Osmotic stress responses of Streptococcus mutans UA159 Jacqueline Abranches, Jose´ A. Lemos & Robert A. Burne Department of Oral Biology, University of Florida College of Dentistry, Gainesville, FL, USA
Correspondence: Robert A. Burne, Department of Oral Biology, University of Florida College of Dentistry, P.O. Box 100424, Gainesville, FL 32610, USA. Tel.: 11 352 392 4370; fax: 11 352 392 7357; e-mail:
[email protected] Received 7 September 2005; revised 15 November 2005; accepted 18 November 2005. First published online 5 January 2006.
Abstract The hyperosmotic stress response of Streptococcus mutans was investigated. Realtime reverse transcriptase-PCR and slot-blot analysis revealed that opuAA, opcA, Smu.2115, sodA and nox were induced after exposure to 0.4 M NaCl. Our data suggest that there is a cross-talk between osmotic and oxidative stress responses in S. mutans. Inactivation of Smu.2115, encoding a putative oxidoreductase, resulted in an acid-resistant and hydrogen peroxide-sensitive phenotype.
doi:10.1111/j.1574-6968.2005.00076.x Editor: William Wade Keywords osmotic stress response; gene regulation; transport; caries; biofilm; Streptococcus mutans.
Introduction The oral cavity is a dynamic habitat in which bacteria must cope with abrupt environmental fluctuations in order to survive. Streptococcus mutans, the primary etiological agent of dental caries, is capable of rapidly mounting responses to many environmental stimuli and has evolved multiple and often-overlapping pathways for dealing with stresses. Accumulation of solutes that come from several sources, including carbohydrates in the diet and salts from tooth demineralization, impacts the osmolality of oral biofilms. The ionic strength of plaque fluid can increase considerably after sugar consumption (Margolis et al., 1988a, b; Gao et al., 2001). During the process of biofilm maturation, when organisms transition from sparsely distributed microcolonies on a freshly cleaned tooth surface to mature dental plaque that can achieve depths of a few 100 mm, organisms must experience considerable changes in the osmolality of their environment. Osmolality impacts bacterial bioenergetics and gene expression in profound ways and thus, adaptation to osmolar changes by bacteria in oral biofilms, such as S. mutans, may have significant consequences in terms of survival and virulence of the organisms. An osmotic upshift forces bacteria to change their physiology by activating or deactivating specific enzymes and transporters, and by altering patterns of gene expression in order to maintain water balance (Kempf & Bremer, 1998; 2005 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved
c
Poolman & Glaasker, 1998). However, most bacteria do not possess active water transport mechanisms to maintain cell turgor (Poolman et al., 2002) and instead have developed sophisticated mechanisms to survive hyperosmotic stress (Kempf & Bremer, 1998; Poolman & Glaasker, 1998). Increasing the concentration of intracellular K1 using energized potassium uptake systems and accumulating compatible solutes are two common strategies to cope with osmotic stress that have been adopted by many bacteria (Kempf & Bremer, 1998). Compatible solutes, including glycine betaine, proline and carnitine, are soluble organic compounds that can be scavenged from the environment or synthesized in high intracellular concentrations without perturbing vital physiologic functions (Poolman et al., 2002; Sleator & Hill, 2002). Several ORFs sharing homology with genes that are known to be induced by hyperosmotic stress in other bacteria can be identified in the S. mutans genome (Ajd´ıc et al., 2002) including trk genes encoding K1 transporters (Dosch et al., 1991; Poolman et al., 2002; Epstein, 2003) and the opu family of ATP-binding cassette (ABC) transporters that internalize compatible solutes. In light of this observation, we initiated a study of osmotic stress responses in S. mutans UA159 and analyzed the transcription levels of a set of genes that share homology with genes in other bacteria that are known to participate in osmotic stress responses. A FEMS Microbiol Lett 255 (2006) 240–246
241
Genes induced by NaCl
mutant strain that is deficient in Smu.2115, which shares similarity with oxidoreductases and is induced by osmotic stress, was also constructed. We demonstrated that the Smu.2115-deficient strain has an acid-resistant and hydrogen peroxide-sensitive phenotype.
Materials and methods Bacterial strains and growth conditions The Streptococcus mutans strains were maintained in brain heart infusion (BHI) medium at 37 1C in a 5% CO2 atmosphere. When required, kanamycin (Km) was added at a final concentration of 1 mg mL1. When assessing growth rates in the presence of NaCl, BHI supplemented with 0.01, 0.1, 0.4 and 0.5 M NaCl was used. For osmotic stress conditions, cells were grown in TV medium (Wen & Burne, 2002) containing 0.5% (weight in volume) glucose to an optical density of 0.5 at 600 nm. Then, NaCl was added to a final concentration of 0.4 M and the cultures were incubated at 37 1C in a 5% CO2 atmosphere for 30 and 60 min, and cells were immediately harvested and stored at 80 1C.
DNA manipulations Chromosomal DNA was isolated from S. mutans UA159 as described previously (Burne et al., 1987). Restriction and DNA-modifying enzymes were obtained from Invitrogen (Gaithersburg, MD) and New England BioLabs (Beverly, MS). PCRs were carried out with 100 ng of chromosomal DNA using iTaq DNA polymerase (Bio-Rad, Hercules, CA). DNA was introduced into S. mutans by natural transformation with addition of 5–10 mmol of competence-stimulating peptide (CSP) (Li et al., 2001). Southern blot analysis was carried out at high stringency, with hybridizations performed overnight at 42 1C, followed by multiple washes in the presence of sodium dodecyl sulfate at 30 1C, as recommended by the supplier of the labeling and detection kits (Ambion Inc., Austin, TX).
RNA isolation, Northern slot-blot analysis and real-time quantitative reverse transcriptase-PCR (RT-PCR) RNA was extracted from cells subjected to salt stress and expression levels of rmeD, Smu.2115, opcA, opuAA and ffh were analyzed by slot-blot or Real-time quantitative RTPCR. Because the strain lacking Smu.2115 was sensitive to H2O2 (see below), the genes for superoxide dismutase (SOD), sodA and for the water-yielding NADH oxidase, nox, which participate in respiration and tolerance to oxidative stress, were included in the analysis. Briefly, cells were grown in TV broth containing 0.5% glucose to an FEMS Microbiol Lett 255 (2006) 240–246
OD600 nm 0.5, and NaCl was added to the cultures to a final concentration of 0.4 M. Cells were incubated for 30 and 60 min, collected by centrifugation and RNA was immediately extracted as detailed elsewhere (Chen et al., 1998). Slotblot analysis using 8 mg of RNA was performed in triplicate as described by Sambrook et al. (1989). Briefly, 8 mg of DNaseI-treated RNA was diluted to 10 mL with diethyl pyrocarbonate (DEPC)-treated water, mixed with 20 mL of 100% formamide, 7 mL of 37% formaldehyde and 2 mL of 20 SSC and incubated for 15 min at 68 1C. The samples were cooled on ice for 2 min, and 400 mL of 20 SSC was added to each tube. The samples were loaded into the slots of the manifold, which was previously treated with 0.1 N NaOH for 1 h and rinsed multiple times with DEPC-treated water, containing a 0.45 mm pore size nitrocellulose membrane. In order to detect the presence of DNA contamination in the RNA preparations, 8 mg of each RNA used in the slot blots was digested with RNaseA, processed as described above and loaded into the manifold as negative controls. Gene-specific probes were labeled with psoralenbiotin using the Brightstar labeling kit (Ambion Inc.). For Real-time quantitative RT-PCR, RNA was repurified and treated on-column with DNaseI using the RNeasy mini kit (QIAGEN Inc., Chatsworth, CA). cDNA was generated from 1 mg of RNA using gene-specific reverse primers as suggested by the supplier (SuperScript First-Strand Synthesis System for RT-PCR; Invitrogen, Carlsbad, CA). Primers used for Real-time quantitative RT-PCR experiments were designed using Beacon Designer 2.0 software (Premier Biosoft International, Palo Alto, CA), and are listed in Table 1. Standard curves for each gene, prepared as described by Yin et al. (2001), were used in every run. A range of 101–108 copies was found to be adequate for all the genes examined.
Construction of an Smu.2115 knockout strain An Smu.2115 mutant was constructed using a PCR ligation mutagenesis strategy (Lau et al., 2002). The 5 0 portion of Smu.2115 and upstream region were amplified by PCR using OxiSApaI (5 0 -GAAAATTTTCCGGGCCCATAATGCATAA-3 0 ) and OxiASEcoRI.400 (5 0 -CCACACTATGAATTCTACCAAAACC-3 0 ) primers to generate a 400 bp product that was subsequently digested with EcoRI. The 600 bp 3 0 portion of Smu.2115 was also amplified by PCR with OxiSBamHI.400 (5 0 -GGTTTTGGTAGGATCCATAGTGTGG-3 0 ) and OxiASNcoI (5 0 -CATCAAGAATCCATGGTCACTAAGATG-3 0 ) primers and subsequently digested with BamHI. Each digested fragment was ligated to an EcoRI/BamHI-digested, nonpolar kanamycin resistance marker (Kremer et al., 2001). The resulting ligation was used to transform S. mutans UA159 generating the strain JAM15. 2005 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved
c
242
J. Abranches et al.
Table 1. Sequences of primers used for real-time quantitative reverse transcriptase-PCR Gene
Forward primer
Reverse primer
ffh nox opcA opuAA Smu.2115 sodA
AGGGTTGAGCGGTGCTAATA GGGTTGTGGAATGGCACTTTGG GCGGACAACAACAGCGTATTG AATCAACCCTGGTGCGTCTT GAAGGACTGGCTCTGGAATTGG GCAGTGCTAAGACTCCCGAATC
GTTTCATAGCAAATTCGCCG CAATGGCTGTCACTGGCGATTC CACCAAATCTTGAAGCCCTTCG CGCTTCACGAAGTTCTTCTG TCTGTATCAGCAGCAACCTGTC TTGCGGAAGTGTGAGATTGGC
(a)
Smu.2113c Smu.2115
gbpA
opuBB opcC opuCD 3mgh
opcA
Smu.2121c
rmeD 800
(b)
1600
rgrB busR
900
(c)
lmo1422
2400
3200
opuAA
1800
2700
lmo1423
Smu.2123
4000
5600
ylxM
opuABC
3600
4800
4500
mntH
6400
ffh
5400
7200
8000
satc satD
6300
7200
8800 satE
8100 lmo1430
opuCD opuCC opuCB opuCA lmo1429
800
1600
2400
3200
4000
4800
5600
6400
7200
8000
8800
Fig. 1. Arrangement of the genes for putative osmoprotectant uptake ATP-binding cassette transporters and flanking regions in the Streptococcus mutans UA159 chromosome. Panel (a) shows the arrangement of the opu/opc gene cluster and flanking regions. Panel (b) shows another opu cluster, composed of two ORFs, that is flanked by ffh and the sat operon. The characterized opuC genes from Listeria monocytogenes are shown in panel (c).
Biofilm assays and stress tolerance The ability of UA159 and JAM15 to form biofilms in the presence of glucose in 96-well microtiter plates was assessed as described elsewhere (Ahn et al., 2005). The experiments were performed in triplicate, and six wells were inoculated for each strain and condition. In order to determine whether Smu.2115 was also involved in acid and oxidative stress responses, planktonic and biofilm populations of JAM15 and UA159 were subjected to acid killing with 0.1 M glycine buffer, pH 2.8, and to hydrogen peroxide killing using 0.2% H2O2 for 30 and 60 min, as described elsewhere (Nascimento et al., 2004). Briefly, for killing of planktonic cells, 50 mL of cell cultures at OD600 nm = 0.5 were harvested and washed with equal volume 0.1 M glycine buffer pH 7.0. For H2O2 killing, pellets were resuspended in 8 mL of 0.1 M glycine buffer, pH 7.0, H2O2 was added to a final concentration of 0.25% and the samples were incubated at room temperature with constant agitation for 30 and 60 min. Serial dilutions were performed in 0.1 M glycine buffer pH 7.0 and plated onto BHI agar. For acid killings, pellets were resuspended in 8 mL 0.1 M glycine buffer pH 2.8, and, processed as described above. Biofilm cells were obtained using 24-well 2005 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved
c
tissue culture plates and killings were performed as described elsewhere (Lemos et al., 2004). Glycolytic profiles of S. mutans strains were assessed as described elsewhere (Belli & Marquis, 1991). Briefly, 50 mL of cells grown to an OD600 nm = 0.5 in BHI were harvested by centrifugation, washed twice with an equal volume of ice-cold water, resuspended in 4.75 mL of 50 mM KCl, 5 mM MgCl2 and the pH was titrated to 7.2 with 0.1 N KOH until stable. Then, 0.25 mL of 1 M glucose was added, and pH drops were recorded every 10 s for 30 min.
Results and discussion Arrangement of the opu family of ABC transporters in the Streptococcus mutans genome When searching for homologs of osmotic stress genes at GenBank (accession no. AEO14133), two regions in the genome of Streptococcus mutans that contain the opu family of ABC transporters responsible for the transport of compatible solutes were identified (Figs 1a and b). ABC FEMS Microbiol Lett 255 (2006) 240–246
243
Genes induced by NaCl
Smu.2115
rmeD
control
30 min
60 min
control
30 min
opc A
60 min
control
30 min
60 min
Fig. 2. Northern slot-blot hybridization of total RNA from Streptococcus mutans UA159 before (control) and 30 or 60 min after treatment with 0.4 M NaCl. The gene fragments used to probe the blots, rmeD, Smu.2115 and opcA, are indicated above each panel. The results shown are representative of at least three independent experiments.
Transcriptional analysis of selected genes in response to salt stress In order to verify whether opu genes and flanking ORFs are induced by osmotic stress, RNA from cells subjected to FEMS Microbiol Lett 255 (2006) 240–246
(a) 6
(b) 6
Smu.2115
Fold of induction
Fold of induction
4 3 2
3 2
0
0 30
30
60
Time
Time
(d) 14 13
sodA
Fold of induction
5 4 3 2 1 0
4
1
1
(c) 6
opuAA
5
5
Fold of induction
transporters are structurally complex proteins responsible for directed movement across biological membranes of a wide variety of compounds in an ATP-dependent manner (for a review, see Young & Holland, 1999; Saier, 2000). Figure 1a shows a putative opc/opu gene cluster that shared significant levels of similarity with its counterparts in Streptococcus agalactiae and the characterized opuC system of Listeria monocytogenes (Angelidis & Smith, 2003). The first gene, opcA, encodes a predicted quaternary amine ABC transporter sharing 72% and 62% identity with OpuCA of S. agalactiae and L. monocytogenes, respectively. Downstream of opcA is opuBB, which encodes a membrane permease that is 78% identical to S. agalactiae and 60% identical to L. monocytogenes OpuCB. The opuBB gene is immediately upstream of opcC, which codes for a quaternary aminebinding protein. OpcC is 68% and 52% identical to OpuCC of S. agalactiae and L. monocytogenes, respectively. The last ORF in the gene cluster, opuCD, is a membrane permease that is also part of an osmoprotectant ABC transporter system. OpuCD is 81% and 60% identical to OpuCD of S. agalactiae and L. monocytogenes, respectively. Immediately upstream of the opc/opu gene cluster is Smu.2115, which is 60% identical to a plasmid-encoded oxidoreductase from Clostridium acetobutylicum. Upstream and on the opposite strand of Smu.2115 is a probable transcriptional regulator that belongs to the MerR family (rmeD). Figure 1b shows the arrangement of another putative opu gene cluster in S. mutans. The opuAA gene codes for a protein that has 82% and 66% identity with the ATPbinding component of a putative quaternary amine ABC transporter of Streptococcus pyogenes and Lactococcus lactis, respectively. The downstream gene codes for OpuABC, which shares 72% and 60% identity with a putative proline/glycine betaine permease of S. pyogenes and L. lactis, respectively. As noted by Kremer et al. (2001), the opuAAopuABC genes are upstream of ylxM, ffh and the sat genes, which are involved in acid stress tolerance (Kremer et al., 2001). Figure 1c illustrates the arrangement of the characterized opuC system of L. monocytogenes.
30
60
Time
60
nox
12 11 10 9 8 7 6 5 4 3 2 1 0 30
Time
60
Fig. 3. Fold of induction relative to untreated controls of mRNA for Smu.2115, opuAA, sod and nox after 30 or 60 min exposure to 0.4 M NaCl. The results were obtained using Real-time quantitative reverse transcriptase-PCR as detailed in the text. The data are means with standard deviation (error bars) derived from RNAs isolated from a minimum of three separate growth experiments. All samples were assayed in triplicate.
0.4 M NaCl was isolated as described above, and transcript levels of specific genes were analyzed by slot-blot and/or Real-time quantitative RT-PCR. Slot-blot analysis indicated that both opcA and Smu.2115 were induced by NaCl stress, but rmeD was not (Fig. 2). Real-time PCR analysis confirmed induction of Smu.2115, and also demonstrated that opuAA was induced by salt stress (Figs 3a and b). These results confirm that opcA and opuAA, which are in distinct operon-like arrangements, and Smu.2115, which is flanking opcA, participate in the salt stress response of S. mutans. Many lactic acid bacteria have either limited or no capacity to synthesize compatible solutes. Therefore, in order to survive an osmotic upshift, they must take up compatible solutes from the environment (Kempf & Bremer, 1998; Poolman & Glaasker, 1998). Although we cannot rule out that S. mutans cannot synthesize compatible solutes, the induction of opcA and opuAA suggests that, like in other lactic acid bacteria, accumulation of compatible solutes taken up from external sources represents an important 2005 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved
c
244
J. Abranches et al.
(a) 100
(b) 100 UA159
UA159 JAM15
1 0.1
JAM15
10 % of survival
% of survival
10
1 0.1 0.01
0.01
0.001
0.001 0
20
40 Minutes
60
80
0
20
40 Minutes
60
80
Fig. 4. Acid and hydrogen peroxide killing of planktonic populations of UA159 and JAM15 (Smu.2115 knockout strain). Panel (a) shows the results derived from cells subjected to acid killing with 0.1 M glycine buffer at pH 2.8. Panel (b) shows the survival of cells subjected to 0.2% H2O2 killing in 0.1 M glycine buffer at pH 7.0. The results shown are representative of at least three independent experiments.
route to recover from hyperosmotic stress. However, the substrates transported by the Opc/Opu family of ABC transporters of S. mutans are still unknown. In L. lactis, it is established that components of the Opu family of ABC transporters respond to osmotic stress by sensing changes in membrane properties and internalizing quaternary amines (Heide & Poolman, 2000). Although transcription of rmeD, encoding a possible regulatory protein, was not affected by the conditions tested, it cannot be excluded that the DNAbinding activity of this protein may be influenced by osmotic stress. Interestingly, expression of sodA and nox increased during osmotic upshift (Figs 3c and d). The levels of nox mRNA were also higher after 30 min of osmotic shock, although this was not the case after 60 min (Fig. 3d). Notably, Escherichia coli cells exposed to osmotic stress have lower respiration rates (Wood, 1999), and NADH-dependent respiration is inhibited within seconds after an osmotic upshift (Wood, 1999). At this point, we cannot rule out that the induction of sodA and nox after osmotic upshift can impact oxygen metabolism in S. mutans. However, S. mutans lacks cytochromes and is not able to engage in oxidative phosphorylation, so it seems more likely that osmotic stress could perturb membrane integrity and inhibit transport processes. Decreases in the rate of sugar transport into the cells would affect the glycolytic rate, decreasing the rate of respiration, which is primarily used in the streptococci to restore NAD/NADH balances. Interestingly, L. lactis cells exposed to 4% NaCl for 30 min showed a decrease in the expression of several genes implicated in sugar transport and metabolism (Xie et al., 2004). Our results clearly show that osmotic stress can induce genes that are involved in responses to other stressors. Finally, only a modest (2.8 1.4-fold) induction of ffh after 60 min of osmotic stress was observed (data not shown). Ffh is involved in protein translocation and in acid stress tolerance (Kremer et al., 2001; Crowley et al., 2004). It 2005 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved
c
is known that a high ionic strength can lead to changes in cell wall structure, growth retardation, lengthening of cells (Vijaranakul et al., 1995; Meury & Devilliers, 1999; Piuri et al., 2005) and changes in membrane composition (Wood, 1999). Consequently, Ffh induction may occur in response to an enhanced demand during osmotic stress to translocate newly synthesized proteins to the cell membrane.
Characteristics of an Smu.2115-deficient strain The finding that Smu.2115 is induced by osmotic stress led us to explore its role in stress tolerance in S. mutans. The Smu.2115 knockout strain, JAM15, was able to grow nearly as well as the parental strain in BHI, with doubling times of 70 10.5 min for the mutant and 60 5.5 min for UA159. The growth of UA159 and JAM15 in BHI supplemented with 0.01, 0.1, 0.4 and 0.5 M NaCl was assessed to find a salt concentration that would be enough to slow growth without completely inhibiting cell division. NaCl at a concentration of 0.4 M increased the generation time of the wild-type strain to 146.6 4.8 min and that of JAM15 to 142.8 10.2 min, whereas 0.5 M NaCl caused nearly complete inhibition of growth of both strains (data not shown). Thus, Smu.2115 is not essential for salt tolerance. Notably, we were unable to induce killing of UA159 and JAM15 with NaCl concentrations up to 5 M, indicating that NaCl has only a bacteriostatic effect on S. mutans (data not shown).
Tolerance to acid and oxidative stresses Both planktonic (Fig. 4a) and biofilm populations of JAM15 displayed enhanced acid resistance compared with the wildtype strain. It has been well established that acid-adapted cells of S. mutans can carry out glycolysis at lower pH values than cells grown at neutral pH (Belli & Marquis, 1991). However, the glycolytic profile of JAM15, measured as the ability of the cells to lower the external pH due to acid production in the presence of glucose, did not differ from FEMS Microbiol Lett 255 (2006) 240–246
245
Genes induced by NaCl
UA159 (data not shown). Interestingly, JAM15, grown in biofilms or planktonically, was more sensitive to killing with 0.2% H202 than UA159 (Fig. 4b). Wen & Burne (2004) demonstrated that an S. mutans strain lacking the luxS gene, which synthesizes the autoinducer-2 (AI-2) quorum-sensing molecule, is acid sensitive and more resistant to H2O2 than UA159, a phenotype opposite to that observed for JAM15. Also, S. mutans strains lacking the relA gene, which is responsible for the production of the nutritional alarmone (p)ppGpp (Lemos et al., 2004), were shown to be more acid tolerant and could lower the pH through glycolysis faster and to a greater extent than the wild-type strain. However, relA strains did not show altered survival following exposure to H2O2 (Lemos et al., 2004). In Pseudomonas aeruginosa and Streptomyces coelicolor, strains lacking functional catalases were reported to be more sensitive to osmotic stress than the wild-type strains (Cho et al., 2000; Lee et al., 2005), suggesting that there is a cross-talk between oxidative and osmotic stress response circuits. Although S. mutans does not have catalases, production of SOD and NADH oxidase is responsive to hyperosmotic stress. The molecular basis for the regulatory link between these stresses in S. mutans and the role of Smu.2115 in stress tolerance remain to be elucidated. Nonetheless, based on our observations that two oxidative stress genes, sodA and nox, are induced during osmotic stress, and on the fact that JAM15 displays an acidresistant and H2O2-sensitive phenotype, we reinforce the idea that there is a general stress response by S. mutans in which a set of proteins are induced, and there are subsets of proteins that are induced in a stress-specific manner (Svens¨ater et al., 2000; Wen & Burne, 2004; Xie et al., 2004; Lemos et al., 2005). In summary, we have shown the induction of opcA, opuAA, Smu.2115, sodA and nox during osmotic upshift. The absence of a functional Smu.2115 in S. mutans generated an acid-resistant and hydrogen peroxide-sensitive phenotype, suggesting that Smu.2115 is involved in responses to multiple environmental stimuli.
Acknowledgements The authors would like to thank P. Crowley for kindly providing ffh and opuAA primers. This work was supported by NIDCR DE13239.
References Ahn SJ, Lemos JA & Burne RA (2005) Role of HtrA in growth and competence of Streptococcus mutans UA159. J Bacteriol 187: 3028–3038. Ajd´ıc D, McShan WM, McLaughlin RE, et al. (2002) Genome sequence of Streptococcus mutans UA159, a cariogenic dental pathogen. Proc Natl Acad Sci USA 99: 14434–14439.
FEMS Microbiol Lett 255 (2006) 240–246
Angelidis AS & Smith GM (2003) Three transporters mediate uptake of glycine betaine and carnitine by Listeria monocytogenes in response to hyperosmotic stress. Appl Environ Microbiol 69: 1013–1022. Belli WA & Marquis RE (1991) Adaptation of Streptococcus mutans and Enterococcus hirae to acid stress in continuous culture. Appl Environ Microbiol 57: 1134–1138. Burne RA, Schilling K, Bowen WH & Yasbin RE (1987) Expression, purification, and characterization of an exo-betaD-fructosidase of Streptococcus mutans. J Bacteriol 169: 4507–4517. Chen YY, Hall TH & Burne RA (1998) Streptococcus salivarius urease expression: involvement of the phosphoenolpyruvate : sugar phosphotransferase system. FEMS Microbiol Lett 165: 117–122. Cho YH, Lee EJ & Roe JH (2000) A developmentally regulated catalase required for proper differentiation and osmoprotection of Streptomyces coelicolor. Mol Microbiol 35: 150–160. Crowley PJ, Svens¨ater G, Snoep JL, Bleiweis AS & Brady LJ (2004) An ffh mutant of Streptococcus mutans is viable and able to physiologically adapt to low pH in continuous culture. FEMS Microbiol Lett 234: 315–324. Dosch DC, Helmer GL, Sutton SH, Salvacion FF & Epstein W (1991) Genetic analysis of potassium transport loci in Escherichia coli: evidence for three constitutive systems mediating uptake potassium. J Bacteriol 173: 687–696. Epstein W (2003) The roles and regulation of potassium in bacteria. Prog Nucleic Acid Res Mol Biol 75: 293–320. Gao XJ, Fan Y, Kent RL Jr, Van Houte J & Margolis HC (2001) Association of caries activity with the composition of dental plaque fluid. J Dent Res 80: 1834–1839. van der Heide T & Poolman B (2000) Osmoregulated ABCtransport system of Lactococcus lactis senses water stress via changes in the physical state of the membrane. Proc Natl Acad Sci USA 97: 7102–7106. Kempf B & Bremer E (1998) Uptake and synthesis of compatible solutes as microbial stress responses to high-osmolality environments. Arch Microbiol 170: 319–330. Kremer BH, van der Kraan M, Crowley PJ, Hamilton IR, Brady LJ & Bleiweis AS (2001) Characterization of the sat operon in Streptococcus mutans: evidence for a role of Ffh in acid tolerance. J Bacteriol 183: 2543–2552. Lau PC, Sung CK, Lee JH, Morrison DA & Cvitkovitch DG (2002) PCR ligation mutagenesis in transformable streptococci: application and efficiency. J Microbiol Methods 49: 193–205. Lee JS, Heo YJ, Lee JK & Cho YH (2005) KatA, the major catalase, is critical for osmoprotection and virulence in Pseudomonas aeruginosa PA14. Infect Immun 73: 4399–4403. Lemos JA, Brown TA Jr & Burne RA (2004) Effects of RelA on key virulence properties of planktonic and biofilm populations of Streptococcus mutans. Infect Immun 72: 1431–1440. Lemos JA, Abranches J & Burne RA (2005) Responses of cariogenic streptococci to environmental stresses. Curr Iss Mol Biol 7: 95–107.
2005 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved
c
246
Li YH, Lau PC, Lee JH, Ellen RP & Cvitkovitch DG (2001) Natural genetic transformation of Streptococcus mutans growing in biofilms. J Bacteriol 183: 897–908. Margolis HC, Duckworth JH & Moreno EC (1988a) Composition and buffer capacity of pooled starved plaque fluid from caries-free and caries-susceptible individuals. J Dent Res 67: 1476–1482. Margolis HC, Duckworth JH & Moreno EC (1988b) Composition of pooled resting plaque fluid from caries-free and caries-susceptible individuals. J Dent Res 67: 1468–1475. Meury J & Devilliers G (1999) Impairment of cell division in tolA mutants of Escherichia coli at low and high medium osmolarities. Biol Cell 91: 67–75. Nascimento MM, Lemos JA, Abranches J, Gonc¸alves RB & Burne RA (2004) Adaptive acid tolerance response of Streptococcus sobrinus. J Bacteriol 186: 6383–6390. Piuri M, Sanchez-Rivas C & Ruzal SM (2005) Cell wall modifications during osmotic stress in Lactobacillus casei. J Appl Microbiol 98: 84–95. Poolman B, Blount P, Folgering JH, Friesen RH, Moe PC & van der Heide T (2002) How do membrane proteins sense water stress? Mol Microbiol 44: 889–902. Poolman B & Glaasker E (1998) Regulation of compatible solute accumulation in bacteria. Mol Microbiol 29: 397–407. Saier MH Jr (2000) Families of transmembrane transporters selective for amino acids and their derivatives. Microbiology 146: 1775–1795. Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sleator RD & Hill C (2002) Bacterial osmoadaptation: the role of osmolytes in bacterial stress and virulence. FEMS Microbiol Rev 26: 49–71.
2005 Federation of European Microbiological Societies Published by Blackwell Publishing Ltd. All rights reserved
c
J. Abranches et al.
Svens¨ater G, Sj¨ogreen B & Hamilton IR (2000) Multiple stress responses in Streptococcus mutans and the induction of general and stress-specific proteins. Microbiology 146: 107–117. Vijaranakul U, Nadakavukaren MJ, de Jonge BL, Wilkinson BJ & Jayaswal RK (1995) Increased cell size and shortened peptidoglycan interpeptide bridge of NaCl-stressed Staphylococcus aureus and their reversal by glycine betaine. J Bacteriol 177: 5116–5121. Wen ZT & Burne RA (2002) Analysis of cis- and trans-acting factors involved in regulation of the Streptococcus mutans fructanase gene (fruA). J Bacteriol 184: 126–133. Wen ZT & Burne RA (2004) LuxS-mediated signaling in Streptococcus mutans is involved in regulation of acid and oxidative stress tolerance and biofilm formation. J Bacteriol 186: 2682–2691. Wood JM (1999) Osmosensing by bacteria: signals and membrane-based sensors. Microbiol Mol Biol Rev 63: 230–262. Xie Y, Chou LS, Cutler A & Weimer B (2004) DNA macroarray profiling of Lactococcus lactis subsp. lactis IL1403 gene expression during environmental stresses. Appl Environ Microbiol 70: 6738–6747. Yin JL, Shackel NA, Zekry A, McGuinness PH, Richards C, Putten KV, McCaughan GW, Eris JM & Bishop GA (2001) Real-time reverse transcriptase-polymerase chain reaction (RT-PCR) for measurement of cytokine and growth factor mRNA expression with fluorogenic probes or SYBR Green I. Immunol Cell Biol 79: 213–221. Young J & Holland IB (1999) ABC transporters: bacterial exporters-revisited five years on. Biochim Biophys Acta 1461: 177–200.
FEMS Microbiol Lett 255 (2006) 240–246
