Guarente, L., and E. Hoar. 1984. Upstream activation sites of the CYCI ... Sherman, F., G. R. Fink, and J. B. Hicks. 1986. Methods in yeast genetics. Cold Spring ...
MOLECULAR AND CELLULAR BIOLOGY, Nov. 1990, p. 5663-5670
Vol. 10, No. 11
0270-7306/90/115663-08$02.00/0 Copyright © 1990, American Society for Microbiology
Opposing Regulatory Functions of Positive and Negative Elements in UASG Control Transcription of the Yeast GAL Genes RUSSELL L. FINLEY, JR.,t SHIMING CHEN, JUNLI MA, PAUL BYRNE,
AND
ROBERT W. WEST, JR.*
Department of Biochemistry and Molecular Biology, State University of New York Health Science Center, Syracuse, New York 13210 Received 16 May 1990/Accepted 6 August 1990
The yeast GALI and GALIO genes are transcribed at a remarkably low basal level when galactose is unavailable and are induced by over 4 orders of magnitude when it becomes available. Approximately six negative control elements (designated GAL operators GALO, to GALO6) are located adjacent to or overlapping four binding sites for the transcription activator GALA in the GAL upstream activating sequence UASG. The negative control elements contribute to the broad range of inducibility of GAL] and GALIO by inhibiting two GAL4/galactose-independent activating elements (GAE1 and GAE2) in UASG. In turn, multiple GAL4-binding sites in UASG are necessary for GAL4 to overcome repression by the negative control elements under fully inducing conditions. When glucose in addition to galactose is available (repressing conditions), the ability of GAL4 to activate transcription is diminished as a result of its reduced affinity for DNA and the reduced availability of inducer. Under these conditions, the negative control elements inhibit transcriptional activation from the glucose-attenuated GAL4 sites, thus accounting at least in part for glucose repression acting in cis. A normal part of transcriptional regulation of the GAL) and GALIO genes, therefore, appears to involve a balance between the opposing functions of positive and negative control elements.
When yeast cells are grown in medium containing both glucose and galactose, transcription of the GAL genes is repressed several hundred-fold relative to the fully induced levels observed with galactose alone (28, 39, 40; this report). Glucose repression of the GAL genes is mediated by at least three distinct pathways. One pathway, referred to as inducer exclusion, acts to reduce transport of galactose into the cell (27, 31). A second pathway reduces the apparent affinity of GAL4 for its binding sites in UASG (12, 25, 33). A third and poorly characterized pathway depends on a cis-acting sequence(s) in UASG (36, 39; see also reference 20). Deletion of sequences between the GAL4-binding sites and the GAL] TATA element, for example, results in 70-fold less glucose repression of the GAL] promoter (39). Thus, a fundamental question is, What cis-acting sequence(s) is responsible for glucose repression of the GAL genes and how does it repress transcription? A second fundamental question is, How do the GAL operators prevent basal-level transcriptional activation by GAE1 and GAE2 without significantly inhibiting the fully induced level of transcriptional activation by GAL4? Previously we speculated that GAL4 activity is not repressed because of the unique position of its binding sites in UASG (10). It was also possible that GAL4 activates transcription by a mechanism that is not susceptible to repression by the GAL operators. Here we show that GAL4 is in fact susceptible to repression by the GAL operators, albeit to a lesser extent than are other activators. Furthermore, our data suggest that the high activating potential of GAL4, originating from synergy between four binding sites in UASG, is necessary to overcome repression by the GAL operators. We also report that in the presence of glucose, when GAL4 activity is attenuated, the GAL operators can contribute to further repress induction of GAL] and GALIO transcription and so are likely to be at least one mechanism responsible for glucose repression acting in cis. We conclude that transcriptional regulation of the GAL] and GALJO genes, as perhaps for other eucaryotic genes, results from a direct competi-
Expression of the yeast GAL] and GALIO genes, essential for galactose metabolism, is tightly regulated at the transcriptional level in response to the availability of galactose and glucose. Transcription of these genes is undetectable in yeast cells grown in the absence of galactose and is induced by over 4 orders of magnitude when galactose becomes available (35, 39, 40). This extraordinary induction ratio relies on the activity of multiple positive and negative control elements located in the 365-bp upstream activation sequence UASG (16, 20, 38). A key transcription activator protein, GAL4, binds to four related sites in UASG and governs the rate of transcription when galactose is available (3, 6, 12). In the absence of galactose, GAL4 remains bound to its sites in UASG but is blocked from activating transcription by its interaction with another protein, GAL80 (22, 24, 26). UASG also contains multiple negative control elements, for convenience designated GAL operators GALO1 to GALO6 (38; this report), which repress two nearby GAL4/ galactose-independent activating elements, GAE1 and GAE2 (10). The mechanism by which the GAL operators repress transcriptional activation is unknown. GAE1 and GAE2, like the GAL operators, reside adjacent to or overlap the binding sites of GAL4, though they activate transcription independently of GAL4 and without a requirement for galactose. If the GAL operators that are located between the GAL4 sites and the GAL] TATA element are removed, basal-level transcription from the GAL] promoter proceeds at a level only 20-fold lower than the fully induced level because of the presence of GAE1 and GAE2 (10, 39). Whereas the physiological role of GAE1 and GAE2 is uncertain, the GAL operators are clearly necessary to inhibit their activity and thus maintain normal inducibility of GAL] and GAL1O transcription. * Corresponding author. t Present address: Department of Molecular Biology, Massachusetts General Hospital, and Department of Genetics, Harvard Medical School, Boston, MA 02114.
5663
5664
MOL. CELL. BIOL.
FINLEY ET AL.
B
Xhol
4
~
245bp -
Sail
TI
C-C1-k)cZ I ~~~~~~ .41 78bp-.
Ei~~
C
Xhol
I
4.128bp
o
_.
I
4-26bp -
4
1 78bp-
,
--
t
.
FIG. 1. Plasmids used. (A) pLGA-312 (14), a 2um URA3 plasmid containing a CYCI-lacZ fusion and a unique XhoI site between the CYCI TATA element (T) and the CYCI UAS (UASc). Distances in base pairs from the transcription start site (arrow) to the XhoI site or to the center of UASC are indicated. (B) 121-632 (39), a 2,um URA3 plasmid containing a GALI-lacZ fusion including sequences 128 bp upstream of the GAL] transcription start site (arrow). UASG sequences (including all six GAL operators) further upstream have been deleted and replaced by a unique XhoI site. (C) pJLb, a 2,um URA3 plasmid derived from pLG67OZ (15; see Materials and Methods) containing a UAS-less CYCJ-lacZ fusion with a unique XhoI site 178 bp upstream of the transcriptional start site (arrow) and a unique Sall site 26 bp upstream of the XhoI site.
tion between the functions of positive and negative control elements. MATERIALS AND METHODS Strains and media. Saccharomyces cerevisiae YM335 (MATa gal4-536 ura3-52 ade2-101 lys2-801 his3-200) and the congenic GAL4+ strain YM256 were provided by Mark Johnston. Escherichia coli DHSx was used for routine cloning purposes. Yeast cells were grown on synthetic defined medium (0.76% yeast nitrogen base with the appropriate amino acids added) containing 3% glycerol and 2% lactate (Gly medium), 2% galactose plus 3% glycerol and 2% lactate (Gal medium), 2% glucose (Glu medium), or 2% glucose plus 2% galactose (Glu Gal). For P-galactosidase assays (see below), yeast cells were grown on Gly medium before inoculation of one of these media. Plasmids, synthetic oligonucleotides, and UASG fragments. Plasmid pLGA-312 (kindly provided by Lenny Guarente), a URA3+ 2i±m plasmid containing a wild-type CYCJ-lacZ fusion, was previously described (14). The 2,um URA3+ plasmids pRY131, containing a wild-type GAL1-lacZ fusion, and 121-632, containing a GAL1-lacZ fusion with UASG sequences upstream of position 632 deleted (nomenclature of Johnston and Davis [21] and Yocum et al. [40]), were previously described (39). pJLb was made from the 2p,m URA3+ plasmid pLG670Z, which contains a CYCI-lacZ fusion lacking UASC (15), by cutting at the natural Sall site, filling in the 5' overhang with Klenow enzyme, and ligating the resulting blunt ends to remove the Sall site. A multiple cloning site (5'-AGGCCTCGAGGATCCATCGATCTA GAGTCGACAGGCCT) was then inserted into the XhoI site, creating plasmid pJLb. Synthetic oligonucleotides UASG-17a (GAL4 site 1), UASG-19 (GAL4 site 2), UASG-31 (GALO1), and lexA-O (LexA-binding site [5]) and the multiple cloning site used to make pJLb were obtained from Genetic Designs, Inc. The lexA-O sequence was 5'-TC GACGTACTGTATGTACATACAGTACG. Synthetic oligonucleotides UASG-17b (formerly UASG-17) (GAL4 site 3), UASG-37a (GAE2), and UASG-37b (GALO3) and UASG fragments UASG-75 (containing GAL4 sites 1, 2, and 3 and GAE1), UASG-40 (containing GALO5), and UASG-80 (containing GALO3 and GALO5) and were previously described (10). Restriction fragments UASG-90 (containing GALO1 and
GALO4), extending from positions 300 to 390, and UASG150 (containing GALO5 and GALO6), extending from position 510 to 660, were filled in with Klenow enzyme and ligated to XhoI linkers. UASH, an 89-bp fragment from the upstream region of the HIS4 gene (between positions -130 and -200) containing the three GCN4-binding sites (1), was obtained as a XhoI fragment from plasmid HYC3 (kindly provided by Alan Hinnebusch [18]). Yeast transformation and ,I-galactosidase assays. Yeast cells were transformed by the spheroplast technique (34), and transformants were selected on Glu medium lacking uracil. P-Galactosidase assays were performed in duplicate and repeated at least three times from yeast cells grown on solid medium as previously described (10). For glucose repression experiments (see Table 3), yeast cells were grown in liquid medium (Gal or Glu Gal), and ,B-galactosidase activity was determined as previously described (29, 39). P-Galactosidase units presented are averages from multiple assays, which differed by less than 20%. RESULTS
UASG contains at least six negative control elements capable of repressing transcription. UASG contains multiple repression sequences which reduce the basal activities of the GALI and GALIO promoters. Previously, three negative control sequences were identified, GAL operators GALO1, GALO2, and GALO3, by showing that certain restriction fragments from UASG containing these sequences could repress the CYC1 UAS (UASC) when inserted between it and the CYCI TATA element in plasmid pLGI-312 (Fig. 1A; 38). UASG fragments lacking repression sequences did not repress UASC, nor did large fragments of random E. coli DNA (13; S. Chen, R. Finley, and R. West, unpublished results), indicating that repression by the operators was not due merely to increased distance between the UAS and TATA element. We identified three additional GAL operators, arbitrarily designated GALO4, GALO5, and GALO6, by subcloning overlapping restriction fragments from the entire 365-bp UASG into the promoter of the CYCI gene fused to lacZ (Fig. 1A) and testing their ability to repress transcription activation (data not shown). The approximate locations of the six GAL operators are depicted in Fig. 2A. For further
VOL. 10, 1990
OPPOSING ACTIVATORS AND OPERATORS IN YEAST UASG
5665
A 160
260
I
1
360
460
560
660
-1F
-1-
-1-
--1F
*
7
UASG
4
04
760
°1
03 05
0
0
6
rT m
rn GL
4- GAL 10
GAL 1
GE
GAE1
B
338
UASG- 2 6
UASG Element
Sequence
Oligonucleotide
359
cggCGCTrAACTGCTCATTGCTATAg
GAL 01
365
UASG- 41
404
GTACGGATTAGAAGCCGCCGAGCGGGTGACAGCCCTCCGAc 476
UASG- 3 7 b
510 325
cgcTAGCCTMAMA ACCTCTCmGGAAg
GAL 04
510
550
UASG- 4 0
C1TlITATGG1TATGAAGAGGAAAAATTGGCAGTAACCTGG
UASG- 3 8
cGATAATGCGATTAGT1ErTAGCCTTAMCTGGGGTAccg
634
597 438
GAL 05
GAL 06
473
UASG-37a CCGGTCGCG1TCCTGAAACGCAGATGTGCCTCGCGCg 368
384
387
403
accCGGGTGACAGCCCTCCG 405
GAE2
GAL4 site 1
UASG- 1 7 a ccgCGGATrAGAAGCCGCCG UASG- 1 9
GAL 02
GAL 03
OACFGCTCCGAACAATAAGA1TCTACAATACTAGtc
299
UASG- 3 1
rt I -41
GAL4 site 2
421
UASG- 1 7 b cAGGAAGACTCTCCTCCGgcCG
GAL4 site 3
FIG. 2. (A) The GALI-GALIO divergent promoter region between the transcription initiation sites (arrows) of GALIO (left) and GAL] (right), drawn approximately to scale. Positions are indicated by the scale at the top in base pairs (21, 40). Locations of UASG (nomenclature of Guarente et al. [16]), the TATA elements (T), GAL4 sites 1 to 4, GAE1 and GAE2, and GAL operators GALO1 to GALO6 are indicated. (B) Synthetic oligonucleotides used. The sequences of synthetic oligonucleotides along with the regulatory sites from which they are derived are shown. The GALI coding strand of UASG is shown 5' to 3' for each oligonucleotide. The numbers over each sequence refer to positions in UASG. Capital letters denote homology with UASG. GAL4-binding sites are underlined. UASG-41 contains GAL4 sites 1 and 2 in addition to GALO2. All synthetic oligonucleotides and UASG fragments have Sall or XhoI ends (not shown). * UASG-40 containing GALO5 is a restriction fragment from UASG previously described (10).
characterization, we made synthetic oligonucleotides bearing individual GAL operators (Fig. 2B) and inserted them in single and multiple copies downstream of UASC in plasmid pLGA-312 (Fig. 1A). P-Galactosidase activity was determined for gal4 mutant yeast cells transformed with the pLGA-312 derivative plasmids and grown on Glu medium. Each of the GAL operators repressed UASC by 4- to 15-fold in single copy and 40- to 500-fold in two copies (with the exception of GALO2, which repressed only 10-fold in two copies) (Table 1). Repression was not specific for the activators that bind to UASc (HAP proteins HAP1 to HAP4; 11, 30), since the activity of GCN4, which binds to sites in UASH from the HIS4 gene (1, 18), was also repressed when UASH was inserted upstream of the CYCI TATA element (see below and Fig. 3; data not shown). Sequences lacking GAL operators (UASG-17b and UASG-55) did not repress the activity of UASC or UASH (Table 1; data not shown). Two different operators repressed UASC to a similar extent as did two of the same operator (Table 1). Similar results
obtained with yeast cells grown on Gly medium (data not shown). Combined, these results indicate that the natural combinations of GAL operators in UASG are capable of significantly reducing the activity of upstream activating were
elements. This conclusion is consistent with previous results demonstrating that a 365-bp fragment containing all six GAL operators repressed UASC by over 1,200-fold in yeast cells grown in Gly medium (38). We do not know whether individual GAL operators repress by the same or by distinct mechanisms, but they clearly can function together to maximize their effects. Multiple GALA sites activate transcription more efficiently than do multiple GAEs. The GAL operators repress the activity of GAE1 and GAE2 in the wild-type GAL] and GALIO promoters (or the activity of UASC or UASH in recombinant promoters), though they do not significantly impair GAL4 activity in the wild-type GAL] and GALIO promoters when yeast cells are grown under fully inducing conditions (e.g., Gal medium). Differential repression of
5666
FINLEY ET AL.
MOL. CELL. BIOL.
TABLE 1. Repression by GAL operators in single and multiple copy of an upstream UAS U of 3-galactosidase activity (fold repression)b
Oligonucleotide or fragmenta
UASG-17b UASG-55 UASG-26 (01) UASG-41 (02) UASG-37b (03) UASG-31 (04) UASG-40 (05)
UASG-38 (06) UASG-80 (03 + 0°)
UASG-90 (01
+
04)
UASG-150 (05 + 06) None
1 copy
2 copies
300 (1) 300 (1) 50 (6) 75 (4) 20 (15) 75 (4) 20 (15) 60 (5) 8 (40) 5 (60) 1.5 (200) 300 (1)
300 (1) ND 6 (50) 30 (10) 0.9 (330) 8 (40) 0.6 (500) 2 (150) ND ND ND
a One or two copies of oligonucleotides (Fig. 2B) or restriction fragments
(UASG-90 and UASG-150 [Materials and Methods]; UASG4O, UASG-55, and UASG-80 [10]) were inserted into the XhoI site of pLGA-312 (Fig. 1A). GAL
operators are shown in parentheses. b Determined as described previously (29) for a gaI4 yeast strain (YM335) containing the respective pLGA-312 derivative plasmids, grown on Glu medium (see Materials and Methods). Fold repression of P-galactosidase activity is expressed relative to the value for pLGA-312. ND, Not determined.
GAL4 and the GAEs by the GAL operators in the wild-type UASG could be due to the relative strengths of the respective activators, the number of activation sites (four GAL4 sites versus two GAEs), or differences in the ability of multiple sites to activate synergistically. To distinguish among these and other possibilities, it was first necessary to assess the relative activities of individual GAL4 sites or GAEs in the absence of GAL operators. To achieve this, we subcloned synthetic oligonucleotides containing individual GAL4 sites or GAEs (Fig. 2B) upstream of a GALI-lacZ fusion lacking all six GAL operators in plasmid 121-632 (Fig. 1B). ,B-Galactosidase activity was assayed from GAL4+ and gal4 yeast strains containing the 121-632 derivative plasmids, grown in Glu, Gly, or Gal medium. The GAL4 sites differed from each other and from GAE1 and GAE2 in the ability to activate the
GAL] promoter (Table 2). In general, the natural GAL4 sites activated better than did GAE1 or GAE2. Although certain GAL4 sites had GAE-like activity (see below), the GAL4dependent activity of the strongest GAL4-binding site (GAL4 site 2 [23]) was greater than the activity of an individual GAE (Table 2). Also, multiple GAL4 sites together activated the GAL] promoter better than did multiple GAEs. This difference may be due to the greater ability of GAL4 to activate synergistically from multiple binding sites. For example, the synergy between two weak GAL4-binding sites (two site 3s) resulted in 750-fold more activity than did a single site 3, compared with the synergy between two GAE2s, which resulted in only 7-fold more activity than did a single GAE2. Furthermore, GAE1 and GAE2 did not activate together any more than did two copies of either element (data not shown). These results suggest that one reason for differential repression of the GAEs and GAL4 sites in UASG may be that the high activity afforded by synergy between four GAL4-binding sites effectively overcomes repression by the GAL operators, whereas the inefficient activity of GAE1 and GAE2 does not. Surprisingly, certain natural GAL4 sites activated the GAL] promoter independently of GAL4 and galactose (Table 2). This constitutive activity may be due to the presence of part of GAE1, which resides within UASG-75 (10), overlapping GAL4 site 1, site 2, or both. The GAE1-like activity of the two GAL4 sites, however, differed somewhat from the GAE1 activity of UASG-75. GAL4 site 1 activity, for example, was nearly undetectable in Gly medium but increased signficantly when glucose was present. GAL4 site 2 activity was about the same in Glu medium as in Gly medium, though it was significantly lower than the GAE1 activity of UASG-75. These results suggest that GAE1 has a
complex structure, possibly with binding sites for several regulatory proteins (see Discussion). GAL4 site 3 had no GAL4-independent activity, suggesting that a GAL4-binding site per se is not recognized by the putative protein(s) that facilitates GAE1 activity. GAL4 activity is repressible by GAL operators. Interestingly, activation of the GAL] promoter by three GAL4 sites
TABLE 2. Activation of a UAS-less GAL] promoter by individual GAL4 sites versus GAEs J-Galactosidase activity (U) inb: Plasmida
pRY131 121-632 632-75-1 632-37a-1 632-37a-2 632-37a-3 632-17a-1 632-17a-2 632-17a-3 632-19a-1 632-19a-2 632-19a-3 632-17b-1 632-17b-2 632-17b-3
Regulatory site(s)
Wild-type UASG UASG deletion
GAE,C
GAE2
GAL4 site 1 GAL4 site 2
GAL4 site 3
1 1 2 3 1 2 3 1 2 3 1 2 3
Gal
Gly
Glu
Copies Agal4
GAL4
AgaI4
GAL4
Agal4
GAL4
O.1 sO.1 120 30
'0.1
-O.1 0.2 80
.0.1
'0.1
0.3 50 10 50 100 0.3 0.9 4.0 5 14 200
0.2 40 15 35 100 0.2 1 10 5 20 40 0.2 0.3 0.3
3,000 s0.1 3,800
60 100 20 450 900 20 25 40
s0.1 0.3 0.5
0.7 130 30 60 180 60 600 800 20 50 200 0.3 1 3
10 40 60 0.3 0.9 2 9 28 35
