restriction mapped by Southern blotting various digests with purified gag, LTR, myc, and env probes (data not shown) to derive the restriction map given in Fig. 2. This fragment contains intact 5' LTR, gag, and myc regions, but lacks the 3' part of env and the 3' LTR. We were unable on repeated attempts to obtain a clone containing both 5' and 3' LTRs using a variety of cloning vectors and strategies. The reason for this is not clear but could be the result of either preferential Sau3A digestion within the proviral DNA or the existence of a sequence in the 3' part of the genome which is unstable in lambda. Comparison of the restriction map of the HBI clone with those of other avian retroviruses (such as MC29 and the Prague C strain of Rous sarcoma virus) show that most of the MC29 env gene is present and suggest that the 3' LTR may have been deleted since the clone extends into cellular DNA. Apart from the missing 3' region, the HBI provirus in

NUCLEOTIDE SEQUENCE OF HBI

VOL. 56, 1985

I-

/

/

Hindu

Sp

L

I

o

1

I

I I(

II R Bs

Bg

2

I

GAG

PSp ScSmX P

SI P XbXb

III Bs

LTRI

/

3

4

Si

PPSc

I II(

B

Sp

S

Si

6

7

HindM

P

II B

C

/2

ENV

I

Pv

5 Ki lobases

I

MYC

971

R P

8

9

FIG. 2. Restriction map of the cloned HBI provirus. A schematic representation is shown of the 9.6-kb HindIII fragment from lambda Charon 28 H9 and plasmid pUH9. The cross-hatched region represents cellular DNA; the various viral regions are indicated. Below this is given a map of the various restriction endonuclease sites in the fragment. Abbreviations: Sp, SpHI; Bs, BstEII; Sl, Safl; Bg, BglII; P, PstI; Xb, XbaI; R, EcoRI; Sc, SacI; Sm, SmaI; B, BamHI; X, XhoI; Pv, PvuII; C, Clal.

pUH9 is apparently identical to the HBI genomic provirus in its restriction map. It contains both the novel EcoRI site in the 5' LTR and the PstI site in gag which are not present in MC29 (6, 36). Nucleotide sequence of the HBI clone 3 provirus. We were especially interested in determining the nucleotide sequence of HBI to determine precisely what changes had taken place both in the acquisition of new myc sequence and in the novel LTR and gag regions. It was also hoped that the sequence would indicate the regions of the viral genome responsible for the altered pathogenic spectrum. The sequence of the cloned HBI provirus from the 5' LTR to the beginning of the env gene is shown in Fig. 3. A comparison with the sequence of MC29 (39) reveals eight differences in the myc region and numerous others in the gag and 5' LTR regions. All references in the text to nucleotides at specific positions refer to the numbering given in Fig. 3. HBI contains sequences from c-myc. A comparison of the HBI myc sequence to that of chicken c-myc (54) reveals that four of the nucleotide differences between HBI and MC29 can be accounted for as c-myc-specific changes (nucleotides 2444, 3055, 3154, and 3173). There are four other differences interspersed within this same region, however, which do not correspond to the published c-myc sequence (nucleotides 2448, 2841, 3057, and 3119). These differences possibly could be the result of mutations arising during recombination. However, since most of them result in conservation of the amino acid sequence, it seems more likely that the changes reflect genetic differences between the c-myc gene which recombined into HBI and the one for which we have the sequence. It may be that the c-myc sequences in HBI are derived from quail cells rather than from chicken cells. If this were the case, recombination with c-myc sequences would have had to occur at the very-first step in the isolation of HBI in the original nonproducer quail cell line (Fig. 1). In any case, since some of these mutations are silent, three of the total of five amino acid differences between the HBI and MC29 myc regions correspond to the chicken c-myc sequence (boxed in Fig. 3). Curiously, the c-myc-specific change at nucleotide 3055, which would have altered the codon at the corresponding position to serine, is cancelled out by a second change at nucleotide 3057. Thus, although

the codon usage is different, HBI resembles v-myc in that it has an arginine at this position. The LTR and gag regions in HBI are derived from the helper virus RPV. The number of differences between HBI and MC29 in the 5' LTR and gag regions (Fig. 3) is far too high to be accounted for on the basis of random mutation during propagation of the virus. In addition there are multiple insertions and deletions in the LTR. Some of these differences might be explained by recombination with the helper virus RPV. This seems especially likely because both HBI and RPV have an EcoRI restriction site in their LTRs, whereas MC29 does not. We therefore determined the sequence of the 5' LTR and gag region of RPV and compared it with the HBI sequence (the plasmid clone was kindly provided by W. S. Hayward). A comparison of the RPV and HBI sequences revealed that, with certain exceptions, the two sequences are largely identical up to nucleotide 1818. Beyond this point the HBI sequence corresponds to MC29, so it appears that one recombination point between MC29 and RPV sequences lies in this region, between nucleotides 1818 and 1830. There is one difference in the 5' inverted repeat of the LTR, three in the 5' leader region, and one in the 5' part of the gag region. There is then a 42-base-pair (bp) deletion (in phase) followed by a cluster of 13 other differences near the middle of the gag gene (bracket in Fig. 4). However, since these latter changes all occur within a single confined region, we assume that they reflect polymorphisms among different RPV isolates and not a different origin of the HBI gag sequence. Thus, we conclude that the LTR and gag sequences of HBI are derived from RPV, although probably from a different strain than the one which was cloned and sequenced. A block diagram is given in Fig. 4 which summarizes the differences described above and indicates which regions of HBI correspond to RPV, MC29, and c-myc sequences. There was one difference between HBI and MC29 at the start of env. We did not sequence any further into env, but the restriction map of the HBI env gene corresponds to that of MC29 and not to that of RPV. Because the 5' and 3' LTRs are expected to be the same, there should be a second recombination point between MC29 and RPV sequences somewhere near the end of env. This region has proved to be

J. VIROL.

SMITH ET AL.

972

T TG G* A CA AA G GG T AAC 0CAT. .ACA 'GTAA-'TCTTGCAACATGCTTATGTAACGATGAGTTAGCAACATGCCTTAT AGGAAAGAAAAAGCACCGTGCATGCCGATTGGTGGAAGTAAGGTGGTATGATCIGTGGTATGATCiGTGGT 120 G

12R

U3

Sph I

I TT

T.

T

TG

AT

A G

TA

24 9

ATGATCGTGCCTTATTAGGAAGGCAACAGACGGGTCTAACACGGATTGGACGAACCACTGAATTCCGCATTGCAGAGATATTGTATTTAAGTGCCTAGCTCGATACAATAAACGCCATTT --1 ____ -Eco RI R ---U3 T

C.

.A

C

A A

G

A

.T

A*

C A .C A

360

GACCATITCACCACATTGGTGTGCACCTGGGTTGATGGCCGGACCGTTGATTCCCTGACGACTACGAGCACATGCATGAAGCAGAAGGCTTCATTTGGTGACCCCGACGTGATCGTTAGGG U5

R

.

.Ji

4

MYC

GAG

0-

10

1-5

20

25

30

35

Kilobases

FIG. 4. Block diagram comparing HBI, MC29, and RPV sequiences. The diagram at .the top represents the structure of, the cloned HBI provirus, with each vertical line indicating a specific nucleotide difference between HBI and MC29. Those nucleotide differences which result in amino acid changes are indicated by asterisks; directly above the line are the MC29-specific amino acids; the arrow indicates the correspondin,g HBI-specific amino acid. The lbwer diagram gives a similar comparison of HBI with RPV. Each vertical line indicates a specific difference between these two sequences. The bracket spans a region that includes a 42-bp deletion and a cluster of single base changes which is discussed ih the text. Amino acid changes are not indicated. The regions of HBI which are derived from RPV and c-myc sequences are indicated below the cloned HBI provirus structure.

difficult to clone and is not contained in plasmid pUH9, so we have not determined where this recombination point lies. Although there are 36 nucleotide differences between the gag regions of HBI and MC29, the corresponding proteins are predicted to differ by only seven amino acids. The gag-myc product of HBI is observed to migrate slightly faster than the MC29 protein in sodium dodecyl sulfate-' polyacrylamide gels (apparent molecular size, of 108 and 110 kDa, respectively). This could be due to alterations in either structure or to modification of the gag-myc protein caused by the amino acid changes. Alternatively, but' less likely, it is conceivable that the sequence changes near the start of gag in some way cause translation to'be ihitiated further downstream than usual. Features of the HBI LTR which may affect viral gene expression. A striking feattre of the HBI/RPV LTR is the presence of two places in the U3 region where a tandem triplication of a specific sequence occurs. One of these, at nucleotide 93, actually involves an insertion of two copies of an 11-bp sequence relative to the MC29 LTR. The other, less perfect one (at nucleotide 10), is present also in MC29 but is essentially unrecognizable there owing to a large number of single base differences. The triplication starting at nucleotide 93 involves a sequence that is homologous to the core enhancer sequence of the simian virus 40 72-bp repeat and the murine sarcoma virus LTR (24). The homologous sequence in RSV (present as a single copy) previously has been proposed as an enhancer on the basis of a sequence comparison and in vitro genetic reconstructions (28, 45). The TATA box, 5' cap site, and poly(A) addition site of the HBI/RPV LTR located at nucleotides 204, 234, and 227, respectively, are identical to those of MC29 virus. In the region of the CAT box, however, there are a total of five sequences which show significant homology to the canonical CCAAT sequence (underlined in Fig. 3). Four of these (at nucleotides 143, 156, 171, and 175) include nucleotides that differ between HBI and MC29 such that their homology to

the canonical sequence is improved in the HBI sequence. Finally, there is another repeated sequence in the 5' leader region just before the start of the gag gene which is not present in MC29. The significance of this sequence remains obscure; however, the proximity to the 5' end of gag is

intriguing. The molecular clone of HBI is biologically actitre. We were curious to know if the molecular clone of HBI is biologically active, both because it lacked a 3' LTR and because we intended to use it in constructs betw'een MC29 and HBI to localize the regions of the genome responsible for the change in oncogehiclity. To this enid quail or chicken embryo fibroblasts were transfected with various amounts of purifeA pUH9 DNA. On the following day, cells were either overlayed with soft agar or subcultured and superinfected with helper 'virus (tdB77).'Foci (20/4Lg) appeared in the cultures overlayed with agar after 7 to 10 days and had characteristic MC29-induced morphology changes (i.e., large prominent nuclei and nucleoli). These foci were subsequently picked, grown, and superinfected with the helper tdB77. Supernatants from the superinfected cultures were tested for virus by infecting chicken embryo fibroblast and bone marrow cultures. Transformation was observed in every case, and the titers were as follows. For chicken embryo fibroblasts the titer, was 450 focus-forming units induced by virus rescued from transfected cells with the helper virus tdB77. For chicken bone marrow the titer was 200 macrophage CFU. Preliminary data (not shown) indicate that the rescued virus also induces lymphomas following injection in 1-day-old Brown leghorn chickens. Further studies are in progress to better characterize these tumors. It was important to confirm that the transformation observed in vitro after transfection with plasmid pUH9 was actually due to the cloned HBI provirus. Therefore, transfected chick cells from which virus had been rescued were labeled with [35S]methionine, and the proteins were


VOL. 56, 1985

1

2

3

-p108gag-myc

-Prr76

FIG. 5. Immunoprecipitation of chick cells transfected with plasmid pUH9. Chicken- embryo fibroblasts were transfected with plasmid pUH9 and labeled with [35S]methionine, and labeled proteins were immunoprecipitated with various antisera. Lane 1, preimmune serum; lane 2, rat antiserum against MC29-transformed rat 1 cells; lane 3, same as lane 2 except absorbed to remove gag determinants.

immunoprecipitated with normal rat serum, tumor-bearing rat serum which recognized both mye and gag determinants, or absorbed tumor-bearing rat serum which recognized only determinants. The HBI 108-kDa gag-myc protein indeed can be immunoprecipitated from these cells, indicating that the plasmid clone is biologically active and encodes the expected transforming protein (Fig. 5). myc

DISCUSSION HBI virus differs markedly in pathogenicity from its parent MC29 and therefore provides an attractive model system in which to study factors that influence the specificity of tumor induction by a viral 4gent. In this study we extended the molecular characterization of the virus through cloning and nucleotide sequencing of the proviral genome. The results demonstrate that HBI is a novel recombinant virus, the genome of 'which contains sequences derived from MC29, c-myc, and RPV, the helper virus used in its isolation. The extent of the differences between the HBI and MC29 sequences is quite large, so it is not po'ssible to make a simple correlation of the altered biological properties with any specific genetic changes. Nevertheless, it is possible to make a preliminary assessment of the parts of the sequence that are likely to contribute to the altered pathogenic phenotype. The two regions which

are likely to exert the major effect the myc and 5' LTR regions. The env gene'is not expres;sed in HBI, and, although differences in gag could conceivably affect myc function in the gag-myc fusion protein, such effects have never been described. The myc region. There are five amino acid differences between HBI and MC29 in their encoded myc proteins (Fig. 3 and 4). Three of these differences correspond to the chicken c-myc sequence; the other two do not (nor do they correspond to differences in any other publis4ed avian myc sequences [1, 21]). Of all these amino acids, two (arginine and glutamine at nucleotides 2443 and 2839, respectively)

are

975

differ substantially in chemical properties from the corresponding amino acids in MC29 myc (glutamine and histidine, respectively). One (glycine at nucleotide 3118) differs moderately (valine in MC29 myc), and two (isoleucine and arginine at nucleotides 3154 and 3172, respectively) differ only slightly from MC29 myc' (leucine and lysine, respectively). Could these changes affect the tissue specificity of HBI? On the surface one line of evidence appears to lend support to such an idea. In cases in which an endogenous c-myc gene has been activated, one finds a predominance of lymphoid tumors (for a review, see reference 41). However, it is not clear whether activation of c-myc has a particularly potent effect on lymphoid cells, among different cell types, or whether the activation process itself is especially favored in lymphoid cells. Clearly, in Burkitt'-s lymphomas, the latter is likely to be the case since the chromosomal rearrangements show features in common with immunoglobulin gene rearrangements. In the case of insertional activation of chicken c-myc in lymphoid tumors by avian leukosis virus it is less clear. The virus is known to have a relatively broad cell specificity, but it is not known whether c-myc activation occurs in cells other than those in which the tumors develop. We therefore cannot say whether the incorporation of c-myc information, by itself, would be sufficient to shift the spectrum of HBI toward lymphoid cells. There is some theoretical basis, however, on which to expect such changes to be effective. The myc protein has been proposed to play a role in the regulation of genes involved in cell proliferation on the basis of a number of its properties, including localization in the nuclear matrix (14), homology with adenovirus ElA protein (35), DNA-binding activity (9, 13), and response to mitogenic stimuli (10, 24). If this is correct, and the regulation has some degree of specificity, then it would be quite conceivable for amino acid changes such as those enumerated above to alter the specificity of the interaction in different cell types. The 5' LTR. The second region of HBI which could be responsible for the altered target cell specificity is the 5' LTR. The HBI LTR is essentially identical to that df the RPV helper virus and differs considerably from the MC29 LTR which has, among other things, a triplicate enhancerlike sequence. These differences suggest that RNA transcription from the HBI genome should proceed at a significaptly higher rate than from the MC29 genome. One of the reasons that RPV is used as a helper is that it produces higher titer virus stocks, which would be consistent with this idea. In addition, it has been observed that higher.gag-myc protein levels seem to be produced in HBI- than in MC29-containing cells (K. Moelling, personal communication). There is' now a considerable amount of evidence which supports the conclusion that LTR sequences may play a role in determnining the tissue specificity of RNA tumor viruses. Lenz et al. (26) have examined the leukemogenic murine retrovirus SL3-3 and have shown that the determinants responsible for the leukemogenicity of this virus lie within the LTR, or, more precisely, in an enhancer-like element in the LTR. They postulate that the enhancer element permits efficient transcription and replication of the virus during infection of the target tissue. In addition, the erythroid and lymphoid nature of t-umors induced by Friend and Moloney leukemia viruses, roespectively, is thought to be determined by viral LTR sequences (11). Finally, it appears that tissue specificity can be a property of both cellular and viral enhancer elements (for a review, see reference 8). Thus it is

976

J. VIROL.

SMITH ET AL.

conceivable, in light of the differences compared with MC29, that the HBI LTR could have a significant effect on the target cell specificity of the virus. Two pieces of evidence, however, complicate this conclusion. First, HBI replicates in and transforms macrophages very efficiently in vitro, implying that the lymphoid specificity seen in vivo may reflect more than just the cell specificity of the virus. Second, it has been shown recently that RPV gives rise to lung tumors in chickens, with very few lymphoid tumors (48). Hence, the presence of the RPV LTR alone is not likely to be sufficient to confer the lymphoid-specific phenotype seen in HBI. It may be that both the novel myc gene and the LTR are required to produce the pathogenic properties of HBI. Having cloned and sequenced HBI, we are now in a position to directly test the contribution of these various novel regions to the altered pathogenic spectrum of the virus. ACKNOWLEDGMENTS We thank W. S. Hayward for supplying the RPV molecular clone used in this study and J. A. Wyke for comments on the manuscript. The secretarial assistance of Joyce Newton and Andrea Sterlini are gratefully acknowledged. LITERATURE CITED 1. Alitalo, K., J. M. Bishop, D. H. Smith, E. Y. Chen, W. W. Colby, and A. D. Levinson. 1983. Nucleotide sequence of the v-myc oncogene of the avian retrovirus MC29. Proc. Natl. Acad. Sci. USA 80:100-104. 2. Alitalo, K., M. Schwab, C. C. Lin, H. E. Varmus, and J. M. Bishop. 1983. Homogeneously staining chromosomal regions contain amplified copies of an abundantly expressed cellular oncogene (c-myc) in malignant neuro-endocrine cells from a human colon carcinoma. Proc. Natl. Acad. Sci. USA 80: 1707-1711. 3. Beug, H., A. von Kirchbach, G. Doderlein, J. F. Conscience, and T. Graf. 1979. Chicken hematopoietic cells transformed by seven strains of defective avian leukaemia viruses display three distinct phenotypes of differentiation. Cell 18:375-390. 4. Biggin, M. D., T. J. Gibson, and C. F. IHong. 1983. Buffer gradient gels and 35S label as an aid to rapid DNA sequence determination. Proc. Natl. Acad. Sci. USA 80:3963-3965. 5. Bister, K., M. J. Hayman, and P. K. Vogt. 1977. Defectiveness of avian myelocytomatosis virus MC29: isolation of long term nonproducer cultures and analysis of virus-specific polypeptide synthesis. Virology 82:431-448. 6. Bister, K., H. W. Jansen, T. Graf, P. J. Enrietto, and M. J. Hayman. 1983. Genome structure of HBI, a variant of acute leukemia virus MC29 with unique oncogenic properties. J. Virol. 46:337-346. 7. Bister, K., G. M. Ramsay, and M. J. Hayman. 1982. Deletions within the transformation-specific RNA sequences of acute leukemia virus MC29 give rise to partially transformationdefective mutants. J. Virol. 41:754-766. 8. Boss, M. A. 1983. Enhancer elements in immunoglobulin genes. Nature (London) 303:281-282. 9. Bunte, T., I. Greiser-Wilke, P. Donner, and K. Moelling. 1982. Association of gag-myc proteins from avian myelocytomatosis virus wild-type and mutants with chromatin. EMBO J. 1:919-927. 10. Campisi, J., H. E. Gray, A. B. Pardee, M. Dean, and C. E. Sonenshein. 1984. Cell cycle control of c-myc but not c-ras is lost following chemical transformation. Cell 36:241-247. 11. Chatis, P. A., C. A. Holland, J. W. Hartley, W. P. Rowe, and N. Hopkins. 1983. Role for the 3' end of the genome in determining disease specificity of Friend and Moloney murine leukemia viruses. Proc. Natl. Acad. Sci. USA 80:4408-4411. 12. Collins, S., and M. Groudine. 1982. Amplification of endogenous myc-related sequences in a human myeloid leukemia cell line. Nature (London) 298:679-681.

13. Donner, P., W. I. Greiser, and K. Moelling. 1982. Nuclear localization and DNA binding of the transforming gene product of avian myelocytomatosis virus. Nature (London) 296:262-266. 14. Eisenman, R. N., C. Y. Tachibana, H. D. Abrams, and S. R. Hann. 1984. V-myc and c-myc-encoded proteins are associated with the nuclear matrix. Mol. Cell. Biol. 5:114-126. 15. Enrietto, P. J., and M. J. Hayman. 1982. Restriction enzyme analysis of partially transformation defective mutants of acute leukemia virus MC29. J. Virol. 44:711-715. 16. Enrietto, P. J., M. J. Hayman, G. M. Ramsay, J. A. Wyke, and L. N. Payne. 1983. Altered pathogenicity of avian myelocytomatosis (MC29) viruses with mutations in the v-myc gene. Virology 124:164-172. 17. Enrietto, P. J., L. N. Payne, and M. J. Hayman. 1983. A recovered avian myelocytomatosis virus which induces lymphomas in chickens: pathogenic properties and their rmolecular basis. Cell 35:369-379. 18. Graf, T., and H. Beug. 1978. Avian leukemia viruses. Interaction with their target cells in vivo and in vitro. Biochim. Biophys. Acta 516:269-299. 19. Hayward, W. S., B. C. Neel, and S. M. Astrin. 1981. Activation of a cellular onc gene by promoter insertion in ALV-induced lymphoid leukosis. Nature (London) 290:475-480. 20. Ivanov, K., Z. Mladenov, S. Nedyalkov, T. C. Todorov, and M. Yakimov. 1964. Experimental investigations into avian leucosis. V. Transmission, haematology and morphology of avian myelocytomatosis. Bull. Inst. Pathol. Comp. Anim. Acad. Bulg. Sci. 10:5-38. 21. Kan, N. C., C. S. Flordellis, C. E. Mark, P. H. Duesberg, and T. S. Papas. 1984. Nucleotide sequences of avian carcinoma virus MH2: two potential onc genes, one related to avian virus MC29 and the other related to murine sarcoma virus 3611. Proc. Natl. Acad. Sci. USA 81:3000-3004. 22. Kelly, K., B. H. Cochran, C. D. Stiles, and P. Leder. 1983. Cell specific regulation of the c-myc gene by lymphocyte mitogens and platelet-derived growth factor. Cell 35:603-610. 23. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London)

227:680-685.

24. Laimins, L. A., G. Khoury, C. Gorman, B. Howard, and P. Gruss. 1982. Host-specific activation of transcription by tandem repeats from simian virus 40 and Moloney murine sarcoma virus. Proc. Natl. Acad. Sci. USA 79:6453-6457. 25. Lautenberger, T. A., R. A. Sehultz, C. F. Garon, P. Tsichlis, and T. S. Papas. 1981. Molecular cloning of avian myelocytomatosis virus (MC29) transforming sequences. Proc. Natl. Acad. Sci. USA 78:1518-1522. 26. Lenz, J., D. Celander, R. L. Crowther, R. Patasca, D. W. Perkins, and W. Haseltine. 1984. Determination of the leukemogenicity of a murine retrovirus by sequences within the long terminal repeat. Nature (London) 308:467-470. 27. Little, C., M. Nau, D. Cainey, A. Gazdar, and J. Minna. 1983. Amplification and expression of the c-myc oncogene in human lung cancer cell lines. Nature (London) 306:194-196. 28. Luciw, P. A., J. M. Bishop, H. E. Varmus, and M. R. Capecchi. 1983. Location and function of retroviral and SV40 sequences that enhance biochemical transformation after microinjection of DNA. Cell 33:705-716. 29. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1981. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 30. Mellon, P., A. Pawson, K. Bister, G. S. Martin, and P. H. Duesberg. 1978. Specific RNA sequences and gene products of MC29 avian acute leukemia virus. Proc. Natl. Acad. Sci. USA 75:5874-5878. 31. Mladenov, Z., U. Heine, D. Beard, and J. W. Beard. 1967. Strain MC29 avian leukosis, myelocytoma, endothelioma and renal growths. Patho-morphological and ultrastructural aspects. J. Natl. Cancer Inst. 38:251-285. 32. Neel, B. C., W. S. Hayward, H. L. Robinson, J. M. Fang, and S. M. Astrin. 1981. Avian leukosis virus-induced tumors have common proviral integration sites and synthesize discrete new RNAs: oncogenesis by promoter insertion. Cell 23:323-334.

VOL. 56, 1985 33. Payne, G. S., S. A. Courtneidge, L. B. Crittenden, A. M. Fadley, J. M. Bishop, and H. E. Varmus. 1981. Analysis of avian leukosis virus DNA and RNA in bursal tumors: viral gene expression is not required for maintenance of the tumor state. Cell 23:311-322. 34. Quade, K., S. Saule, D. Stehelin, G. Kitchener, and M. J. Hayman. 1983. Virus gene expression in rat cells transformed by avian myelocytomatosis virus strain MC29 and avian erythroblastosis virus. J. Gen. Virol. 64:83-94. 35. Ralston, R., and J. M. Bishop. 1983. The protein products of the myc and myb oncogenes and adenovirus-ElA are structurally related. Nature (London) 306:803-806. 36. Ramsay, G. M., P. J. Enrietto, T. Graf, and M. J. Hayman. 1982. Recovery of myc-specific sequences by a partially transformation defective mutant of avian myelocytomatosis virus, MC29, correlates with the restoration of transforming activity. Proc. Natl. Acad. Sci. USA 79:6885-6889. 37. Ramsay, G. M., T. Graf, and M. J. Hayman. 1980. Mutants of avian myelocytomatosis virus MC29 with smaller gag gene related proteins have an altered transforming ability. Nature (London) 288:170-172. 38. Ramsay, G. M., and M. J. Hayman. 1982. Isolation and biochemical characterization of partially transformation-defective mutants of avian myelocytomatosis virus strain MC29: localization of the mutation to the myc domain of the 110,000-dalton gag-myc polyprotein. J. Virol. 41:745-753. 39. Reddy, E. P., R. K. Reynolds, D. K. Watson, R. A. Schultz, J. Lautenberger, and T. S. Papas. 1983. Nucleotide sequence analysis of the proviral genome of avian myelocytomatosis virus (MC29). Proc. Natl. Acad. Sci. USA 80:2500-2504. 40. Rimm, D., D. Horness, J. Kucera, and F. R. Blattner. 1980. Construction of coliphage lambda Charon vectors with Bam HI cloning sites. Gene 12:301-309. 41. Robertson, M. 1983. Paradox and paradigm: the message and meaning of myc. Nature (London) 306:733-736. 42. Roussel, M., S. Saule, C. Lagrou, C. Rommens, H. Beug, T. Graf, and D. Stehelin. 1979. Three new types of viral oncogene of cellular origin specific for hematopoietic cell transformation. Nature (London) 281:452-455.


977

43. Royer-Pokora, B., H. Beug, M. Claviez, H.-J. Winkhardt, R. R. Friis, and T. Graf. 1978. Transformation parameters in chicken fibroblasts transformed by AEV and MC29 in avian leukemia viruses. Cell 13:751-760. 44. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 45. Schwartz, D. E., R. Tizard, and W. Gilbert. 1983. Nucleotide sequence of Rous sarcoma virus. Cell 32:853-869. 46. Sheiness, D. L., L. Fanshier, and J. M. Bishop. 1978. Identification of nucleotide sequences which may encode the oncogenic capacity of avian retrovirus MC29. J. Virol. 28:600-610. 47. Shibuya, M., J. Yokota, and V. Ueyama. 1985. Amplification and expression of a cellular oncogene (c-myc) in human gastric adenocarcinoma cells. Mol. Cell Biol. 5:414-418. 48. Simon, M. C., R. E. Smith, and W. S. Hayward. 1984. Mechanisms of oncogenesis by subgroup F avian leukosis viruses. J. Virol. 52:1-8. 49. Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503-517. 50. Stow, N. D., and N. W. Wilkie. 1976. An improved technique for obtaining enhanced infectivity with herpes simplex virus type 1 DNA. J. Gen. Virol. 33:447-453. 51. Vennstrom, B., C. Moscovici, H. M. Goodman, and J. M. Bishop. 1981. Molecular cloning of avian myelocytomatosis virus genome and recovery of infectious virus by transfection of chicken cells. J. Virol. 39:625-631. 52. Viera, J., and J. Messing. 1982. The pUC plasmids, an M13 mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers. Gene 19:259-268. 53. Vogt, P. K. 1969. Fundamental techniques in virology, p. 198. K. Habel and N. P. Salzman (eds.). Academic Press, Inc., New York. 54. Watson, D. K., E. P. Reddy, P. H. Duesberg, and T. S. Papas. 1983. Nucleotide sequence analysis of the chicken c-myc locus reveals homologous and unique coding regions by comparison with the transforming gene of avian myelocytomatosis virus MC29, gag-myc. Proc. Natl. Acad. Sci. USA 80:2146-2150.