Oncogene-targeted antisense oligonucleotides for the ... - CiteSeerX

Review Oncologic, Endocrine & Metabolic

Oncogene-targeted antisense oligonucleotides for the treatment of Ewing sarcoma

1. Introduction 2. Downregulation of EWS/Fli-1 3. Downregulation of genes involved in the maintenance of the Ewing sarcoma cells phenotype 4. Expert opinion

Andrei Maksimenko & Claude Malvy†

†CNRS UMR 8121, Institut Gustave Roussy PR2, 39 rue Camille Desmoulins, 94805 Villejuif Cedex,

France

The genetic hallmark of the Ewing sarcoma family of tumours (ESFT) is the presence of the t(11;22)(q24;q12) translocation, present in up to 85% of cases of ESFT, which creates the EWS/FLI1 fusion gene and results in the expression of a chimeric protein regulating many other genes. The inhibition of this protein by antisense strategies has shown its predominant role in the transformed phenotype of Ewing cells. In addition, the junction point at the mRNA level offers a target for short therapeutic nucleic acids which is present only in the cancer cells and not in the normal tissues of a patient. Several teams have, therefore, investigated the activity of antisense oligonucleotides and siRNAs targeted against the junction point in mRNA, therefore inhibiting EWS/FLI1 synthesis. Generally speaking the molecules induce a cell growth inhibition in culture. Apoptosis has also been reported. One laboratory has reported the in vivo tumour inhibitory effect of phosphorothioate antisense oligonucleotide directed against the EWS part of EWS/FlI1 when injected intratumourally. Independently, a tumour inhibitory effect of oligonucleotides targeting the junction point has been demonstrated provided they are delivered by polymeric nanoparticles through the intratumoural route. Alongside this target, other genes participating to the maintenance of the transformed phenotype of Ewing cells have been downregulated by antisense strategies. Keywords: antisense oligonucleotide, Ewing sarcoma, EWS/FlI1, siRNA Expert Opin. Ther. Targets (2005) 9(4):xxx-xxx

1. Introduction

Ashley Publications www.ashley-pub.com

Cancers with chromosomal translocations are considered to represent around 10% of cancers. These rearrangements originate from two chromosomes and create a fusion gene in one of these chromosomes. Genomic rearrangements leading to intragenic gene fusion are found in particular types of haematopoietic malignancies and sarcomas. A number of fusion genes resulting from chromosomal translocations has already been defined. These chimeric genes frequently encode aberrant transcription factors which are responsible for cellular transformation and in consequence for oncogenesis. This fusion gene represents a very attractive target for therapeutic approaches because it is present only in the cancer and not in normal tissues. Cancer therapies are indeed often very toxic because the targets are also present in normal cells even if they are either different in sequence (mutated oncogenes in tumours) or expressed at a different level. The Ewing sarcoma family of tumours (ESFT) belongs to this type of translocation-induced cancers. It was first described nearly 80 years ago and includes classic Ewing sarcoma of bone, extra osseous or soft tissue Ewing sarcoma, Askin tumours of the chest wall, and peripheral primitive neuroectodermal tumours of bone or soft 10.1517/14728222.9.4.xxx © 2005 Ashley Publications Ltd ISSN 1472-8222

1


tissues. Ewing’s sarcoma is the second most common type of bone cancer [1]. It is frequently found in the flat bones, such as the pelvis and ribs, as well as the bones of the arms and legs. It commonly spreads to bones, lungs and bone marrow. Ewing tumours represent the second most common primary malignant bone tumour in childhood and adolescence; the annual incidence rate in children (< 15 years) was estimated as 3 per 1 million in Caucasians, with a male preponderance of 1.5/1 [2,3]. Incidence rates in adults are less well documented; an annual incidence of 2.4 cases per 1 million for patients aged between 15 and 24 years was reported for the north of England [4]. The median age at presentation is between 10 and 20 years, accounting for > 50% of cases. There are no known associated diseases and the aetiology is unknown [5]. The genetic hallmark of ESFT is the presence of the t(11;22)(q24;q12), present in up to 85% of cases of ESFT, which creates the EWS/FLI1 fusion gene and results in the expression of a chimeric protein. EWS/ERG transcripts are also found. Many alternative forms of EWS/FLI1 exist because of variations in the locations of the EWS and FLI1 genomic breakpoints. The most common form (∼ 60% of cases) [1], ‘Type 1’, consists of the first 7 exons of EWS jointed to exons 6 – 9 of FLI1. The ‘Type 2’ EWS/FLI1 fusion also includes FLI1 exon 5 and is present in another 25%. Other junctions have been described. Two publications can be read to have a clear idea of the structure [1] and the frequency [33] of the various types of junctions. The EWS/FLI1 protein is an aberrant transcription factor which has been shown by different authors to regulate various genes. In a recent study [6] it has been shown that when EWS/FI1 is specifically inhibited by an siRNA (short interfering RNA) in Ewing A673 cells, 80 genes were found up and downregulated, respectively, at least 2-fold. The EWS/ FlI1 protein is widely considered as the main cause of Ewing sarcoma. Inhibition of this protein activity, therefore, is very attractive for a therapeutic prospect. Several reports indeed indicate that inhibition of the synthesis of the EWS/FlI1 protein leads to a reduction of cell growth [6-9] and to apoptosis [6,10]. The nucleic sequence of the junction is present only in the mRNA of tumour cells. It is, therefore, an extremely attractive target for a selective therapy of Ewing sarcoma. To the knowledge of the authors’ no attempts have been made to target the fusion gene at the DNA level, but antisense strategies allow for inhibition of EWS/FI1 at the RNA level. The aim of this article is to review the results obtained with short oligonucleotides, either antisense oligonucleotides or siRNAs. These oligonucleotides can be designed to downregulate either EWS/Fli-1 or other genes involved in the maintenance of Ewing cells phenotype. Many clinical trials are going on in various types of diseases with antisense oligonucleotides and some clinical studies have recently been initiated using siRNAs. Ewing sarcoma, although a rare disease, is an aggressive cancer. Taking into account that the putative rate limiting cause of this disease 2

can be very specifically inhibited by antisense strategies, one might consider that patients should benefit from the antisense approach at the therapeutic level. Antisense oligonucleotides (ASO) belong to two categories according to their chemical modifications. The first type [29], such as phosphorothioate ASO, works by inducing the mRNA cleavage in a sequence-specific manner either at the level of the primary RNA transcript (before splicing) or at the mRNA level. For most ASOs, the prevailing mechanism of action at either the primary RNA transcript or at the mRNA level is not known. The target cleavage is obtained through the action of RNAase H enzymes which are ubiquitously expressed in all cells. After cleavage, the ASO is still available to target other RNA molecules. The second type, such as morpholino ASO [11,12], works by inhibiting translation. However, the lifetime in cells of ASOs is limited, mainly due to the action of 3’ DNA exonucleases. The siRNAs are double-stranded RNA oligonucleotides with a full duplex of 19 bases and 2 bases overhang at the 3’ termini. They induce the sequence-specific cleavage of mRNA in the cytoplasm by directing the RNA-induced cleavage complex (RISC) to the complementary sequence on the target RNA. siRNAs, such as ASO, can be chemically modified to improve their resistance to degradation. siRNAs can also be synthetised directly in the cell after maturation of shRNAs (small hairpin RNAs) which are expressed from a plasmid under the control of an RNA polymerase II or III promoter. Artificial shRNAs have a structure which looks like the natural miRNAs (micro RNAs), which have been shown to inhibit translation and to play an important role in the embryonary development. Maturation of shRNAs can produce siRNAs (which degrade the target mRNA) or miRNAs (which does not degrade the target mRNA). There are many reviews on RNA interference (see [14,15] for reviews on siRNA, shRNA and miRNA). 2. Downregulation 2.1 Results

of EWS/Fli-1

obtained with antisense oligonucleotides The two initial reports using antisense oligonucleotides appeared in 1997. They were by Tanaka et al. [7] on various Ewing cell lines in culture and on SK-N-MC cells in vivo and by Toretsky et al. [8] in Ewing TC32 cells. Both reports deal with oligonucleotides targeting an EWS/Fli-1 RNA having a Type 1 fusion junction. In the Tanaka report, the oligonucleotides were phosphorothiates. They were added to the cells without transfection agent. The concentrations used were, therefore, in the µmolar range. One oligonucleotide targeting the junction sequence was efficient to inhibit the growth of SK-N-MC cells in-vitro. However, the oligonucleotides used for the other cell lines as well as in vivo for SK-NM-C grafted cells, were targeted against the EWS moiety. As a consequence, there was both inhibition of EWS and EWS/FlI1 proteins. Accordingly, they describe a tumour growth inhibition with the ASO alone after 5 injections in the tumour at a total dose of 187 mg/Kg. In the Toretsky study, the

Expert Opin. Ther. Targets (2005) 9(4)

Maksimenko & Malvy

oligonucleotides were phosphodiester oligonucleotides protected in 3’ and 5’ by a thioate group. They were delivered in cells using electroporation. Several oligonucleotides spanning the junction were tested and one of them targeting the Type 1 fusion junction was found efficient to reduce the EWS/FlI1 protein level in cells; however, surprisingly, the EWS protein expressed from the nontranslocated chromosome 22 was also reduced. Cell growth inhibition was observed, which the authors assigned directly to EWS/FlI1 inhibition because inhibition of EWS by the same oligonucleotide in control fusion negative PC-3M cells did not induce any inhibition of cell growth. Recently, it has been confirmed that ASO knockdown of EWS expression is not lethal in HeLa cells [32] However, these results should be interpreted with caution, because the cellular function of germline EWS, which is ubiquitously expressed, is not known. It has been reported that at the protein level, EWS/FlI1 and EWS can form heterodimers [16]. Simultaneous inhibition of EWS/FLI1 and EWS might, therefore, have a cooperative effect. The 25 bases phosphorothioate oligonucleotide described by Tanaka et al. [7] has also been used in vivo by Lambert et al. [17] using a mouse xenograft model of EWS-FLI1 transformed NIH 3T3 cells. This ASO targeted the Type 1 fusion region with a somewhat stronger hybridisation to the FlI1 part of EWS/FlI1. They had encapsulated it in biocompatible polymeric nanocapsules and injected the nanocapsules directly into the tumours expressing EWS/FlI1. They observed a 70% inhibition of tumour growth only with the antisense oligonucleotide at a dose of 5 mg/Kg and no inhibition with the control oligonucleotide. No inhibition of tumour growth was observed when using the oligonucleotides without nanocapsules. In the same tumour model, Maksimenko et al. used a 30-mer oligonucleotide also directed against the Type 1 junction with a higher affinity to EWS within the 3´part of the ASO. This oligonucleotide is predicted to form a stem loop structure, the stem being composed of 22 phosphodiester nucleotides (including 5 nucleotides noncomplementary of the target, but required for the stem stabilisation and protection) and the loop of 8 phosphorothioates, to protect it from exonucleases attacking single-stranded DNA [18]. It was found to act as an antisense agent, inhibiting EWS/FlI1 by 50% when delivered by cationic lipids in 3T3 cells permanently expressing EWS/FlI1 [30]. Inhibition of EWS mRNA was in the range of 10% only (A Maksimenko, pers. commun.). When bound to polymeric nanospheres coated with a cationic compound, cetyltrimethylammoniumbromide, this oligonucleotide also specifically inhibited tumour growth after intratumoural injection. At the same dose of oligonucleotide (5 mg/Kg), the inhibition obtained was slightly better than when using the encapsulated 25 mer phosphorothioate [20]. This result is interesting because it means that although the in vivo use of a polymeric vector is required, the obtained effect is similar despite the use of a different oligonucleotide and a different system of vectorisation. It therefore seems that there is in this murine model an intrinsic sensitivity to the in vivo action of oligonucleotides

targeted against EWS-FI1. The stem loop ASO bound to polymeric nanospheres does not specifically inhibit cell growth in culture [30]; however, it inhibits EWS/FLI1 expression in cell culture with specificity (A. Maksimenko, pers. commun.). It seems, therefore, that EWS/FLI1 inhibition is a key event to obtain an antitumour effect by intratumoural administration. Recently, these ASO bound to polymeric nanospheres have been shown to be active by intravenous administration [30]. ASOs are known, once in the cytoplasm, to translocate easily in the nucleus [21,22] where RNAase H is present. Therefore, they could act at the level of the unspliced RNA primary transcript. Theoretically, targeting the actual intronic fusion region of the chimeric nuclear primary transcript might allow to prevent cellular resistance to the oligonucleotide in the tumour by selecting cells with alternative splicing [23]. However, this junction varies from patient to patient. Thus, the oligonucleotide would need to be personalised for each patient, and so far, this approach has not yet been tested. 2.2 Results 2.2.1 Cell

obtained with siRNAs culture

Until now, the gene silencing activity of siRNAs has been ascribed to the cytoplasm where the RISC complex was supposed to be located (recent reports indicate that it might be also in the nucleus). The EWS-FI1 junction at the mRNA level is evidently also an attractive target for siRNAs. Dohjima et al. [9] studied the action of two siRNAs intracellularly expressed from shRNAs and targeted against the Type 1 junction point in TC135 cells. One of the two siRNAs also partially downregulated Fli-1. Both siRNAs degraded their target mRNA (which confirms their siRNA activity) by 80% and reduced cell growth by 50 – 60%. Siligan et al. [24] have used siRNAs expressed from shRNAs in three different ESFT cell lines, STA-ET-7.2, SK-N-MC, and TC252, one targeting the Type 1 fusion region (identical to the Dohjima sequence), one directed against the Type 2 fusion joint, and one to the FlI1 portion. When intracellularly expressed as shRNAs from a RNA polymerase III promoter driven retroviral expression vector, all three of them specifically downregulated EWS-FLI1 expression by inducing mRNA degradation (therefore acting as siRNAs) and inhibited growth of ESFT cells in monolayer and soft agar tissue culture. HA Chansky et al. [10] have also used an siRNA targeted against junction point 2 in SK-ES cells. However, this siRNA was not efficient. They got inhibition of EWS-Fli1 by an electroporated siRNA targeted against the FlI1 part. Fli1 is not expressed in SK-ES-1 cells at the protein level. The consequences for SK-ES-1 cells were an increased apoptosis and an abrogation of invasiveness in an in vitro assay. Prieur et al. [6] have used an siRNA targeting the Type 1 junction. This siRNA has a target which is intermediate between the targets chosen by Dohjima et al. [9] (Figure 1). This synthetic siRNA has been transfected with oligofectamine in A673 cells. They used this siRNA to identify with a DNA microarray technique the genes that are regulated by EWS/FLI1. They observed a complete arrest of


3


EWS

FLI-1

Junction point Reference ⇓ 5’UCAAUAUAGCCAACAGAGCAGCAGCUACGGGCAGCAGAACCCUUCUUAUGACUCAGUCAGAAGAGCAG 3' * GCAGCUACGGGCAGCAGAACCCUUC [18] GCAGAACCCUUCUUAUGACUCAGUC [7,17] Antisense AGCAGAACCCUUCUUAUGAC [8] CAGCUACGGGCAGCAGAACCCUUC [8] AGCAGAACCCUUCU [8] UACGGGCAGCAGAACCCUUCUUAUG [7]

siRNA

GGCAGCAGAACCCUUCUUA AGCUACGGGCAGCAGAACCC AGCAGAACCCUUCUUAUGAC CAGCUACGGGCAGCAGAACCC GCAGAACCCUUCUUAUGAC

[6] [9] [9] [27] [24]

Figure1. Target mRNA sequences used in the literature. * EWS-Fli-1 target mRNA. Junction point 1.

growth and a dramatic increase in the number of apoptotic cells after delivering the siRNA with two transfections. It is difficult to draw a general conclusion with the siRNAs because sequences, cells and protocols differ according to authors. Indeed, siRNAs may have numerous off-target effects, related to each sequence, and this has not yet been thoroughly appreciated in the Ewing sarcoma studies. The targeting of a junction point is indeed a priori very favourable for the specificity, but this remains to be proven by microarray technology. The cellular consequences in human cells of the treatment by active EWS/FLI1 targeted siRNAs varies. Apoptosis has been described in two reports. Growth inhibition by ASOs and siRNAs targeting EWS-FLI1 are commonly reported, confirming early studies using plasmid vector based antisense strategies [25,26]. We have, nevertheless, to be cautious about the earlier reports of cell growth inhibition because oligonucleotide concentrations were very high and it has been shown in leukaemic cells that, when using very high concentrations of oligonucleotides, degradation products can display antiproliferative effects [31]. It is not actually known which is the important parameter in cultures of oligonucleotides treated EWS/FLI1 expressing cells related to the in vivo activity of these oligonucleotides. When considering murine NIH3T3 cells expressing the human EWS/FLI1 gene, growth inhibition in cell culture is not related to the in vivo effect [30]. Inhibition of EWS/FLI1 expression might be the more relevant parameter (C Malvy, pers. commun.). However, nothing indicates that the murine model can be extrapolated to the human situation. Generally speaking, the level of inhibition of genes by siRNAs is greater than with ASOs (and obtained at a lower concentration). The few results with EWS/FLI1 as a target for siRNAs seem to confirm this tendency (with both agents the inhibition is transient). However, one has to be cautious to generalise this result for EWS/FLI1 inhibition because, generally, the inhibition level depends on the target 4

site (generally differentially selected for ASO and for siRNAs) and on the chemical modifications of the oligonucleotides. But the targeting of a chimeric gene junction does not give a great freedom for the conception of the oligonucleotide (see Figure 1) when compared with another type of oncogene. When siRNAs are used as shRNA permanently expressed by plasmids in the cells, inhibition is permanent. However, it is very difficult, even with viral vectors, to have the plasmids expressed in all the tumour cells. This means for therapeutic purposes that the balance between the inhibitory activity of the shRNAs on one hand, and on the other hand, the possibility for the tumours to grow again starting from the nontransfected cells joined to the viral vector toxicity (mainly for repeated administrations) will have to be considered. In conclusion, oligonucleotides targeting EWS-FlI1 RNA have shown interesting effects in cell culture and in animal preclinical models and have the potential to be assayed as therapeutic agents either to keep residual disease at a low level or for enhancing the activity of conventional anticancer agents. 2.2.2 In

vivo In 2005 two reports have been made in symposiums on the action of polymer encapsulated siRNAs. In the first report, Hu et al. [13] use an EWS/FlI1 targeted siRNA condensed in a sugar-containing polymer. These nanoparticles are attached to transferrin in order to have a preferential binding to cancer cell which over express the transferrin receptor. The nanoparticles are injected by intravenous administration to mice grafted with human Ewing cells which express a fluorescent reporter gene. Long-term treatment markedly inhibited tumour growth and metastasis. In the second one Toub et al. [27] use a Type I junction targeted siRNA encapsulated in polyalkylcyanoacrylate nanocapsules. These nanocapsules are injected intratumourally every 3 days (total


Maksimenko & Malvy

dose 1.1 mg/Kg siRNA) in mice grafted with NIH3T3 murine cells permanently expressing the human EWS/FlI1 gene. Tumour growth inhibition of 80% is obtained with the targeted siRNA in nanocapsules. No inhibition is obtained with the controls. 3. Downregulation

of genes involved in the maintenance of the Ewing sarcoma cells phenotype FLT-3 ligand is a cytokine which participates to the proliferation of haematopoietic progenitors. Cytoplasmic FLT-3 is found in all Ewing cell lines studied and 74% of Ewing sarcoma and peripheral neuroectodermal tumour. ASO downregulating FLT-3 significantly inhibit cell growth [19]. ZNF43, a zinc-finger protein, has been identified by differential display between Ewing cell lines and the same cell lines induced to differentiate by a differentiating agent. ZNF43 is downregulated in the differentiated cells. Downregulation of ZNF43 by an ASO in Ewing proliferating cells induces a morphological differentiation and a growth arrest [28]. 4. Expert

opinion

Many clinical trials are going on with ASOs in the cancer field. New clinical trials are just beginning with siRNAs. ESFT is a rare cancer, afflicting mostly children. It is, therefore, fully justified to use orphan drugs (drugs for rare disease which are unlikely to be developed by pharmaceutical companies) such as nucleic acids which could improve the therapeutic success. Translocation-associated diseases such as ESFT are unique as opposed to other cancers, where clinical trials with nucleic acid drugs are already ongoing because the RNA target is present only in the malignant cells. Compared to leukaemias, solid tumours may be better targets for nucleic acid

Bibliography 1.

2.

3.

ZOUBEK A, DOCKHORN-DWORNICZAK B, DELATTRE O et al.: Does expression of different EWS chimeric transcripts define clinically distinct risk groups of Ewing tumor patients? J. Clin. Oncol. (1996) 14:1245-1251. HENSE HW, AHRENS S, PAULUSSEN M, LEHNERT M, JURGENS H: Descriptive epidemiology of Ewing’s tumor-analysis of German patients from (EI)CESS 1980-1997. Klin. Padiatr. (1999) 211:271-275. GURNEY JG, DAVIS S, SEVERSON RK, FANG JY, ROSS JA, ROBISON LL:

delivery according to the experience derived from in vitro laboratory. The issue of in vivo delivery of the short nucleic acids in the tumour cells is important for the clinical development of these molecules, still only partially resolved and in full progress. All results but one of Ewing sarcoma tumour inhibition actually published in vivo in animal models with short oligonucleotides have been obtained with synthetic vectors. It is obvious that these vectors protect oligonucleotides against degradation in vivo, but they might also have other roles such as preventing the interaction of oligonucleotides with undesired targets and modifying their uptake route in cells. In addition, vector targeting, which can be obtained by attaching a ligand to the synthetic vector, might be an important issue. The therapeutic treatment of EFST has reached a plateau of survival (∼ 60% for patients with localised disease and 25% for high risk groups). Also, taking into account the aggressive character of conventional multi-modal treatment given to young patients, there is a significant risk for secondary adverse effects in the long-term. The authors believe that short synthetic nucleic acids such as ASOs and siRNAs which specifically modulate the EWS/Fli-1 protein may be expected to be less toxic, and could therefore improve the actual treatment for the benefit of the patients. In addition, SFT is an orphan disease. This means that it is unlikely that a private company will invest in research on this disease. These short nucleic acids and the synthetic vectors have already been designed in academic laboratories. This should greatly reduce the cost of research and development to investigate the value of this type of compounds in human clinical trials.

Acknowledgements The authors greatly thank Professor Heinrich Kovar (Vienna, Austria) for his corrections and advice about this review.

downstream oncogenic pathways and a crucial role for repression of insulin-like growth factor binding protein 3. Mol. Cell Biol. (2004) 24:7275-7283.

Trends in cancer incidence among children in the US. Cancer (1996) 78:532-541. 4.

COTTERILL SJ, PARKER L, MALCOLM AJ, REID M, MORE L, CRAFT AW: Incidence and survival for cancer in children and young adults in the North of England, 1968-1995: a report from the Northern Region Young Persons’ Malignant Disease Registry. Br. J. Cancer (2000) 83:397-403.

5.

PAULUSSEN M, FROHLICH B, JURGENS H: Ewing tumour: incidence, prognosis and treatment options. Paediatr. Drugs (2001) 3:899-913.

6.

PRIEUR A, TIRODE F, COHEN P, DELATTRE O: EWS/FLI-1 silencing and gene profiling of Ewing cells reveal Expert Opin. Ther. Targets (2005) 9(4)

7.

TANAKA K, IWAKUMA T, HARIMAYA K, SATO H, IWAMOTO Y: EWS FLI-1 antisense oligodeoxynucleotide inhibits proliferation of human Ewing’s Sarcoma and primitive neuroectodermal tumor cells. J. Clin. Invest. (1997) 99:239-247.

8.

TORETSKY JA, CONNELL Y, NECKERS L, BHAT N: Inhibition of EWS-Fli-1 fusion protein with antisense oligodeoxynucleotides. J. Neuro-Oncology (1997) 31:9-16.

9.

DOHIJMA T, LEE NS, LI H, OHNO T, ROSSI JJ: Small interfering RNAs expressed

5


from a Pol III promoter suppress the EWS/ Fli-1 transcript in an Ewing sarcoma cell line. Mol. Ther. (2003) 7:811-816. 10.

11.

12.

CHANSKY HA, BARAHMAND-POUR F, MEI Q et al.: Targeting of EWS/FLI-1 by RNA interference attenuates the tumor phenotype of Ewing’s sarcoma cells in vitro. J. Orthop. Res. (2004) 22:910-917. WICKSTROM E, CHOOB M, URTISHAK KA et al.: Sequence specificity of alternating hydroyprolyl/phosphono peptide nucleic acids against zebrafish embryo mRNAs. J. Drug Target. (2004) 2(6):363-372. JEPSEN JS, WENGEL J: LNA-antisense rivals siRNA for gene silencing. Curr. Opin. Drug Discov. Devel. (2004) 7(2):188-194.

13.

HU S: Novel gene-silencing nanoparticles shown to inhibit Ewing’s sarcoma. Proc. Am. Assoc. Cancer Res. (2005) abstract 6104, 46:1435.

14.

HANNON G, ROSSI J: Unlocking the potential of the human genome with RNA interference. Nature (2004) 431:371-378

15.

MEISTER G, TUSCHL T: Mechanisms of gene silencing by double-stranded RNA. Nature (2004) 431:343-349

16.

17.

18.

6

SPAHN L, SILIGAN C, BACHMAIER R, SCMID JA, ARYEE DN, KOVAR H: Homotypic and heterotypic interactions of EWS, FLI1 and their oncogenic fusion protein. Oncogene (2003) 22(44):6819-6829. LAMBERT G, BERTRAND JR, FATTAL E et al.: EWS FLI-1 antisense nanocapsules inhibts Ewing Sarcomarelated tumor in mice. Biochem. Biophys. Res. Com. (2000) 279:401-406. MAKSIMENKO A, LAMBERT G, BERTRAND JR, FATTAL E, COUVREUR P, MALVY C: Therapeutic potentialities of EWS-Fli-1 mRNA-targeted vectorized antisense oligonucleotides. Ann. NY Acad. Sci. (2003) 1002:72-77.

19.

TIMEUS F, RICOTTI E, CRESCENZIO N et al.: Flt-3 and its ligand are expressed in neural crest-derived tumors and promote survival and proliferation of their cell lines. Lab. Invest. (2001) 1025-1037

20.

MAKSIMENKO A, MALVY C, LAMBERT G et al.: Oligonucleotides targeted against a junction oncogene are made efficient by nanotechnologies. Pharm. Res. (2003) 20:1565-1567.

21.

LEONETTI JP, MECHTI N, DEGOLS G, GAGNOR C, LEBLEU B: Intracellular distribution of microinjected antisense oligonucleotides. Proc. Natl. Acad. Sci. USA (1991) 89:2702-2706.

22.

CHIN DJ, GREEN GA, ZON G, SZOKA FC, JR, STRAUBINGER RM: Rapid nuclear accumulation of injected oligodeoxyribonucleotides. New Biol. (1990) 2:1091-1100.

23.

KOVAR H, BAN J, POSPISILOVA S: Potentials for RNAi in sarcoma research and therapy: Ewing’s sarcoma as a model. Semin. Cancer Biol. (2003) 13:275-281

24.

SILIGAN C, BAN J, BACHMAIER R et al.: EWS-FLI1 target genes recovered from Ewing´s sarcoma chromatin. Oncogene (2005) advance on-line publication Feb. 14, 2005.

25.

26.

27.

OUCHIDA M, OHNO T, FUJIMURA Y, RAO VN, REDDY ES: Loss of tumorigenicity of Ewing’s sarcoma cells expressing antisense RNA to EWS-fusion transcripts. Oncogene (1995) 11:1049-1054 KOVAR H, ARYEE DN, JUG G et al.: EWS/FLI-1 antagonists induce growth inhibition of Ewing tumor cells in vitro. Cell Growth Differ. (1996) 7:429-437. TOUB N, BERTRAND JR, MALVY C, FATTAL E, COUVREUR P: Potentials For SiRNA Nanocapsules Targeted Against The Jonction Point Of The EWS-Fli 1 Oncogene: Ewing’ Sarcoma As A Model. The 32nd Annual Meeting & Exposition of the Controlled Release Society, June 18-22, 2005, Miami Beach, Florida. (This siRNA


was first used by BENHAM D. Diplomarbeit. Technishe Universität Berlin. Inhibition of EWS/Fli-1 protein synthesis by siRNA in a Ewing’s sarcoma model. February 2004). 28.

GONZALEz-LAMUNO D, LOUKILI N, GARCIA-FUENTES M, THOMSON TM: Expression and regulation of the transcriptional repressor ZNF43 in Ewing sarcoma cells. Pediatr. Pathol. Mol. Med. (2002) 21(6):531-540.

29.

NESTEROVA M, CHO-CHUNG YS: Killing the messenger: antisense DNA and siRNA. Curr Drug Targets. (2004) 5(8):683-689.

30.

MAKSIMENKO A, COUVREUR P, POLARD V et al.: Antitumor effect of EWS-Fli-1 targeted antisense oligonucleotides by systemic injection in mice. Submitted for publication to the Ann. NY Acad. Sci.

31.

VAERMAN JL, MOUREAU P, DELDIME F et al.: Antisense oligodeoxyribonucleotides suppress hematologic cell growth through stepwise release of deoxyribonucleotides. Blood (1997) 90(1):331-339

32.

YOUNG PJ, FRANCIS JW, LINCE D, COON K, ANDROPHY EJ, LORSON CL: The Ewing’s sarcoma protein interacts with the Tudor domain of the survival motor neuron protein. Brain Res. Mol. Brain Res.. (2003) 119(1):37-49.

33.

ZUCMAN J, MELOT T, DESMAZE C et al.: Combinatorial generation of variable fusion proteins in the Ewing family of tumors. (1993) 12(12):4481-4487.

Affiliation

Andrei Maksimenko1 & Claude Malvy†2 †Author for correspondence 1Bioalliance Pharma SA, 59 bvd de M Valin, Paris 75015, France 2CNRS UMR 8121, Institut Gustave Roussy PR2, 39 rue Camille Desmoulins, 94805 Villejuif Cedex, France E-mail: [email protected]