ISSN 1672-9145
Acta Biochimica et Biophysica Sinica 2006, 38(8): 571–576
CN 31-1940/Q
Optimized Adaptor Polymerase Chain Reaction Method for Efficient Genomic Walking Peng XU1,2, Rui-Ying HU1,2, and Xiao-Yan DING1* 1
Laboratory of Molecular and Cell Biology and Laboratory of Stem Cell Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China; 2 Graduate School of the Chinese Academy of Sciences, Shanghai 200031, China
Abstract Genomic walking is one of the most useful approaches in genome-related research. Three kinds of PCR-based methods are available for this purpose. However, none of them has been generally applied because they are either insensitive or inefficient. Here we present an efficient PCR protocol, an optimized adaptor PCR method for genomic walking. Using a combination of a touchdown PCR program and a special adaptor, the optimized adaptor PCR protocol achieves high sensitivity with low background noise. By applying this protocol, the insertion sites of a gene trap mouse line and two gene promoters from the incompletely sequenced Xenopus laevis genome were successfully identified with high efficiency. The general application of this protocol in genomic walking was promising. Key words
optimized adaptor PCR; touchdown PCR; genomic walking; gene trap; promoter
In the postgenomic era, one major challenge is the functional characterization of single gene. The gene trap method, using mouse embryonic stem cells and a reporter vector randomly integrated into the genome, is a useful tool to find novel genes and study their biological function [1]. To verify the precise integration site, rapid and efficient genomic walking is required for cloning the flanking sequences near to a gene trap vector. The traditional approach is to screen the genomic library using a specific probe, however, this strategy is laborious and time-consuming. Several PCR-based methods for isolating unknown DNA fragments flanking a known sequence have been developed. They are: (1) inverse PCR [2], which uses a pair of reversed primers to amplify DNA sequences in self-circularized genomic fragments, but it meets the limitation of restriction site distribution; (2) randomly primed PCR [3–6], which amplifies with a known sequence-specific primer and an arbitrary primer, but the non-specific amplification blocks its application; and (3) ligation-mediated PCR [7–15]. The adaptor PCR method, Received: March 20, 2006 Accepted: April 29, 2006 This work was supported by a grant from the National Key Project for Basic Science Research of China (2001CB509901) *Corre sponding a u thor: Tel, 8 6 -2 1 -5 4 9 2 1 4 11 ; Fa x, 8 6 -2 1 54921011; E-mail,
[email protected]
which uses an adaptor ligated to a genomic fragment, was carried out with a locus-specific primer and an adaptorspecific primer. As this involved the use of the adaptorspecific primer, the amplification of adaptor itself leads to the generation of a high level of background noise. Several improved protocols have emerged to overcome the drawbacks, but they are either complicated or inefficient. In this study, we describe an optimized adaptor PCR protocol developed recently with the application of an optimized touchdown PCR program. Using this protocol, the flanking sequences of a gene trap vector and two promoters from the tetraploid animal Xenopus laevis were successfully and rapidly isolated. The results indicated that the optimized adaptor PCR would be valuable for genomic walking.
Materials and Methods Isolation of genomic DNA and restriction enzyme digestion Genomic DNA was extracted from mouse tail or DOI: 10.1111/j.1745-7270.2006.00194.x
©Institute of Biochemistry and Cell Biology, SIBS, CAS
572
Acta Biochim Biophys Sin
Xenopus liver as previously described [16]. Briefly, homogenized tissues were digested by proteinase K overnight at 55 ºC. The genomic DNA was extracted twice with phenol/chloroform, precipitated by ethanol, then washed with 75% ethanol and finally dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). The quality of DNA was determined by the ratio of A 260/A 280. One microgram of genomic DNA was digested overnight with 10 U of appropriated restriction enzyme (New England Biolabs, Ipswich, USA) in 200 μl volume. Oligonucleotide primers and adaptor The specific primers for each walking step were designed based on the known sequence. Primers for the gene trap vector were: GT1, 5'-CTCACCTTGCTCCTGCCGAGAAAGTATCCA-3'; GT2, 5'-CGGAATTCGGGCTGACCGCTTCCTCGTGCTTTA-3'. Primers for the Xenopus PAPC gene were: PAPC1, 5'-CTCAGCTGCCCATCACTCTCACGGACT-3'; PAPC2, 5'-CAATTACAGTGCCAGGGGGTTCTTCTTC-3'. The upper strand for the BamHI-specific adaptor was 5'-GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGTCTAG-3', and the upper strand for the HindIIIspecific adaptor was 5'-GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGTTCGA3'. The lower strand for the adaptor was 5'-PO4-AGCTTACCAGCCC-NH2-3'. Adaptor primer AP1 was 5'GTAATACGACTCACTATAGGC-3' and adaptor primer AP2 was 5'-ACAATAGGGCACGCGTGGT-3'. The 5' end of the down strand of the adaptor was phosphorylated and an amino group at the 3' end was modified. The same amount of upper strand and down strand of the adaptor were denatured at 80 ºC for 10 min, then annealed at room temperature for 30 min. Generation of DNA adaptor-linked digests The ligation mixture contained 1 μg of digested genomic fragment, 1 U of T4 DNA ligase (New England Biolabs) and 50 mM adaptor in T4 DNA ligase buffer. The ligation reaction was carried out overnight at 16 ºC. The genomic fragments ligated to the enzyme-specific adaptor were purified.
Vol. 38, No. 8
was: denaturing at 94 ºC for 30 s, annealing at 70 ºC for 30 s with extension at 72 ºC for 4 min. The annealing temperature was reduced by 0.5 ºC per cycle. PCR parameters for the proceeding 30 cycles were: denaturing at 94 ºC for 30 s, annealing at 60 ºC for 1 min with extension at 72 ºC for 4 min, and the final extension at 72 ºC for 5 min. The second-round PCR was carried out in a 50 μl reaction mixture containing 1 μl of the first-round PCR product diluted 1:100, 2.5 U of LA buffer II (Mg2+ plus), 250 μM dNTP, 10 pM AP1, 10 pM GSP2, and 2.5 μl of LA Taq polymerase. The PCR program was the same as indicated above. The second-round PCR product was run on a 1% agarose gel. Each band was isolated by Gel Cleanup (Eppendorf, Hamburg, Germany) and cloned into pGEM-T easy vector (Promega, Madison, USA). The positive clones were sequenced with ABI PRISM 377 by Shanghai Biotech Company (Shanghai, China). Southern blot To produce a Southern blot probe specific to the gene trap vector, the neomycin resistance gene was amplified and the genomic DNA from the gene trap mouse line was prepared and digested overnight with HindIII and EcoRI restriction enzymes. Digested DNA (10 μg per lane) was run on a 0.8% agarose gel and transferred to Hybond N+ nylon membrane (GE Healthcare, Piscataway, USA) and hybridized by a 32P-labeled probe using the Prime-a-Gene labeling kit (Promega). The membrane was washed twice before autoradiographing at 70 ºC. Sequence analyses The sequence data were analyzed using the Editseq program from the DNASTAR nucleotide sequence analysis package (DNASTAR, Madison, USA) and searched in the mouse genome using the BLAST program (http://www. ncbi.nlm.nig.gov/blast).
Results
PCR amplification and cloning of products
Application of touchdown PCR program for genomic walking
The first-round PCR amplification was carried out in a 50 μl of reaction mixture containing 5 μl of LA buffer II (Mg2+ plus), 250 μM dNTP, 10 pM GSP, 10 pM AP1, 100 ng of adaptor-ligated genomic DNA, and 2.5 U of LA Taq polymerase (TaKaRa, Takara, Japan). After pre-denaturing at 94 ºC for 3 min, the condition of the first 5 cycles
To analyze the precise insertion site of a gene trap vector, the genomic walking from the gene trap vector is required. We found that all published protocols have their disadvantages. Obviously, the traditional way of screening the genomic library is time-consuming. Also the inverse PCR and randomly primed PCR methods have not been
©Institute of Biochemistry and Cell Biology, SIBS, CAS
Aug., 2006
Peng XU et al.: Optimized Adaptor PCR-based Method for Efficient Genomic Walking
generally applied to walk in uncloned genomic DNA. An improved adaptor PCR, which used a special adaptor, was reported to walk upstream from one exon. However the protocol was very inefficient so that its application was limited [17]. Although several attempts were made to increase its sensitivity, the method became increasingly complicated and the application was also limited [7]. According to this protocol (Table 1, protocol 1) we attempted to identify the flanking sequence of a gene trapping mouse line, 8A21, but failed to get any amplified products [Fig. 1 (A), lane 1]. Touchdown PCR is a method of PCR by which degenerate primers are used to avoid amplifying nonspecific sequences [18]. It not only increases specificity but also enhances yield. Its applications in genomic walking have been mentioned in some published works [19]. However there is no published report on applying the touchdown PCR to the adaptor PCR method. We then thought to combine these two methods in order to increase the PCR efficiency. The combination of touchdown PCR to adaptor PCR (Table 1, protocol 2) indeed increased the yield of PCR products, but its smear pattern in agarose gel argues the amplification specificity of this protocol [Fig. 1 (A), lane 2]. In the classic touchdown program, the annealing temperature is reduced by 2 ºC per cycle, and this is the parameter we used in protocol 2. However, we have accumulated data indicating that scaling down the touchdown PCR parameters, in terms of slowly reducing the annealing temperature, was the key step in keeping the
Table 1
573
specificity of the touchdown PCR program (unpublished data). We then developed the third protocol, in which the annealing temperature was lowered by 0.5 ºC per cycle (Table 1, protocol 3) and found it worked perfectly in producing sharp PCR products [Fig. 1(A), lane 3]. Three bands of 3.4 kb (F1), 2.1 kb (F2) and 300 bp (F3) in length were obtained from the gene trapping mouse line, 8A21. Sequence analysis showed that one of the three specific bands, F1 [Fig. 1(A), lane 3], contained a 597 bp trapping vector sequence in reverse to a 3.2 kb trapping vector sequence, indicating the two trapping vectors tandemly, but reversely, integrated into the genome [Fig. 1(B), F1]. The second, F2, contained the 597 bp trapping vector sequence together with a 1.5 kb sequence; and we searched the currently available mouse genome database using the BLAST program, and it revealed that the trapping vector was inserted into mouse chromosome 4 A5 loci encoding a P4 ATPase [Fig. 1(B), F2]. F3 was a nonspecific amplificon. Thus, two insertion sites, with their flanking sequences, were identified only by our optimized adaptor PCR. Southern blot analysis was carried out using the gene trap vector-specific probe to identify the number of insertion sites. The genomic DNA extracted from the gene trap mouse line was digested with HindIII or EcoRI restriction enzyme and transferred onto the nylon membrane. Two insertion sites were characterized, as shown in Fig. 1(C). This result supports the fact that optimized adaptor PCR can accurately identify multiple trapping vector insertion sites.
Comparison of three adaptor protocols for genomic walking
Protocol
Step 1
Step 2
Step 3 (the 1st-round PCR)
Step 4 (the 2nd-round PCR)
1 [17]
Ligation of genomic DNA with adaptor
94 ºC, 1 min, 1 cycle; 94 ºC, 30 s, 68 ºC, 6 min, 35 cycles; 68 ºC, 15 min, 1 cycle
94 ºC, 1 min, 1 cycle; 94 ºC, 30 s, 68 ºC, 6 min, 35 cycles; 68 ºC, 15 min, 1 cycle
2
Isolation and digestion of high quality genomic DNA As above
As above
3
As above
As above
94 ºC, 3 min, 1 cycle; 94 ºC, 30 s, 70 ºC, 30 s, lowered by 2 ºC per cycle, 72 ºC, 4 min, 5 cycles; 94 ºC, 30 s, 60 ºC, 1 min, 72 ºC, 4 min, 30 cycles; 72 ºC, 5 min, 1 cycle 94 ºC, 3 min, 1 cycle; 94 ºC, 30 s, 70 ºC, 30 s, lowered by 0.5 ºC per cycle, 72 ºC, 4 min, 5 cycles; 94 ºC, 30 s, 60 ºC, 1 min, 72 ºC, 4 min, 30 cycles; 72 ºC, 5 min, 1 cycle
94 ºC, 3 min, 1 cycle; 94 ºC, 30 s, 70 ºC, 30 s, lowered by 2 ºC per cycle, 72 ºC, 4 min, 5 cycles; 94 ºC, 30 s, 60 ºC, 1 min, 72 ºC, 4 min, 30 cycles; 72 ºC, 5 min, 1 cycle 94 ºC, 3 min, 1 cycle; 94 ºC, 30 s, 70 ºC, 30 s, lowered by 0.5 ºC per cycle, 72 ºC, 4 min, 5 cycles; 94 ºC, 30 s, 60 ºC, 1 min, 72 ºC, 4 min, 30 cycles; 72 ºC, 5 min, 1 cycle
PCR, polymerase chain reaction.
http://www.abbs.info; www.blackwellpublishing.com/abbs
574
Acta Biochim Biophys Sin
Fig. 1
Vol. 38, No. 8
Identification of gene trap insertion site using the optimized adaptor polymerase chain reaction (PCR) method
(A) After second-round amplification of three different adaptor PCRs, the PCR products were separated by gel electrophoresis. 1, original adaptor PCR; 2, conventional touchdown PCR combined with adaptor PCR; 3, optimized touchdown PCR combined with adaptor PCR. Three bands (F1, F2 and F3) of the second-round optimized adaptor PCR were obtained from the gene trap 8A21 mouse line. (B) Alignment of F1 and F2 with gene trap vector and mouse genome. BamHI adaptor and GT2 and AP2 primer positions are shown. (C) Southern blot results of HindIII and EcoRI cut 8A21 mouse line genomic DNA probed with gene trapping vector.
It requires only two rounds of PCR to get mouse gene trap insertion sites, which is much quicker than all previously reported methods for cloning flanking sequences. The rapid and efficient simultaneous cloning of multiple insertion sites indicates that the optimized PCR would be a useful tool to verify gene trap insertion sites. Cloning PAPC promoter from Xenopus laevis Encouraged by the rapid cloning of the trapping insertion site, we then used the optimized adaptor PCR protocol to isolate the promoter of the X. laevis PAPC gene, as the
Fig. 2
genome of X. laevis has not yet been sequenced. Two specific primers, PAPC1 and PAPC2, were designed based on the sequence adjacent to the Xenopus PAPC transcription start site. The genomic DNA was isolated from the Xenopus liver and digested with a restriction enzyme, HindIII. The purified genomic fragments were ligated to the HindIII adaptor. Three protocols with different PCR conditions as shown in Table 1 were also simultaneously applied for genomic walking. After two rounds of PCR, the PCR products were analyzed by gel electrophoresis. As shown in Fig. 2(A), a band of approximately 5 kb was
Cloning of Xenopus laevis PAPC promoter using the optimized adaptor polymerase chain reaction (PCR) method
(A) Xenopus genomic DNA digested with the restriction enzyme HindIII and ligated with HindIII adaptor. 1, original adaptor PCR; 2, conventional touchdown PCR combined with adaptor PCR; 3, optimized touchdown PCR combined with adaptor PCR. A 5 kb fragment F was obtained in lane 3. (B) Alignment of F with Xenopus PAPC cDNA.
©Institute of Biochemistry and Cell Biology, SIBS, CAS
Aug., 2006
Peng XU et al.: Optimized Adaptor PCR-based Method for Efficient Genomic Walking
amplified from HindIII-specific adaptor-ligated genomic DNA [Fig. 2(A), lane 3]; while there was no obvious bands in the two former protocols [Fig. 2(A), lanes 1 and 2]. The specific band F was isolated and sequenced. Sequence analysis indicated that F was related to Xenopus PAPC promoter. We also used the same protocol to isolate the promoter of mespo, another Xenopus gene, and got the same sharp results (data not shown). In each case the whole procedure, from preparing tissues to obtaining sequences, took only one week. Thus, the feasibility of this approach in cloning sequences flanking a gene/vector from different genomes is evident.
575
especially multi-copy insertions; (2) isolating flanking sequences from known sequences, such as cloning a gene promoter from a cDNA fragment; (3) filling the gaps in genome sequencing; and (4) obtaining non-conserved regions of genes in uncharacterized species, according to the conserved sequences of reported genes. In our experiments, we found several key points for the successful application of the optimized adaptor PCR. First, the touchdown rate should be slow; in our case, the rate of 0.5 ºC worked perfectly in amplifying the target bands. Second, genomic DNA with a very high average molecular weight should be digested efficiently by enzyme. Finally, gene-specific primers should be highly specific, preferably approximately 25–30 nucleotides long, and hairpin sequences and primer dimmers should be avoided.
Discussion Three kinds of PCR strategies were developed for chromosome walking: inverse PCR [2]; random primer PCR [3–6]; and ligation-mediated PCR [8–15]. Inverse PCR is used less for chromosome walking because of the limitation of available restriction sites in the unknown/ known region or poor circularization of the template molecule. Ligation-mediated PCR and random primer PCR are more popular for chromosome walking. The latter is the simplest and most popular method for identification of T-DNA or transposon insertions, but its amplified products are generally small (1 kb) or to walk step by step, we usually resort to ligation-mediated PCR. However, this is an inefficient strategy because, in most cases, non-specific amplification accounts for the major proportion of the final PCR products. To increase its specificity, an improved adaptor PCR using a special adaptor has been developed [7]. However,the genomic complexity from different species and low effiencent PCR program would make amplification efficiency lower,blocking its applications. Several improved ligation-mediated PCRs increase the amplification efficiency but their manipulations are complicated. Here we combined the touchdown PCR with the adaptor PCR and scaled down the parameters, developing an optimized touchdown PCR protocol. Slowly lowering the annealing temperature makes primers find their targets precisely, so they yield specific products efficiently. By simple modification of the PCR program, our optimized touchdown PCR protocol could largely improve the application of adaptor PCR in genome research. We believe that the optimized adaptor PCR is a powerful tool in the following genome-related experiments: (1) identifying gene trap or other transgenic vector insertion sites,
Acknowledgements We thank Dr. Babara I. MEYER and Dr. Ulrike TEICHMANN (Department of Molecular Cell Biology, Max-Plank Institutes of Biophysical Chemistry, Gotingen, Germany) for kindly providing gene trap mouse lines and Dr. Yuan-Xin HU (Institutes of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China) for technical help with Southern blot. We are also grateful to Dr. Xu-Dong ZHAO (Department of Medical Genetics, Shanghai Jiaotong University School of Medicine, Shanghai, China) for discussion. We thank Dr. Cheng-Fu SUN and Dr. Shuang-Wei LI (Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences) for their critical reading of this manuscript.
References 1 Cecconi F, Meyer BI. Gene trap: A way to identify novel genes and unravel their biological function. FEBS Lett 2000, 480: 63−71 2 Keim M, Williams RS, Harwood AJ. An inverse PCR technique to rapidly isolate the flanking DNA of dictyostelium insertion mutants. Mol Biotechnol 2004, 26: 221−224 3 Parker JD, Rabinovitch PS, Burmer GC. Targeted gene walking polymerase chain reaction. Nucleic Acids Res 1991, 19: 3055−3060 4 Liu YG, Whittier RF. Thermal asymmetric interlaced PCR: Automatable amplification and sequencing of insert end fragments from P1 and YAC clones for chromosome walking. Genomics 1995, 25: 674−681 5 Liu YG, Mitsukawa N, Oosumi T, Whittier RF. Efficient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J 1995, 8: 457−463 6 Terauchi R, Kahl G. Rapid isolation of promoter sequences by TAIL-PCR:
http://www.abbs.info; www.blackwellpublishing.com/abbs
576
7
8
9
10
11
12
Acta Biochim Biophys Sin The 5'-flanking regions of Pal and Pgi genes from yams (Dioscorea). Mol Gen Genet 2000, 263: 554−560 Siebert PD, Chenchik A, Kellogg DE, Lukyanov KA, Lukyanov SA. An improved PCR method for walking in uncloned genomic DNA. Nucleic Acids Res 1995, 23: 1087−1088 Garrity PA, Wold BJ. Effects of different DNA polymerases in ligationmediated PCR: Enhanced genomic sequencing and in vivo footprinting. Proc Natl Acad Sci USA 1992, 89: 1021−1025 Warshawsky D, Miller L. A rapid genomic walking technique based on ligation-mediated PCR and magnetic separation technology. Biotechniques 1994, 16: 792−794, 796, 798 Rosenthal A, Jones DS. Genomic walking and sequencing by oligo-cassette mediated polymerase chain reaction. Nucleic Acids Res 1990, 18: 3095−3096 Rosenthal A, MacKinnon RN, Jones DS. PCR walking from microdissection clone M54 identifies three exons from the human gene for the neural cell adhesion molecule L1 (CAM-L1). Nucleic Acids Res 1991, 19: 5395− 5401 Sterky F, Holmberg A, Alexandersson G, Lundeberg J, Uhlen M. Direct sequencing of bacterial artificial chromosomes (BACs) and prokaryotic
Vol. 38, No. 8
genomes by biotin-capture PCR. J Biotechnol 1998, 60: 119−129 13 Mueller PR, Wold B. In vivo footprinting of a muscle specific enhancer by ligation mediated PCR. Science 1989, 246: 780−786 14 Jones DH, Winistorfer SC. Sequence specific generation of a DNA panhandle permits PCR amplification of unknown flanking DNA. Nucleic Acids Res 1992, 20: 595−600 15 Dai SM, Chen HH, Chang C, Riggs AD, Flanagan SD. Ligation-mediated PCR for quantitative in vivo footprinting. Nat Biotechnol 2000, 18: 1108− 1111 16 Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. 3rd ed. New York: Cold Spring Harbor Press 2001 17 Reddy MK, Nair S, Sopory SK. A new approach for efficient directional genome walking using polymerase chain reaction. Anal Biochem 2002, 306: 154−158 18 Don RH, Cox PT, Wainwright BJ, Baker K, Mattick JS. “Touchdown” PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res 1991, 19: 4008 19 Levano-Garcia J, Verjovski-Almeida S, da Silva AC. Mapping transposon insertion sites by touchdown PCR and hybrid degenerate primers. Biotechniques 2005, 38: 225−229
Edited by Ming-Hua XU
©Institute of Biochemistry and Cell Biology, SIBS, CAS
