of Infected HeLa Cells and Human Lymphoid Cells - Europe PMC

JOURNAL OF VIROLOGY, Dec. 1991, p. 7041-7045

Vol. 65, No. 12

0022-538X/91/127041-05$02.00/0 Copyright X 1991, American Society for Microbiology

Rapid Accumulation of Measles Virus Leader RNA in the Nucleus of Infected HeLa Cells and Human Lymphoid Cells JASODHARA RAY,1 J. LINDSAY

WHITTON,2 AND ROBERT S.

FUJINAMI3*

Department of Neurosciences, University of California, San Diego, La Jolla, California 92093'; Department of Neuropharmacology, Division of Virology, Research Institute of Scripps Clinic, La Jolla, California 920372; and Department of Neurology, University of Utah School of Medicine, Salt Lake City, Utah 841323 Received 24 June 1991/Accepted 10 September 1991

The 3' terminus of the single-stranded, negative-sense genome of the measles virus comprises a 55-nucleotidelong sequence, which is transcribed into a short, positive-sense RNA called the leader sequence. In other viral systems, this RNA has been shown to modulate host cell transcription. Here, we report the presence of measles virus leader RNA in both cytoplasmic and nuclear fractions of infected HeLa cells as well as T- and B-lymphoid cells. A sharp and rapid increase in the concentration of leader RNA in the nucleus of infected HeLa cells was also observed. The presence and accumulation of leader RNA in the nucleus of infected cells supports the hypothesis that the leader RNA plays a role in the down regulation of host cell transcription and may be responsible for the suppression of immunoglobulin synthesis by measles virus-infected B cells. Such alterations in immune responsiveness could aid in the establishment of a persistent infection by measles virus.

Measles virus, a member of the Paramyxoviridae family, has a nonsegmented negative-sense RNA genome. During infection, complementary copies of the entire genome, the antigenome, are synthesized. The antigenome serves as an intermediate for viral genome replication. Transcription of measles virus genes by the viral polymerase occurs in the 3'-to-5' direction of the genome template in the following order: nucleoprotein (NP); phosphoprotein (P); two nonstructural proteins, C and V; fusion protein (F), hemagglutinin (HA); and the large protein (L) (3, 4, 22, 24). A short noncoding sequence of 55 nucleotides (nt) long, termed leader, precedes the NP gene at the 3' end of the genome (4, 9, 23). This genome arrangement is similar to other negativestrand viruses such as vesicular stomatitis virus (VSV), Sendai virus, and Newcastle disease virus (1, 2, 7, 25, 26). From extensive in vivo and in vitro studies with the prototype negative-strand virus, VSV, a model has been proposed where transcription initiates not only at the 3' end of the genome but also at intergeneric junctions (1, 29). The initiation of transcription at any gene requires the synthesis of the preceding gene (29). This observation has led to an alternate model in which a start-stop mechanism is suggested; in this model, transcription starts solely at the 3' end of the genome and proceeds toward the 5' end, terminating and then reinitiating at intergeneric junctions (29). Prior synthesis of the leader RNA is required for mRNA transcription. Thus far, a free leader RNA species has been detected in cells infected with VSV, Sendai virus, and Newcastle disease virus (14-16). In the VSV model, not only does viral polymerase synthesize monocistronic mRNAs from different cistrons, but a distinct, free, 47-nt-long RNA species called the plus-sense leader RNA is detected (8). Newcastle disease virus and Sendai virus also synthesize free plus-strand leader RNAs (15, 16). These distinct leader RNAs have been proposed to be involved in the inhibition of host cell transcription observed in infected cells (8, 11, 20, 31). In contrast to these viruses in which free leader RNAs have been detected, repeated attempts to detect a free leader *

RNA for measles virus have not been successful (4, 5, 9, 12). During infection, measles virus synthesizes not only the full-length antigenomic RNA, but also mono- and bicistronic mRNAs (3, 4, 22, 23). Castaneda and Wong (5) reported that mono- and bicistronic mRNAs were synthesized with or without a leader sequence, while the antigenomic RNA always contained a leader sequence. This observation has led these authors to suggest that measles virus uses an RNA transcription mechanism different from that of these other viruses. Accordingly, viral transcription for mRNA initiates not only at nt 1 but also begins at nt 56. Synthesis that initiates at nt 1 produces antigenomic RNAs as well as mono- and bicistronic leader-containing mRNAs. When the initiation of transcription occurs at nt 56, leaderless monoand bicistronic mRNAs are synthesized. Recently, Castaneda and Wong (6) reported that functionally, the leaderless and leader-containing RNAs were distinct. Leaderless mono- and bicistronic RNAs were associated with ribosomes and functioned as mRNAs, whereas leader-containing mono- and bicistronic RNAs were detected in nonribosomal ribonucleoprotein complexes. Measles virus leader-containing RNA has been detected in total RNA and in poly(A)+ RNA isolated from infected CV-1 cells (5). Northern (RNA) blot hybridization using a probe complementary to the NP leader showed a low but constant amount of leader-containing RNA as early as 4 h postinfection (5). Leader-containing RNA was also detected in total RNA isolated from measles virus-infected HeLa cells displaying 80 to 100% cell involvement; however, a time course for the accumulation of leader RNA was not performed (5). In most instances, measles virus infection of humans results in an acute respiratory tract infection with characteristic rash. The virus is gradually cleared from the body as an antiviral immune response is mounted. On rare occasions, measles virus can persist in central nervous system and lymphoid tissues and cause a severe condition, known as subacute sclerosing panencephalitis. Virus is able to persist despite the presence of high-titer antibody and competent immune cells (27, 28). Another feature of measles virus infection is a frequent yet transient suppression (von Pirquet phenomenon) of both humoral and cell-mediated immunity

Corresponding author. 7041

7042

NOTES

(30). McChesney et al. (18, 19) reported that the suppression of immunoglobulin secretion after measles virus infection was due to the infection of B lymphocytes. These B cells were inhibited from undergoing proliferation and differentiation into immunoglobulin-secreting cells. Measles virusinfected B lymphocytes were arrested at the G1 phase of the cell cycle (19). While measles virus can infect other lymphoid cells, infection of T lymphocytes and monocytes had no effect since these cells could still provide help and accessory function needed for B cells to differentiate and secrete immunoglobulin. In contrast, the proliferation of T lymphocytes was markedly suppressed (19). These data indicate that one of the contributing factors for the immunosuppression caused by measles virus is cell cycle arrest of B lymphocytes in G1 which does not allow these cells to further differentiate. We hypothesize that both the establishment of persistent virus infection and the immune suppression described above may be related to the inhibition or modulation of host cell transcription by measles virus leader RNA in a manner analogous to that described for other paramyxoviruses and VSV. As a first step toward testing this hypothesis, we wished to determine the distribution of leader RNA in cytoplasmic and nuclear fractions of HeLa cells as well as Tand B-lymphoblastoid cells during the course of infection. A viral stock of the Edmonston strain of measles virus was grown in Vero cells (10). This high-titer stock was then used to infect HeLa, Jurkat, Molt-4, Raji, and Daudi cells. Jurkat and Molt-4 cells are of T-lymphocyte origin, and Raji and Daudi are of B-lymphocyte lineage (13, 21). Cells were infected with measles virus at a multiplicity of infection of 2 to 3 PFU per cell. Infected cells were washed once by centrifugation and cutured in 75-mm flasks (Costar, Cambridge, Mass.). For the zero time point, the cells were collected after a 2-h adsorption period. At the prescribed time points after infection, HeLa cells were washed three times with phosphate-buffered saline and RNA extracted (14). Jurkat, Molt-4, Raji, and Daudi cells were infected with measles virus in a similar fashion, but RNA was collected 24 h postinfection. Cells were fractionated into cytoplasmic and nuclear fractions, and the RNA was isolated by the method of Kurilla et al. (14). The cells (1 x 107 to 5 x 107/ml) were suspended in buffer A (10 mM Tris-HCl, pH 7.4, 10 mM NaCl, 1.5 mM MgCl2), incubated on ice for 5 min, and then lysed by the addition of Nonidet P-40 to a final concentration of 0.5%. After centrifugation at 1,000 x g, the cytoplasmic fraction (supematant fluid) and nuclei (pellet) were separated. The pelleted nuclei were resuspended in buffer A and a detergent solution (6.6% Nonidet P-40-3.3% sodium dodecyl sulfate (SDS) at a ratio of 0.15:1 [vol:vol]). After removing the nuclear membrane by vortexing (5 to 10 s), the residual nuclei were collected by centrifugation at 1,000 x g and lysed in buffer B (10 mM Tris-HCl, pH 7.4, 500 mM NaCl, 5 mM MgCl2, 0.1 mM CaCl2) by vortexing. The cytoplasmic fractions were treated with proteinase K (50 jig/ml; Bethesda Research Laboratories, Inc., Gaithersburg, Md.) for 20 min at 37°C after the addition of EDTA and SDS to final concentrations of 2 mM and 0.1%, respectively. The nuclear fractions were first treated with DNase I (50 ,ug/ml, RNase free; Boehringer Mannheim, Indianapolis, Ind.) for 10 min at 37°C and then with proteinase K as previously described for the cytoplasmic fractions. After phenol:CHCl3 (1:1) extraction, the RNAs from both cytoplasmic and nuclear fractions were precipitated with ethanol. Following centrifugation, the pelleted RNA was dis-

J. VIROL.

solved in sterile water and the concentration was determined by reading the optical density at 260 nm. Two complementary 56-nt sequences, 5'-ACCAAACAA AGTTGGGTAAGGATAGTTCAAATCAATGATCAT CTTCTAGTGCACTT-3' (Li) and 5'-AAGTGCACTAGAA GATGATCATTGATTTGAACTATCCTTACCCAACT TTGTTTGGT-3' (L2) (4), containing the positive-sense (antigenomic) leader sequence (L1) or its negative sense (genomic) complement (L2) were synthesized by an Applied Biosystems DNA synthesizer. Following hybridization, the duplex oligonucleotide was cloned into the pSP65 vector (Promega Biotec, Madison, Wis.) in an orientation which allowed the SP6 polymerase to transcribe an RNA equivalent to L2 (i.e., this RNA is complementary to leader RNA). The resultant plasmid, pML2, was sequenced to confirm its identity. The plasmid, pML2, was linearized with HindIll, and a genomic-sense riboprobe, L2, was transcribed in vitro by the SP6 polymerase in the presence of [32P]UTP by using standard methods (17). The L2 riboprobe was 124 bases long, comprising the L2 sequence flanked by additional plasmid sequences. After digestion of the DNA template with RNase-free DNase I (Boehringer Mannheim), the labeled riboprobe was separated from unincorporated nucleotides by spin column filtration (17). The resulting riboprobe was phenol-CHCl3 (1:1) extracted and precipitated with ethanol. After centrifugation, the riboprobe was dissolved in sterile water and an aliquot was counted in a scintillation counter. RNase protection assays were conducted as described by Kurilla et al. (14). Equal amounts of cytoplasmic or nuclear RNA (20 j,g) in 100 ,ul of 10 mM Tris-HCI (pH 7.4) were mixed with approximately 5 x 104 cpm of L2 riboprobe, boiled for 2 min, and immediately chilled on ice. After the addition of 15 jil of 3 M NaCl, the mixtures were hybridized at 65°C overnight. After hybridization, the mixtures were treated with 0.5 ,ug of RNase A and 1 U of RNase T1 for 30 min at 37°C. The samples were treated with proteinase K (10 jig per sample) for 15 min at 37°C. The RNAs were phenol: CHC13 (1:1) extracted and then ethanol precipitated after the addition of 10 jig of tRNA (Sigma Chemical Co., St. Louis, Mo.). RNA duplexes were analyzed on 10% polyacrylamide gels followed by autoradiography. The genomic-sense riboprobe, L2, was used to detect the presence of leader RNA in infected cells. To determine whether this probe could hybridize and protect complementary sequences from RNase digestion, the L2 probe was hybridized with the oligonucleotide Li (a DNA equivalent of leader RNA) and treated with RNase. The data presented in Fig. 1A demonstrated that the resulting duplex was resistant to RNase A and RNase T1 treatment. This duplex band served as a size marker for the hybrid produced with in vivo synthesized leader RNA. This experiment also indicated that the L2 probe alone as expected migrated faster than the Li and L2 DNA:RNA duplex. When the L2 probe alone was treated under similar conditions, it was totally degraded, as expected for a single-stranded RNA (Fig. 1A). After hybridization with the probe (L2) and RNase treatment, the RNA isolated from either the cytoplasmic and nuclear fractions yielded one 56-bp band (Fig. 1B). Occasionally, a higher migrating band (Fig. 1B) was observed which disappeared after treatment with increasing amounts of RNase A and RNase T1. This band appeared to be a product of incomplete or imprecise nuclease digestion. Interestingly, Kurilla et al. (14) reported the presence of two short RNA duplexes by hybridization with 3'-end-labeled

VOL. 65, 1991

NOTES

TABLE 1. Increase of leader-containing RNA in measles virusinfected HeLa cells

Ll+L2+ L2+ L2 RNase FRNase Probe

A

RNA source and time postinfection (h)

Cytoplasmic 0 8

.........................................................

.........................................................

56 bp f