Several (but not all) Plasmodium berghei chromosomes bear in the subtelomeric position a cluster of ... Genome organization in Plasmodium species, the caus-.
Vol. 10, No. 5
MOLECULAR AND CELLULAR BIOLOGY, May 1990, p. 2423-2427 0270-7306/90/052423-05$02.00/0
Copyright C 1990, American Society for Microbiology
Organization of Subtelomeric Repeats in Plasmodium berghei E. DORE, T. PACE, M. PONZI, L. PICCI, AND C. FRONTALI*
Laboratory of Cell Biology, Istituto Superiore di Sanita, Rome, Italy Received 4 August 1989/Accepted 2 February 1990
Several (but not all) Plasmodium berghei chromosomes bear in the subtelomeric position a cluster of 2.3-kilobase (kb) tandem repeats. The 2.3-kb unit contains 160 base pairs of telomeric sequence. The resulting subtelomeric structure is one in which stretches of telomeric sequences are periodically spaced by a 2.1-kb reiterated sequence. This periodic organization of internal telomeric sequences might be related to chromosome-size polymorphisms involving the loss or addition of subtelomeric 2.3-kb units.
repeat family is irregularly distributed over different chromosomes in a strain-specific fashion (17). The purpose of the studies described here is to better characterize the localization and distribution of the 2.3-kb repeats in the P. berghei genome. To this purpose, we analyzed in detail the junction between the telomeric (7-bp) repeats and the portion of the 2.3-kb unit present in our original telomeric clone (22). This junction region was found to be identical to the subfragment of the 2.3-kb units carrying a stretch of telomeric repeats. It was thus shown that, at least in that case, the 2.3-kb repeat is directly adjacent to and actually overlapping the telomeric structure. We next investigated whether immediate subtelomeric localization is a general rule for the 2.3-kb repeat family of P. berghei. The junction between telomeric repeats and the 2.3-kb unit in pTel.l. Figure 1 illustrates the relation between the restriction map of our original telomeric clone pTel.1 (22) and that of the 2.3-kb unit. Only the latter unit (actually 2,268 bp long) had been completely sequenced (17) (GenBank accession number, M19300). Homology between subfragments d and 8, c and -y, b and , and a and a had been demonstrated by cross-hybridization (17), but in the case of the latter pair, hybridization between telomeric repeats in a and telomere-related motifs in a might have masked possible differences in the nonrepeated parts. Because of the lack of restriction sites, only part of subfragment a had been sequenced (22), and the region representing the chromosomal junction to the telomeric motifs could not be analyzed in detail. This gap has now been eliminated by extending the sequence analysis from the proximal end of the a fragment to the beginning of the actual telomere. Figure 2 shows the optimal alignment between the complete a sequence and the proximal portion of the a region. Starting from the proximal TaqI site, an almost perfect homology (98%) extends down to nucleotide 428 of the a sequence (corresponding to nucleotide 423 of the a sequence) where, in both cases, telomeric repeats set in. Though variations in the heptanucleotide repeat reduce the homology to 82% from this point onward, the two sequences still remain very closely related. Curiously enough, the 27-bp unit built up of telomeric repeat variants which appears in three perfect tandem copies in this region of the a sequence has a perfect homolog in the corresponding a region. From nucleotide 595 of the a sequence onward, unresolved heptanucleotides continue to be discernible in a as a
Genome organization in Plasmodium species, the causative agents of malaria, became accessible to molecular biology studies only after the introduction of pulsed-field electrophoresis (PFGE). In the absence of cytogenetic evidence, the only definition of chromosomal entities which can be given at present depends on the PFGE resolution of chromosome-size DNA molecules. As soon as PFGE molecular karyotypes were available, an exceptionally high degree of chromosome-size polymorphism among pure plasmodial populations became apparent. It is important to understand the origin of this extreme genomic plasticity, since rapid changes in genomic makeup may represent one of the ways by which the parasite continually thwarts the strategies of attack devised to control the spread and the severity of a disease which still represents one of the world's major health problems. Several lines of recent experimental evidence (4, 12, 18, 20, 21, 23, 25, 29) emphasize the instability particularly affecting the organization of telomere-adjacent regions in plasmodia. Long-range physical mapping, restriction fragment-length polymorphisms, and loss of telomericaily located genetic markers all lend support to the view that deletions or rearrangements in subtelomeric regions contribute to, if they do not completely account for, the size variations observed for chromosome-size DNA molecules in PFGE. Subtelomeric regions are known to be preferential sites for genomic rearrangements in other lower eucaryotes, in particular in Saccharomyces cerevisiae (10) and in Trypanosoma species (reviewed in reference 2). This fact prompted us, some years ago, to start to look for telomeric sequences in Plasmodium species which would also allow the exploration of subtelomeric portions. The first telomeric fragment (pTel.1) cloned from Plasmodium berghei (22) contained a series of tandem 7-base-pair (bp) repeats (which later proved to be present in all the chromosomes of all the Plasmodium species tested [5, 13, 16]) and part of the basic element of a 2.3-kilobase (kb) repeat family. We subsequently cloned (in pUC8, using either HindlIlor BamHI- unique sites) the 2.3-kb unit (17) and showed it to be specific to P. berghei, in which it is present in several hundred copies, mostly in tandem organization. The basic 2.3-kb element contains a series of telomere-related motifs (17) and a bent DNA region (6). Furthermore, hybridization to molecular (PFGE) karyotypes indicated that the 2.3-kb
*
Corresponding author. 2423
MOL. CELL. BIOL.
NOTES
2424
o I
T HT V II i. .i
a
b
S
T S i i d
c
T T
FIT
I
200 bp p
iI
y
T
11
VIIA
I 6
U
T S
y
a
x
FIG. 1. Restriction maps of pTel.1 (above) and the 2.3-kb repeat unit (below) are shown in the correct alignment. Hatched areas indicate regions of telomeric repeats. D, DraI; T, TaqI; S, Sau3A; H, HindIlI. Latin and Greek letters identify TaqI subfragments.
regular ladder of GGG groups, while the a sequence is interrupted by the TaqI site not present in a (17) (Fig. 1). It has thus been confirmed that in pTel.1, the 2.3-kb repeat is directly joined to the telomeric structure. The latterappears to consist of -140 heptanucleotide repeats (see also reference 22) which correspond approximately to 1 kb. No significant homology was found either with the pPftel. 1 sequence directly joined to telomeric repeats in the Plasmodium falciparum clone described by Vernick and McCutchan (26) or with the rep20 repeat (1, 15) located near the ends of P. falciparum chromosomes (4, 18). Distribution of 2.3-kb repeats in P. berghei genome. The next question to be answered is whether the subtelomeric localization of the 2.3-kb element observed in pTel.1 is a general feature of this tandem repeat family. To investigate this point, we compared the hybridization patterns lit up by (i) a 2.3-kb probe obtained by recovering the insert from a (HindIII) recombinant clone (17) and (ii) a purely telomeric probe (described below) on digests of total genomic DNA or of isolated chromosomes. Because of the presence of short (160-bp) telomeric stretches within the 2.3-kb element, a probe specific for Taq I
a:
'IC-GECAANTACAACATTATCTATAAAAGATGTTTTATACATCTAACATTTTTAGTAATAC
11111111A1ACAACTTATTATAAA 1ATGTTTATCATCAACATTTTAGAATA TACAACATTATCTAT4AAAAGATGTTTTATACATCTAACATTTTTAGTAATAC
1111111
Xa: .TCGAl
AA
61 60
ATAAAAAATACACTATATATATGTGTATAATAAATTCATAAATTATAAATATATATAATA
121
ATCACTTTTTTAATTTCAATAATTTACATTTATGTTAAAATTATAATTTATATTGATATA
120
CTCACTTTTTTAATTTCAATAATTTACATTTATGTTAAAATTATAATTTATATTGATATA
11
1o
1,1|11 1||1||111111111111111111111111 AATAGTTCTCTATATATTAATTTATTTACTATAAAGGTATAATAATATATTAATCACTAT
241
TAATTTATAAATTTGATAGTTTTGAGGTATAAATAAATTATA*TTAAATAGTT
240
TAATTTATAAATTTGATAGTTTTGAGGTATAAATAAATTATATTTTAAiTAGTTAAAATA Dra I
AAATA
11111
300
T AATATAT AAT AAATGTAATGTCATA TTTTCTATAATACTTATAAACAATTC GTA III Ilt1 1111111 III IIIIIIIIIIIIIII
300
TAAATATATAAATAAAATGTAATGTCATATTTTTCTATAATACTTATAAACAATTCGGTA
355 360 415
420 470
TATAAAATTAGCGTTATTGTACTAATATATATAATATTGTATCAATGACTAAAACTGAAA ii ii itit I 1 11 11 11 1 1 1 111 11 11 11 11 IIIIIIIIII III 111III III I1111111 I11III
TATAAAATTAGCGTTATTGTACTAATATATATAATATTGTATCAATGACTAAAACTGAA
TATGTTAATTT GGtTTA SGGTTTAT9GTTCA GGTTTA GGTTTNTGTTAGGO TY 11111111111 o111111 filIlllIllill 111111 11111 1li111l111 11
TATGTTAATTTGGGTTTAGGGGTTTATGGTTCAGGGTTTAGGGTTTGTGGTTTAGGGTTT SGTTTATGGTTCA TTAGSTTCAGGT CAGGYTTATGGTTCAW4rTTAGGGTTCA 1oil lolilioilt HIM11 Iloilo 111111 111111 1111 ItIIti
490
GTG TTAGMTTCA OGYTTATGYT
529
T TA
TTAGGGTTCAGGGTTCA6GTTTAGGGT Toq I
-____________
III
539
TTCAl#W
111
TTAGGGTTTGTGGTTTAGGSTTTATGGTCTATGGTTGITW
111111
111111
1III
11111111
III
111111
1
TTAGGGTTTAGGGTTCAGGGTTCAGGGTTCAGTTTAGGGTTTAGGGTTTAGG
FIG. 2. Sequence homology between subfragment a (odd-numbered lines) and the proximal part of subfragment a (even-numbered lines). TaqI and DraI sites are indicated. The 27-bp motifs are boxed. The arrow indicates the start of telomeric heptanucleotide repeats. The region immediately preceding this point is referred to in the text as the junction region.
*#
U
FIG. 3. FIGE molecular karyotype (center panel) and blot hybridization to the pTB4.1 probe (left panel) and the 2.3-kb probe (right panel) for a cloned population of P. berghei ANKA (clone Antwerp 8417). The insert shows OFAGE resolution of low-molecular-weight chromosomes, as revealed by pTB4.1 chromosome labeling. All hybridizations were followed by highly stringent washes (see text). Numbers to the right show the size in megabases (Mb); numbers to the left are the chromosome numbers.
telomeres should consist of a sufficiently long series of (7-bp) telomeric repeats so as to withstand high stringency conditions. For this reason, rather than resorting to synthetic oligonucleotides, we subcloned part of our original telomeric clone (22) into a pUC8 vector. The procedure, described in detail elsewhere (M. Ponzi, C. J. Janse, E. Dore, R. Scotti, T. Pace, T. J. F. Reterink, F. M. van der Berg, and B. Mons, Mol. Biochem. Parasitol., in press), involved linearization of pTel.1 and then step-wise digestion with Bal 31. The final construct, pTB4.1, contains a 550-bp insert consisting of 71 copies of the TT(T/C)AGGG repeat typical of Plasmodium telomeres, plus 49 bp of the original pBR322 vector. Under highly stringent washes (two times 20 min in 5 x SSC [lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate], 2x SSC, lx SSC, and 0.1x SSC in the presence of 0.1% sodium dodecyl sulfate, at 65°C), the labeling of chromosome bands by the telomeric probe is independent of their hybridization to the 2.3-kb probe (Fig. 3). The molecular karyotype presented in the central panel of Fig. 3 is that of a pure line of P. berghei ANKA (clone 8417, obtained in Antwerp and made available to us by M. Wery). Inverted field (FIGE) separation was achieved by a 72-h run, during which the pulse duration was increased from 24 to 384 s. Forward and backward pulse voltages were 100 and 33 V, and 0.5x TBE (0.5x TBE is 0.0445 M Tris plus 0.0445 M boric acid plus 0.1 mM EDTA) was used as the buffer solution. These electrophoretical conditions are such that even the largest plasmodial chromosomes enter the gel but are not the best ones for low-molecular-weight chromosomes. The latter are better resolved with an OFAGE system (under the conditions described in reference 17), as shown by the insert in the left panel of Fig. 3. Accurate densitometric analysis (Ponzi et al., in press) allows us to state that the more intensely fluorescent bands correspond to
NOTES
VOL. 10, 1990 c
1i
3
a
D
2425
c IS
--.
RI-U
:.
goo
1
A
a
4W
-01
I 0
\x.3 kb pTB 4.1 FIG. 4. HaeIII digests of genomic (agarose-embedded) DNA from P. berghei ANKA clones from Edinburgh (a), from Antwerp 8417 (b), and from Antwerp 8458 (c). The blot was hybridized at high stringency first to the telomeric pTB4.1 probe (left panel) and then to the 2.3-kb probe (right panel). X
of unresolved chromosomes (chromosomes 5 and 6, well-separated under OFAGE conditions; chromosomes 9, 10, and 11; chromosomes 13 and 14). This is confirmed by the higher label intensity after hybridization to the PTB4.1 probe (Fig. 3, left panel). By comparing the hybridization proffles with the telomeric and the 2.3-kb probe (Fig. 3, left and right panels, respectively), it can be clearly seen that individual 2.3-kb-rich chromosomes (e.g., chromosome 7) are labeled by the pTB4.1 probe to the same intensity level as 2.3-kb-negative chromosomes are (e.g., chromosomes 4 or 8). Conversely, the 2.3-kb probe cannot label telomeres, as shown by the absence in the left-hand panel of several chromosomal bands. Cross-hybridization between the two probes thus does not take place under the stringency condi-
groups
tions used. As a first step in testing colinearity between telomeric sequences and 2.3-kb elements in the P. berghei genome, we then probed at high stringency total genomic digests of different cloned lines with the purely telomeric (pTB4.1) and the 2.3-kb probes. Figure 4 shows the results obtained by restricting with HaeIII (an enzyme which has no recognition site within the 2.3-kb unit) total DNA from three P. berghei ANKA clones, one isolated in Edinburgh and kindly donated by D. Walliker and two (named 8417 and 8458) isolated in Antwerp and kindly donated by M. Wery. HaeIII digestion was carried out on DNA samples embedded in low-melting-point agarose blocks to reduce mechanical fragmentation. Separation in the range of 3 to 50 kb was achieved, using short (4-s) pulses in the LKB Pulsaphor apparatus. There are probably restriction fragments originated from different chromosomal extremities which comigrate under the electrophoretical conditions used. The hybridization results (Fig. 4, left and right panels) indicate that all the bands recognized by the 2.3-kb probe are also identified as being telomeric by the pTB4.1 probe. The reverse is not true, i.e., there are telomeres which do not carry 2.3-kb repeats in the immediate subtelo-
FIG. 5. Chromosome 7 of P. berghei ANKA clone 8417 recovered after FIGE separation of chromosomal bands (Fig. 3) was restricted with PvuII, run under contour-clamped homogeneous field conditions (center panel), and blotted and hybridized at high stringency, first to the pTB4.1 probe (left panel) and then to the 2.3-kb probe (right panel).
meric position, though all 2.3-kb clusters are colinear with telomeric sequences. A comparison of lanes a, b, and c in Fig. 4 reveals that a high degree of restriction site polymorphism affects the subtelomeric region. This contrasts with the good conservation in the organization of internally located repetitive and unique sequences (Ponzi et al., in press). The preliminary evidence derived from experiments performed on total digests was improved by testing with the above-described probe digests of individual chromosomes. This is done for P. berghei ANKA clone Antwerp 8417 by recovering chromosomal bands from FIGE or OFAGE gels (Fig. 3) in the form of small (Seakem GTG) agarose blocks, which were subsequently treated with enzymes which rarely cut and have no recognition site within the 2.3-kb units. Separation of fragments up to 500 kb was achieved with an LKB Pulsaphor apparatus equipped with a hexagonal attachment for contour-clamped homogeneous field electrophoresis (run, 19 h; pulses, 17 s, 250 V; buffer, 0.5x TBE). Figure 5 shows as a typical example the results obtained for chromosome 7, restricted with PvuII and hybridized at high stringency to the telomeric probe (left panel) and to the 2.3-kb probe (right panel). It can be seen that only the two restriction fragments (190 and 220 kb, respectively) which are identified as telomeric by pTB4.1 are positive to the 2.3-kb probe. The same is true (data not shown) for other isolated chromosomes containing 2.3-kb repeats (chromosomes 6 and 12). For unresolved groups of chromosomes (9 plus 10 plus 11 and 13 plus 14), the number of pTB4.1-positive fragments always corresponded to the expected number of chromosomal ends, and all 2.3-kb-positive fragments (two in each group) were again telomeric. Only two pTB4.1-positive fragments were present in chromosomes negative to the 2.3-kb probe, such as chromosomes 2, 3, 4, and 8. These results, clearly expected for linear chromosomes either not bearing 2.3-kb repeats or bearing them exclusively in the subtelomeric position, allow us to rule out the existence of internal clusters of 2.3-kb repeats, possibly still colinear with sequences recognized by the telomeric probe. Possible functional implications of subtelomeric repeats.
2426
NOTES
telomere
1Kb
.
2268 bp
2108 bp
FIG. 6. Periodic positioning of telomeric stretches (hatched areas) at the ends of P. berghei chromosomes carrying 2.3-kb (actually 2,268-bp) repeats.
Our data indicate that in P. berghei ANKA, several chromosomes bear members of the 2.3-kb tandemly repeated (17) family in a subtelomeric position and that at least in one case (pTel.1), the outmost 2.3-kb element actually overlaps the telomeric series of 7-bp repeats. The resulting subtelomeric structure, depicted in Fig. 6, is one in which 160 bp of telomeric sequence are periodically repeated (when proceeding from the telomere towards the interior of the chromosomes) in alternation with 2.1 kb of unrelated sequence. This structure is strikingly similar to that of the chromosomal extremities of the yeast S. cerevi-
siae (3, 28) in which telomeric (C1l3A)n sequences are intercalated between the Y' repeats (6.7 kb in length). As in plasmodia, the Y' repeats are distributed on several (but not all) chromosomes in a strain-specific way (30). Our data (Fig. 4) also reveal an extensive restriction site polymorphism in subtelomeric regions among different pure populations of P. berghei which also exhibit extensive chromosome-size polymorphisms (11). The observed variation in restriction fragment length might be explained by assuming that the number of 2.3-kb units, present on a given chromosomal extremity after the last HaeIII restriction site, may vary to a large extent. This interpretation is fully consistent with the results discussed in a separate paper (Ponzi et al., in press) which finds a significant correlation between the size of polymorphic chromosomal variants and their relative abundance in 2.3-kb repeats. This latter finding poses the question of what role is possibly played by 2.3-kb repeats in the genomic rearrangements leading to karyotype heterogeneity (11). The 2.3-kb repeats might be involved in the generation
of chromosome-size diversity in P. berghei by a variety of mechanisms involving pairing between subtelomeric repeated regions belonging to nonhomologous chromosomes and then crossover or conversion events. Such mechanisms could easily explain variations in the number of 2.3-kb copies among those chromosomal ends which already posses at least one copy of the basic 2.3-kb repeat unit. The peculiar structure revealed by the present study (Fig. 6), however, enables us to explain the observation (Ponzi et al., in press) that even chromosomal ends completely lacking 2.3-kb repeats can acquire them. In effect, a pairing event between a true telomeric sequence not flanked by 2.3-kb repeats and one of the internal telomeric stretches periodically positioned at the end of a different chromosome could promote the transfer of a variable extension of the periodic subtelomeric structure to an extremity initially lacking 2.3kb repeats. The mechanism involved might be similar to the one described by Dunn et al. (7) in the case of linear plasmids acquiring Y' sequences in yeast cells (strand invasion and conversion). The possibility that the dispersal of 2.3-kb elements takes place via excision, circularization, and integration, as has been found to be the case with yeast chromosomes expanding and contracting in units of Y' (9), cannot be excluded. In the case of yeasts, the periodic subtelomeric organization [(C1_3A)nY']m was taken as evidence in favor of the idea
MOL. CELL. BIOL.
that telomere growth involves recombinational events (27, 28). Whether telomere formation is mediated by recombination between DNA termini (19) or whether it involves exclusively untemplated telomere addition (8), possibly primed also by internal telomeric repeats (14, 24), is still an open question. However, whatever the mechanism(s) of telomere elongation, it is tempting to suggest that internal telomeric sequences such as those described in yeasts and now also in Plasmodium species may provide an easy mechanism for both chromosome-size reduction (by acting as alternative telomere growth-promoting regions) and chromosome-size increase (by promoting telomere conversion events). Thanks are due to P. Donini and B. Mons for advice and critical reading of the manuscript and to M. Wery, A. Said, and D. Walliker for making available to us their cloned lines. This work was supported by the Commission of European Communities (contract TS2-0082.I) in the framework of the "Science and Technology for Development" program.
LITERATURE CITED 1. Aslund, L., L. Franzen, G. Westin, T. Persson, H. Wigzeli, and U. Pettersson. 1985. Highly reiterated non-coding sequence in the genome of P. falciparum is composed of 21 base-pair tandem repeats. J. Mol. Biol. 185:509-516. 2. Borst, P., and D. R. Greaves. 1987. Programmed gene rearrangements altering gene expression. Science 235:658-667. 3. Chan, C. S. M., and B. K. Tye. 1983. Organization of DNA sequences and replication origins at yeast telomeres. Cell 33: 563-573. 4. Corcoran, L. M., J. K. Thompson, D. Walliker, and D. J. Kemp. 1988. Homologous recombination within subtelomeric repeat sequences generates chromosome size polymorphisms in P. falciparum. Cell 53:807-813. 5. Dore, E., T. Pace, M. Ponzi, R. Scotti, and C. Frontali. 1986. Homologous telomeric sequences are present in different species of the genus Plasmodium. Mol. Biochem. Parasitol. 21: 121-127. 6. Dore, E., T. Pace, M. Ponzi, R. Scotti, and C. Frontali. 1988. A site of intrinsic bending in a highly repeated element of P. berghei genome. Mol. Biochem. Parasitol. 27:201-206. 7. Dunn, B., P. Szauter, M. L. Pardue, and J. W. Szostak. 1984. Transfer of yeast telomeres to linear plasmid by recombination. Cell 39:191-201. 8. Greider, C. W., and E. H. Blackburn. 1989. A telomeric sequence in the RNA of Tetrahymena telomerase required for telomere repeat synthesis. Nature (London) 337:331-337. 9. Horowitz, H., and J. E. Haber. 1985. Identification of autonomously replicating circular subtelomeric Y' elements in Saccharomyces cerevisiae. Mol. Cell. Biol. 5:2369-2380. 10. Horowitz, H., P. Thorburn, and J. E. Haber. 1984. Rearrangements of highly polymorphic regions near telomeres of Saccharomyces cerevisiae. Mol. Cell. Biol. 4:2509-2517. 11. Janse, C. J., E. G. Boorsma, J. Ramesar, P. Van Vianen, R. Van der Meer, P. Zenobi, 0. Casaglia, B. Mons, and F. M. Van der Berg. 1989. P. berghei: gametocyte production, DNA content and chromosome-size polymorphism during asexual multiplication in vivo. Exp. Parasitol. 68:274-282. 12. Kemp, D. J., J. K. Thompson, D. Walliker, and L. M. Corcoran. 1987. Molecular karyotypes of P.falciparum: conserved linkage groups and expendable HRP genes. Proc. Natl. Acad. Sci. USA 84:7672-7676. 13. Langsley, G., L. Sibilli, D. Mattei, P. Falanga, and 0. Mercereau-Puialon. 1987. Karyotype comparison between P. chabaudi and P. falciparum: analysis of a P. chabaudi cDNA containing sequences highly repetitive in P. falciparum. Nucleic Acids Res. 15:2203-2211. 14. Murray, A. W., T. E. Claus, and J. W. Szostak. 1988. Characterization of two telomeric processing reactions in Saccharomyces cerevisiae. Mol. Cell. Biol. 8:4642-4650. 15. Oquendo, P., M. Goman, M. MacKay, G. Langsley, D. Walliker,
VOL. 10, 1990
16. 17.
18.
19.
20.
21. 22.
and J. Scaife. 1986. Characterization of a repetitive DNA sequence from the malaria parasite P. falciparum. Mol. Biochem. Parasitol. 18:89-101. Pace, T., and B. Mons. 1988. Detection of all human Plasmodium species by a telomeric fragment cloned from P. berghei. Bull. W.H.O. 66:759-762. Pace, T., M. Ponzi, E. Dore, and C. Frontali. 1987. Telomeric motifs are present in a highly repetitive element in the P. berghei genome. Mol. Biochem. Parasitol. 24:193-202. Patarapotikul, J., and G. Langsley. 1988. Chromosome size polymorphism in P. falciparum can involve deletions of the sub-telomeric pPFrep20 sequence. Nucleic Acids Res. 16:43314340. Pluta, A. F., and V. A. Zakian. 1989. Recombination occurs during telomere formation in yeast. Nature (London) 337: 429-433. Pologe, L. G., and J. V. Ravetch. 1986. A chromosomal rearrangement in a P. falciparum histidine-rich protein gene is associated with the knobless phenotype. Nature (London) 322: 474-477. Pologe, L. G., and J. V. Ravetch. 1988. Large deletions result from breakage and healing of P. falciparum chromosomes. Cell 55:869-874. Ponzi, M., T. Pace, E. Dore, and C. Frontali. 1985. Identification of a telomeric DNA sequence in P. berghei. EMBO J. 4: 2991-2995.
NOTES
2427
23. Sinnis, P., and T. E. Weliems. 1988. Long-range restriction maps of P. falciparum chromosomes: crossing over and size variation among geographically distant isolates. Genomics 3:287-295. 24. Szostak, J. W. 1989. The beginning of the ends. Nature (London) 337:303-304. 25. Vermick, K. D., D. Walliker, and T. F. McCutchan. 1988. Genetic hypervariability of telomere-related sequences is associated with meiosis in P. falciparum. Nucleic Acids Res. 16:6973-6985. 26. Vermick, K. V., and T. F. McCutchan. 1988. Sequence and structure of a P. falciparum telomere. Mol. Biochem. Parasitol. 28:85-94. 27. Walmsley, R. M. 1987. Yeast telomeres: the ends of the chromosome story? Yeast 3:139-148. 28. Walmsley, R. M., C. S. M. Chan, B. K. Tye, and T. D. Petes. 1984. Unusual DNA sequences associated with the ends of yeast chromosomes. Nature (London) 310:157-160. 29. Wellems, T. E., D. WaHliker, C. L. Smith, V. E. do Rosario, W. L. Maloy, R. J. Howard, R. Carter, and T. F. McCutchan. 1987. A histidine-rich protein gene marks a linkage group favored strongly in a genetic cross of P. falciparum. Cell 49:633-642. 30. Zakian, V. A., and H. M. Blanton. 1988. Distribution of telomere-associated sequences on natural chromosomes in Saccharomyces cerevisiae. Mol. Cell. Biol. 8:2257-2260.
