OSTEOPETROSIS MUTATION R444L CAUSES ... - TSpace

OSTEOPETROSIS MUTATION R444L CAUSES ENDOPLASMIC RETICULUM RETENTION AND MISPROCESSING OF VACUOLAR H+-ATPase a3 SUBUNIT

BY

AJAY BHARGAVA

A THESIS SUBMITTED IN CONFORMITY WITH THE REQUIREMENTS FOR THE DEGREE: MASTERS OF SCIENCE FACULTY OF DENTISTRY UNIVERSITY OF TORONTO

© AJAY BHARGAVA (2012)

Osteopetrosis mutation R444L causes endoplasmic reticulum retention and misprocessing of vacuolar H+-ATPase a3 subunit Masters of Science, 2012, Ajay Bhargava Faculty of Dentistry, University of Toronto

ABSTRACT Osteopetrosis is characterized by increased bone density and fragility. The R444L missense mutation in the human V-ATPase a3 subunit causes this disease. Modeling the R444L mutation in mouse a3 caused endoplasmic reticulum (ER) retention of a3 with attendant abrogation of maturation and trafficking of the glycoprotein and its degradation. The mutant protein also displayed altered conformation and increased degradation. Together, these data suggest that R444 is involved in protein folding or stability significant to mammalian a3, and that infantile osteopetrosis caused by the R444L mutation in the V-ATPase a3 subunit is another member of the growing class of protein folding diseases. We also ascertained that the N-Glycosylation sites of the a3 glycoprotein lie at position N484 and N504, data that help to refine the topology of the a subunit. Overall, this study sheds new light onto the role that R444 plays in a subunit structure, and refines a subunit topology.

ii

ACKNOWLEDGEMENTS I would like to thank my supervisor Dr. Morris Manolson for giving me the chance to prove myself in this research world; Dr. Norbert Kartner for challenging me to do better with the skills I had; Dr. Irina Voronov for giving me the direction in and out of the lab to be successful (also the chocolate); Noelle Ochotny for verifying my sanity and providing technical help; Dr. Yeqi Yao for all the enlightening lab discussions, technical help, and food while I stayed in the lab; Dr. Keying Li for her technical guidance and mastery in skill, which I admired and tried to mimic; my summer students Albert Tan and Ravi Kumar for all their help in the lab; and the fantastic graduate students of the Faculty of Dentistry who, over time, made writing this thesis very difficult to do as we found an almost infinite number of fun distractions. Outside the work environment, I thank my family, my mom, my dad, my sister, and the close group of friends who, over the years, toughed it through with me while I missed out on so many life events. These were hard times for all of us. Lastly, I would like to thank my adversaries. If it weren't for the competitive spirit that embodied our relationship, I don’t think I would have gotten this far.

iii

TABLE OF CONTENTS ABSTRACT

ii

ACKNOWLEDGEMENTS

iii

CONTRIBUTIONS BY THE AUTHOR AND CONTRIBUTIONS FROM OTHERS

vi

LIST OF TABLES AND FIGURES 1.1 TABLES 1.2 FIGURES

vii vii vii

2

viii

3

ABBREVIATIONS INTRODUCTION 3.1 Literature review 3.1.1 Functions of intracellular V-ATPases 3.1.2 Functions of plasma membrane V-ATPases 3.1.3 V-ATPase structure and function 3.1.3.1 3.1.3.2

Structure and function of the V1 complex Structure and function of the V0 complex

1 2 2 3 3 5 7

3.1.4 V-ATPase assembly 3.1.5 V-ATPase glycosylation 3.1.6 V-ATPase in human disease 3.1.7 Point mutations aid in the study of V-ATPase structure and function 3.1.8 Human mutations at R444 3.2 Statement of the problem 3.3 Hypothesis 3.4 Objective 3.5 Significance of research

11 12 13 16 16 17 17 17 18

4

METHODOLOGY 4.1 Reagents and antibodies 4.2 Yeast strains 4.3 Scoring growth phenotype 4.4 Mammalian constructs 4.5 Cell culture, media, and reagents 4.6 Mammalian cell transfection 4.7 Creation of mammalian cell lines 4.8 RNA extraction 4.9 Protein extraction 4.10 Isolation of mouse whole cell lysate 4.11 Deglycosylation of a3 and a3-GFP 4.12 Western blotting 4.13 Immunostaining and confocal microscopy 4.14 Quantitative confocal analysis 4.15 Trypsin proteolysis 4.16 Quantitative protein analysis

19 19 19 19 20 20 20 20 21 21 22 22 23 23 23 24 24

5

RESULTS 5.1 A negatively charged amino acid at position 462 does not affect Vph1p function 5.2 a3R445L-GFP has significantly reduced protein expression in mature osteoclasts 5.3 a3R445L-GFP is core-glycosylated but not processed 5.4 a3R445L-GFP is retained within the endoplasmic reticulum

25 25 25 26 27

iv

5.5 5.6

a3R445L-GFP alters protein conformation N484 and N504 are the glycosylation sites of a3

27 28

6

DISCUSSION 6.1 R462 is not critical for Vph1p function 6.2 R445 is necessary for proper mouse a3 folding 6.3 How might the R445L point mutation alter protein conformation? 6.4 Disease mechanisms resulting from mutations at this residue 6.5 Refining the topology of the N-terminal half of CTa 6.6 Summary of findings

30 30 31 33 34 35 36

7

FUTURE STUDIES 7.1 Do molecular therapeutics such as chemical chaperones rescue R444L a3 to WT? 7.2 Does R444L prevent V1-V0 assembly? 7.3 Identifying the polar partners interacting with R444

37 37 37 38

8

REFERENCES

59

v

CONTRIBUTIONS BY THE AUTHOR AND CONTRIBUTIONS FROM OTHERS I performed all the work in this thesis except for the creation of the cell lines as mentioned in “Methodology”, Section 4.7, which was performed by Yongqiang Wang (Wang, Y.). Experiments that were performed by others are: Figure 7A, performed by Dr. Irina Voronov; and Figure 11A, compiled by Dr. Norbert Kartner. Work from this thesis is to be detailed in a first author publication and co-author publication: 1. Bhargava, A., Kartner, N., Voronov, I., Wang, Y., Glogauer, M., and Manolson, M. R444L missense mutation responsible for infantile osteopetrosis alters V-ATPase a3 structure and ER processing. J. Biol. Chem. 2012 (Manuscript in Revision) 2. Kartner, N., Yao, Y., Bhargava, A., Manolson, M., Topology, glycosylation and conformational changes in the membrane domain of the V-ATPase a subunit. J. Biol. Chem., 2012 (Manuscript in Revision) Other work performed by the author but not related to this thesis: 3. Durand M., Komorova S., Bhargava A., Li K., Fiorino C., Nabavi N., Manolson M.F., Harrison R.E., Dixon S.J., Sims S.M., Mizianty M.J., Kurgan L., Boire G., Lucena-Fernandes M.F., deBrum-Fernandes A.J., Monocytes from patients with osteoarthritis display increased osteoclastogenesis and subsequent bone resorption: the in vitro osteoclast differentiation in arthritis (IODA) study. Arth. & Rheum. 2012 (Manuscript in Revision)

vi

LIST OF TABLES AND FIGURES 1.1 TABLES Table 1 – V-ATPase subunits and subunit isoforms

39

Table 2 – Sequence identity conservation across human a subunit isoforms and Vph1p

40

Table 3 – Yeast strains, plasmids and primers used in this thesis

41

Table 4 – Mammalian plasmids, strains used in this thesis

42

Table 5 – A negatively charged amino acid at position 462 is not required for vph1p function 43

1.2 FIGURES Figure 1 – Functions of plasma membrane V-ATPases

44

Figure 2 – V-ATPase nomenclature, and structural and functional comparisons

45

Figure 3 – Consensus model of yeast Vph1p (a subunit) topology

46

Figure 4 – a subunit N-glycosylation site mapping

47

Figure 5 – Sequence identity conservation across a subunit isoforms

48

Figure 6 – Conservation of the R444 amino acid in a subunits

49

Figure 7 – a3R445L-GFP has significantly reduced protein expression in mature osteoclasts.

51

Figure 8 – a3R445L-GFP is core-glycosylated but not processed

53

Figure 9 – a3R445L-GFP is retained within the endoplasmic reticulum

54

Figure 10 – a3R445L-GFP alters protein conformation

56

Figure 11 – N484 and N504 are the glycosylation sites of mouse a3

58

vii

2 ABBREVIATIONS GFP, green fluorescent protein LAMP2, lysosome-associated membrane protein 2 M-CSF, macrophage colony stimulating factor PMSF, phenylmethylsulfonyl fluoride SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis TLCK, Nα-tosyl-L-lysine chloromethyl ketone hydrochloride TPCK, tosyl phenylalanyl chloromethyl ketone TM, transmembrane α-helix V-ATPase, vacuolar-type H+-ATPase. UPR, unfolded protein response ERAD, endoplasmic reticulum associated degradation OST, oligosaccharyltransferase GDP/GTP, Guanosine Diphosphate/Guanosine Triphosphate ARNO, ADP-ribosylation factor nucleotide site opener ARF6, GTPases in Arf family VPH1, Vacuolar pH 1 VMA1, Vacuolar Membrane ATPase NT-/CT-, N-Terminal, C-Terminal ARCL-II, Autosomal recessive cutis laxis type II dRTA, distal renal tubular acidosis iARO, infantile autosomal recessive osteopetrosis HSCT, hematopoetic stem cell therapy

viii

3

INTRODUCTION V-ATPases are H+ pumping enzymes consisting of multiple subunits. These subunits act

as either stators or rotors, and together form an enzymatic motor that performs the proton pumping necessary for maintaining pH gradients across cellular membranes. The action of this multi-subunit enzyme thus maintains a critical cellular housekeeping function. In addition to this, V-ATPases localize to specialized organelles in unique cell types in order to help these cells achieve their necessary physiological function. Because of the diversity of environments that VATPases are required in, evolution has necessitated numerous isoforms of each of V-ATPase’s subunits to serve this demand. Specific isoforms combine to form a unique V-ATPase complex, which localizes specifically to the organelle requiring its proton pumping function. To facilitate our understanding of the structure and function of these unique V-ATPases, we studied human diseases caused by missense mutations in specific V-ATPase subunit isoforms that lead to diseases such as osteopetrosis or distal renal tubule acidosis in humans.

We hypothesize that the mutations result in significant protein structural changes, altering the protein conformation of the subunits within the V-ATPase enzyme complex. Characterization of these structural changes will allow us to gain understanding of the molecular mechanisms behind these diseases, and will provide us with new knowledge of the structural features of VATPases. Work described in this thesis depicts the phenotypic effects of a single point mutation known to lead to osteopetrosis, and exploits the knowledge to uncover novel characteristics of VATPase.

The following literature review summarizes current knowledge regarding V-ATPase structure, function, assembly, and conservation. This will be followed by a description of known human mutations in genes encoding for V-ATPase subunits and the diseases that result from them. Current knowledge about how these mutations on V-ATPase structure and function will be described. The review concludes by outlining the importance of a specific conserved amino acid residue that, when mutated in two isoforms of the same V-ATPase subunit, results in diseases of the bone and kidney.

1

2 3.1

Literature review 3.1.1

Functions of intracellular V-ATPases

Within the cell, the V-ATPase acidifies the luminal space of organelles. In mammalian organisms, these include, but are not limited to: lysosomes, endosomes, and secretory vesicles. In yeast, V-ATPase is required for acidification of the central vacuole. The acidification of these various compartments in mammalian organisms allows the cell to perform vital functions such as autophagy, clathrin mediated endocytosis, and secretory vesicle acidification (1, 2). In autophagy, V-ATPases are required to acidify the lysosomal compartment. The acidification of the lysosome permits the fusion of the autophagosome with the lysosome, forming the autophagolysosome (3). The formation of this compartment is necessary for the clearance of aggregates and other protein degradation products. Diseases such as Alzheimer’s can occur due to the absence of V-ATPases in autophagolysosomal organelles (4).

In clathrin-mediated endocytosis, the V-ATPase is

essential for the acidification of the endosome. The acidification of the endosome activates the release of the ligands from the receptors, thus permitting unoccupied receptor recycling (1). Furthermore, a similar process is required for the trafficking of newly synthesized lysosomal enzymes from the Golgi to the lysosome (5). In yeast, the acidification of the central vacuole is necessary for cell survival, and response to environmental changes such as heavy metal resistance (6).

In addition to their roles in proton pumping, V-ATPases play non-canonical roles in signaling, and vesicle fusion. In endocytic trafficking, subunits within the V-ATPase complex associate with the small GTP-binding protein, ARF6, and its GDP/GTP exchange factor, ARNO, in a pH dependent manner. The association of these factors with the V-ATPase complex regulates transport from early to late endosomes. This activity suggests that V-ATPases may also serve as pH sensors (7, 8).

In vesicular fusion, a membrane embedded V-ATPase subunit forms a proteolipid pore that functions in membrane fusion. Homotypic fusion events were initially seen in yeast during the fusion of yeast vacuoles, but have also been observed in fusion events in higher order organisms, and have been found to be necessary to facilitate synaptic vesicle exocytosis. In yeast, the purpose of this homotypic fusion event is to trigger an efflux of calcium from the vacuolar lumen,

3 thus fostering the binding of calmodulin to the membrane (9). In Drosophila, homotypic fusion is required for synaptic vesicle fusion with the plasma membrane. The loss of the subunits necessary for proteolipid pore formation leads to the accumulation of vesicles near the synaptic terminal, causing a deficit in release (10). Recent studies suggest that proteolipid pore formation may even be necessary for insulin release from β-cells in the pancreas (11). 3.1.2

Functions of plasma membrane V-ATPases

On the cell surface, the V-ATPase participates in cellular functions critical to the physiological function of many cell types. Acid secretion by V-ATPase into the extracellular environment assists the cell in carrying out roles in: urine acidity, bone resorption, sperm maturation, and tumor metastasis (Fig. 1) (12). To acidify urine, cells within the distal tubule and the collecting duct of the kidney traffic their V-ATPases to the plasma membrane facing the renal tubular lumen. Here, the proton pumping activities of V-ATPase lower the pH of urine. As a result of this proton pumping, further re-absorption of bicarbonate occurs, replenishing the blood’s supply of bicarbonate ions used in respiration (13). To perform bone resorption, osteoclasts, the bone dissolving cells required for normal bone remodeling, traffic V-ATPase to the ruffled border, an organelle in osteoclasts facing the bone surface.

The ruffled border creates a sealed extracellular space into which V-ATPases pump protons. The action of proton pumping acidifies the bone matrix and activates proteases necessary for proper bone matrix remodeling (14). During sperm maturation, V-ATPases are required to traffic to the apical membrane of clear cells. The proton pumping action of VATPases acidifies the lumen of the vas deferens and epididymis. This action aids in sperm maturation and sperm storage (15). Recently, V-ATPase activity has been shown to be necessary for tumor metastasis in the highly invasive MB-231 breast cancer cell line. V-ATPase proton pumping activity acidifies the extracellular matrix beneath the cell. Inhibition of V-ATPase prevents metastasis of this cell line (16). 3.1.3

V-ATPase structure and function

The yeast V-ATPase structure is well characterized due to our knowledge of yeast molecular biology and genetics. Our studies of mammalian V-ATPase studies have proven difficult. Favorably, however, there exists a high degree of homology between yeast and

4 mammalian V-ATPases, thus permitting comparison. V-ATPases also share a high degree of sequence identity with the F1-F0 ATP synthase, found in mitochondria, thus permitting topological comparisons. The V-ATPase also operates in a similar fashion as the F1-F0 ATP synthase, but in reverse, allowing for rudimentary functional comparisons. V-ATPase is comprised of at least 14 known subunits, which assemble into a multi-subunit complex. The subunits are divided into those composing the membrane integral domain, the V0, or the peripheral domain, the V1. Nomenclature for the V-ATPase subunits are modeled loosely from the F1-F0 ATP synthase, and are labeled in uppercase roman characters for V1 subunits (A-H), and lower-case roman characters for Vo subunits (a-e) (Fig. 2 and Table 1). In yeast, V-ATPase subunits are also named VMA (Vacuolar Membrane ATPase), while the ‘a’ subunit is named VPH1 (Vacuolar pH 1). V-ATPase nomenclature is further divided by the isoforms of each subunit. In the mammalian V-ATPases, isoforms of each subunit are classified numerically (ex. a1-a4, G1-G3). In yeast V-ATPases, the ‘a’ subunit is the only subunit possessing an isoform, and this isoform is labeled Similar To Vph1p, Stv1p.

As the V-ATPase functions as a molecular motor, the enzyme can be functionally divided into two categories – the stator and rotor. The rotor, or rotational portion of the enzyme, is held in place by the stator, the stationary non-moving portion of the enzyme. The stator is comprised of the A, B, C, E, G, H, a, and possibly e subunits. The rotor is comprised of the D, F, c, c’, c’’, and d subunits. Each one of the subunits has a necessary role to play in the proper function of VATPase, but, as discussed below, mounting evidence also shows that each subunit also functions as a bridge between V-ATPase and the cellular environment.

5 3.1.3.1 Structure and function of the V1 complex Consisting of eight subunits in a stoichiometry of a3B3CDE3FG3H, the V1 complex is 600-650 kDa in size. Together, these subunits form the stationary catalytic headpiece, the central rotating stalk, and the stationary peripheral stalk. ATP hydrolysis in the stationary catalytic headpiece creates the energy necessary to drive the rotation of a central stalk, itself being connected to the proteolipid ring of c, c’, and c’’ subunits in the V0 domain. The peripheral stalks are needed to keep the rotational subunits in place, and hence belong to the stator category. In mammalian organisms, the B, C, E, and G subunits have multiple isoforms, each localized to different tissues (17).

The stationary catalytic headpiece consists of the a3B3 hexamer, and is made of catalytic and non-catalytic subunits. The A subunit is the catalytic subunit involved in the hydrolysis of ATP. Identified in S. cerevisiae as Vma1p, the yeast A subunit shares a sequence identity of 25% with the β subunit of the F1-F0 ATP synthase (18). Crystal structure mapping of the β subunit of the F1-F0 ATP synthase to the A subunit lead to site directed mutagenesis studies, which have shown that amino acids within the binding pocket region evolutionarily conserved with the β subunit of the F1-F0 ATP synthase are necessary for ATP hydrolysis (19, 20). Functionally, the B subunit contains a non-catalytic nucleotide-binding region, and participates in nucleotide binding. The B subunit is highly conserved with the α subunit of the F1-F0 ATP synthase (21). Site directed mutagenesis studies of VMA2 have shown that Vma2p is involved in maximal ATP binding, like its α subunit counterpart in F1-F0 ATP synthase (21, 22). Both B subunit isoforms participate in non-canonical roles, such as: actin binding, association with aldolase, and association with adenylyl cyclase (23-25).

In mammalian systems, the B subunit has two isoforms: the B1 is the isoform found in renal cells, the epididymis, and olfactory epithelium; while the B2 isoform is ubiquitous (26). Interestingly, osteoclasts preferentially localize B2 containing V-ATPases to the ruffled border (27).

6 The central rotating stalk consists of the D and F subunits, and connects the V1 and V0 subunits. The D subunit, Vma8p in yeast, has no counterpart to the F1-F0 ATP synthase, but shows a high degree of α-helix homology with the γ subunit of the F-ATP synthase stalk subunit, suggesting that its role is similar (28). Mutagenesis studies of VMA8 demonstrated an uncoupling of the V1 and V0 subunits. Isolation of vacuolar membranes from Δvma8 yeast showed that the V0 but not V1 domain was in the vacuole, suggesting that Vma8p is necessary for V1-V0 attachment (29, 30).

The F subunit, Vma7p in yeast, has recently been crystalized in S. cerevisiae, and data suggests that the subunit shape contains a hook-like structure that connects to the catalytic headpiece, allowing for the coupling of energy from ATP hydrolysis to drive the rotation of the V0 subunits (31). Similar to Vma8p, Vma7p is required for V1-V0 attachment (32). The stationary peripheral stalk consists of the C, E, G, and H subunits. These subunits are utilized primarily to hold the rotational and catalytic subunits in place while they perform their activities (33). In addition to their primary roles, the C, E and G subunits have other regulatory roles. These roles are discussed further below. The C, E, and G subunits have multiple isoforms, which are preferentially expressed in different tissues. C1 is ubiquitous, while C2 is found in the lung, kidney and epididymis. The E1 isoform localizes to the testis, and the E2 isoform is ubiquitous (34, 35). G1 is ubiquitous, while G2 is found in neural tissue, and G3 is found in renal, and epididymis tissue (12, 15, 17, 36).

The C subunit, Vma5p in yeast, has its crystal structure solved to within 1.75Å (36) and shares no homology with the F-ATPase (37). The primary function of the C subunit is to function as a ratcheting mechanism to hold the V1 to the V0 such that rotational energy generated from the V1 can drive the rotation of the proteolipid in the V0 (38). The C subunit binds to actin and facilitates in coordination with the cytoskeleton (39). Other work has shown that the C subunit also binds ADP, and to a lower affinity, ATP, and may be important in facilitating ATP entrance to the catalytic headpiece (40).

7 The E subunit, Vma4p in yeast, has a partial NMR structure available from yeast VATPase (41). The E subunit is required for yeast V-ATPase assembly, as Δvma4 yeast did not have V1-V0 attachment (42). More recent work with Vma4p has suggested that the E subunit interacts with the catalytic a3B3 hexamer, and may also interact with the H subunit, extending its reach from the V0 to the V1 domain (43). The E subunit possesses multiple isoforms in mammalian tissues. Work with the E subunit in C. elegans has shown that interference with the expression of the E subunit causes severe defects in embryogenesis and interferes with receptor mediated endocytosis (44).

The G subunit, Vma10p in yeast, was identified to be necessary for yeast growth. Absence of the VMA10 gene prevented yeast growth (45). Further mutagenesis studies with VMA10 showed that the G subunit was required for V1-V0 attachment, and that the G subunit may dimerize with the E subunit to form a larger stationary peripheral stalk (46).

The H subunit, Vma13p in yeast, is one of the only subunits not required for V1-V0 attachment and assembly, but is required for ATP hydrolysis. Furthermore, Δvma13 V-ATPase are less stable than wild-type V-ATPases (47). When V-ATPase is disassociated and the V1 is detached from the V0 section, the H subunit plays a greater role in that it prevents the hydrolysis of ATP from the freed catalytic headpiece. This action prevents the depletion of ATP within the organism. This action is accomplished by the H subunit binding to the F subunit (48). The H subunit in mammalian organisms has also been seen to act as a scaffold for protein interactions. Vma13p in humans is also known as NPB1, and shares homology with β-Adaptins (49). NPB1 was found to interact with HIV protein Nef, and the interaction of NPB1 with Nef aided the endocytosis of Nef (50). 3.1.3.2 Structure and function of the V0 complex The V0 complex is comprised of the a, d, e, c, c’ (yeast only), c’’, and Ac45 subunits, and forms a 260 kDa integral complex with a stoichiometry in mammalian organisms of ac5c”deAc45, responsible for the movement of protons from the cytoplasmic to luminal space. The V0 can be divided into the stator and rotor categories; however, each subunit in this domain also participates in roles beyond the core V-ATPase proton pumping function. Furthermore, most

8 subunits play multiple roles beyond proton pumping. Hence, discussion of each subunit individually is key to understanding the diversity of functions the V0 serves. Structure of the a subunit – The a subunit is a 116 kDa protein in mammalian organisms, and a 100 kDa protein in yeast. In yeast, the a subunit is present as two isoforms: Vph1p and Stv1p. Little is known about the structure of the a subunit in mammalian organisms, however, more is known about the topology of the a subunit ortholog, Vph1p, in yeast. The yeast a subunit consists of two distinct domains, NTa, which is the N-terminal hydrophilic half that is cytoplasmic, and the CTa, the C-terminal half, which is a hydrophobic integral membrane polypeptide. The NTa is thought to have a bifurcated structure (51). The CTa, by in silico and in vitro consensus, is thought to have 8 transmembrane domains with the C-termini being cytoplasmic. It also has several cytoplasmic loops (CL’s) extracellular (or luminal) loops (EL’s) and a C-terminal domain (52)(Fig. 3 ). The relative positions of the α-helices remains the subject of speculation. Work on the structure of the a subunit has provided low resolution NMR of a small portion of TM-7 (53), and further work on the eubacterial I subunit (homolog of the eukaryotic a subunit) has also provided new knowledge on the 3D structure of V-ATPase (54). Most recently, sub-nanometre resolution of the I subunit (a subunit homolog in T. thermophilus) has been obtained. This sub-nanometre structure suggests that the I subunit transmembrane domains form two bundles which may form hemi-channels interfacing both the cytosol and periplasm (55). There is precedence to suggest that these hemi-channels form the entry and exit channels for protons moving through the membrane, discussed below.

Functions of the a subunit – Of all the subunits within the V-ATPase, the a subunit is by far the most diverse in terms of its functional capabilities. Part of the subunits responsible for functioning as “stator” subunits, the a subunit forms the membrane embedded portion of the stator. The bifurcated portion of the NTa binds to the A and B subunits holding them in place (51). Energy from the catalytic headpiece turned into torque in the central stalk drives the rotation of the proteolipid cylinder of c, c’ and c’’ subunits. Protons entering these subunits must first enter through a hypothesized entry hemi-channel within the a subunit, pass through the proteolipid c, c’, and c’’ subunits, and then out again to the lumen through a hypothesized exit hemi-channel in the a subunit once more. Protons entering the entry hemi-channel are gated by a

9 critical arginine residue within the a subunit. TM-7 of the a subunit contains this Arg residue (R735 in yeast, R740 in human) critical for the translocation of protons from the cytoplasmic to the luminal side of the membrane. Absence of the R735 residue abrogates proton translocation (56). The location of the exit hemi-channel is unknown, but is hypothesized to exist within TM-3 or TM-4 (52).

Beyond its proton translocation and stator functions, the a subunit is also involved in the regulation of V1-V0 disassociation and reassociation in response to changes in cellular homeostasis (57). Furthermore, the a subunit may also serve as a pH sensor (8), as a mediator of membrane fusion of phagosomes to lysosomes (58), energy metabolism (59), and interaction with several other trafficking factors (60).

Most importantly, the a subunit is involved in the regulation of V-ATPase targeting to specific organelles. This function is achieved due to the many isoforms the a subunit possesses. Stv1p and Vph1p share 54% sequence identity (61), however the former is targeted to the Golgi while the latter is targeted to the vacuole. Further studies have shown that creation of a Stv1pNTa-Vph1p-CTa chimera targeted V-ATPase to the Golgi. Likewise, a Vph1p-NTa-Stv1p-CTa chimera targeted V-ATPase to the vacuole, suggesting that the NTa is responsible for V-ATPase targeting in yeast (62). Although the precise mechanism of V-ATPase targeting in mammals is currently unclear, it is well known that ‘isocomplexes’ of V-ATPases containing isoforms of the a subunit are responsible for the targeting of V-ATPase to specific organelles. The a1 containing isocomplex of V-ATPase is targeted to neuronal tissue, a3 is highly enriched at the ruffled border and lysosomal organelles in osteoclasts, and a4 is found specifically in the apical membrane of renal intercalated cells in the kidney. The a2 isoform is ubiquitous, but is found in the acrosomal membrane of sperm (17, 63, 64).

As discussed above, rotation of the central stalk drives the rotation of the proteolipid ‘barrel’ of subunits in the V0 domain; these subunits are the c, c’, and c’’ subunits. In yeast, these are the Vma3p, Vma11p and Vma16p subunits, forming a barrel with a stoichiometry of c4c’c’’; in mammalian systems, the lack of the c’ subunit creates a subunit stoichiometry of c5c’’ (65). The barrel of c subunits picks up protons through a buried glutamate residue in their

10 transmembrane domain. Mutagenesis of any one of the glutamate residues in the barrel abrogates proton translocation (66). DCCD, concanamycin, and bafilomycin share a binding site within the barrel of c subunits, and abrogate proton translocation activity (67, 68). Other than its role in proton translocation, recent evidence has also shown that the barrel of c subunits may also promote conditions necessary for the SNARE dependent fusion of yeast vacuoles (69).

The d subunit, Vma6p in yeast, is required for V1-V0 attachment. Additionally, in mutants lacking Vma6p, components of the V0 domain become destabilized, suggesting the d subunit is required for V0 stability (70). The d subunit also couples ATP hydrolysis and proton translocation (71). Perhaps the greatest amount of knowledge about the d subunit is known in osteoclastogenesis with the d2 isoform. d2 is expressed in the skeletal muscle, heart and spleen. The d2 isoform has been shown to be increasingly important in cell signaling during osteoclastogenesis. Adrm1, a factor involved in cell migration and osteoclast maturation physically interacts with d2 (72). Furthermore, mice deficient in d2 display impaired osteoclast fusion and decreased bone formation (73).

The e subunit is Vma9p in yeast. The disruption of VMA9 prevents the association of the V1 and V0 subunits in the vacuole and also results in decreased amounts of Vph1p and Stv1p. One theory as to its purpose suggests that it might function as a stator subunit that interfaces with the proteolipid barrel of c subunits (74).

The Ac45 subunit has no yeast homolog, and is the well understood out of all V-ATPase subunits. The 45kDa subunit was discovered in bovine chromaffin granules at a size of 45 kDa (75). The Ac45 subunit is thought to be involved in V-ATPase regulation. Studies have suggested that the Ac45 subunit may be involved in guiding V-ATPase through the secretory pathway, regulating a V-ATPase mediated process of peptide secretion from melanotrope cells in amphibians (76). Recently, Ac45 has also been shown to be necessary for osteoclast formation and function (77).

11 3.1.4

V-ATPase assembly

The assembly of V-ATPase is a complex process that is not yet well understood. The assembly factors and assembly pathway in yeast V-ATPases is the best characterized, while mammalian V-ATPase assembly factors and assembly methods have yet to be fully elucidated.

The assembly of the V1 to the V0 is also a poorly understood process. The biosynthesis of V-ATPase is thought to follow either an “independent pathway”, where a fully assembled V1 complex combines with a fully assembled V0 complex, or a “concerted pathway”, where partly assembled V1 and V0 subunits combine to form an assembled V1-V0 complex (78). The preferred model of assembly is still debated (22, 79).

Assembly of the yeast V-ATPase complex involves several characterized chaperones: Vma12p, Vma21p, Vma22p, Voa1p and regulator of assembly RAVE (Regulator of Vacuolar and Endosomal membranes), which assist V-ATPase biosynthesis and assembly at various points (80, 80-82). Vma12p and Vma22p assist in the folding of Vph1p by forming a transiently interacting complex with the nascent Vph1p a subunit. It has also been suggested that the Vma21p/Vma22p complex assists in the folding of the NTa of Vph1p (82). The role of Vma21p is more defined. In Δvma12 and Δvma22 yeast Vph1p stability is compromised, however, Vph1p still associates with Vma3p (the c subunit), suggesting that Vma21p is important in facilitating the interaction of Vph1p with Vma3p. Vma21p possess a bona fide ER-retrieval signal, hence, its interaction with Vph1p suggests that Vma21p escorts assembled V-ATPase to the Golgi for further processing (83). The actions of Vma12p, Vma21p, and Vma22p only account for the chaperone assembly of the Vph1p and Vma3p subunits, and then subsequent delivery of the V0 complex to the Golgi. To join the Vma3p subunit to Vph1p, a novel chaperone, Voa1p is utilized. Voa1p interacts with the Vma12p/Vma22p/Vph1p complex and the Vma3p, Vma11p, and Vma16p complex and then disassociates upon full V0 assembly (81). Assembly of V-ATPases in mammalian organisms is less clear. Recent evidence has suggested that two factors, (pro)renin receptor and presenilin-1 may play a role in the assembly of their tissue specific V-ATPases. The prorenin receptor is a single transmembrane domain protein that contributes to the uptake of renin/prorenin, which are important players in the renin-

12 angiotensin system, a system necessary for water and salt retention and circulating blood volume increases. A portion of the (pro)renin receptor physically interacts with the V-ATPase, although the precise site of interaction is unknown. Ablation of (pro)renin receptor expression causes decreased V0 subunit expression, resulting in the deacidification of intracellular vesicles, leading to cardiomyocyte apoptosis (84). In neuronal cells with the a1 containing V-ATPases, presenilin1 has been shown to play a potential role in V-ATPase assembly. Absence of presenilin-1 abrogates a1 glycosylation, preventing its exit from the ER (2, 4). 3.1.5

V-ATPase glycosylation

The N-linked glycosylation of polypeptides begins with the co-translational transfer of Glc3Man9GlcNac2-PP-dolichol to the nascent polypeptide at Asn-X-Ser/Thr residues, where X represents any amino acid except Pro, at the ER lumen interface. Once the Glc3Man9GlcNac2 oligosaccharide

is

attached

to

the

aspargine

residue

of

the

polypeptide

by

oligosaccharyltransferase (OST), the structure is termed ‘high-mannose’ to reflect its mannose residue content. The positioning of the transmembrane segment during oligosaccharide transfer closely resembles its final position in the lipid bi-layer (85). Processing of the N-linked highmannose oligosaccharide peptide begins by the removal of glucose residues by α-glycosyidases, which enables interaction with lectin chaperones calnexin and calreticulin. Later, αmannosidases remove the α1,2-linked mannose residues from the high-mannose glycoprotein, which results in the transfer of the glycoprotein to the Golgi for further processing. This allows for the formation of ‘hybrid’ and ‘complex’ oligosaccharides consisting of complex sugars such as fucose, sialic acid and galactose on the Man8GlcNac2 structure. This effectively increases the molecular weight of the protein attached to it (86-92). The N-linked oligosaccharide structure on polypeptides confers some level of chaperoning properties, and prevents the association of hydrophobic patches of protein with other nascent polypeptides. Furthermore, association of lectin chaperones such as calnexin and calreticulin promote the proper folding of glycoproteins (93).

OST’s active site resides 30Å into the ER lumen, facing away from the inner membrane surface of the ER lipid bilayer. For topological analysis of transmembrane domain positions, locating the positions of N-glycosylation sites provides a reasonably accurate estimate of the distance from an NxS/T site to the membrane surface. Studies of leader peptidase in E. coli have

13 shown that the NxS/T site had to be placed 12 residues away from the hydrophobic end of a TM segment, and 14 residues prior to the beginning of a TM segment. Utilization of this knowledge in other polytopic membrane proteins aids in locating the positions of the end of one TM segment and the beginning of another (85, 94).

Two subunits in the V0 domain in mammalian organisms are known to be N-glycosylated. These are the Ac45 and a subunits. The Ac45 subunit possesses several N-glycosylation sites. Tunicamycin, an inhibitor of GlcNac phosphotransferase and thus an inhibitor of Glc3Man9GlcNac2 transfer, prevents the N-glycosylation and processing of Ac45. It is thought that processed Ac45 aids in the activation of V-ATPase proton pumping.

Each a subunit isoform, and yeast a subunit ortholog Vph1p, possesses a varying number of NxS/T motifs, as predicted by in silico methods (Fig. 4). The mammalian a subunit has a theoretical molecular weight of 93 kDa, but runs in SDS-PAGE at 116 kDa. Yeast Vph1p runs in SDS-PAGE at 100 kDa and has a theoretical weight at 95 kDa. In silico prediction of the location of NxS/T motifs suggests variations in motif number and location amongst a subunit isoforms and orthologs (Fig. 4). The a subunit has been shown to be N-glycosylated, and more recently, a1 subunit N-glycosylation has been demonstrated (4, 95). There is no biochemical evidence suggesting where glycosylation sites in each a subunit isoform occurs, or if there are any active N-glycosylation sites in other a subunit isoforms. 3.1.6

V-ATPase in human disease

Since V-ATPase is found in a variety of contexts, changes to V-ATPase results in an array of diseases ranging from weak to strong phenotypes and non-fatal to fatal prognoses. There are both indirect (chaperones, signaling molecules) and direct factors (amino acid sequence) that when changed from normal, can contribute to V-ATPase related disease.

An example of a pathological scenario in which changes to the molecular chaperone of mammalian V-ATPase, presenilin-1, can be found in patients with familial Alzheimer’s disease (FAD). FAD most commonly results from mutations in the genes encoding for presenilin-1. Presenilin-1 is a transmembrane protein with functions in cell adhesion, apoptosis and nerve cell growth. A portion of the protein is cleaved in the endoplasmic reticulum (ER). In a mouse model,

14 it was shown that the absence of the mouse homolog of presenilin-1 leads to defective autophagic vacuole clearance, thus leading to the accumulation of amyloid-β peptide. It was found that autophagic vacuole clearance was defective because the necessary pH environment needed to break down amyloid-β peptides was not present. This was caused by an absence of VATPase at the autophagolysosomal membrane. Presenilin-1 was hypothesized to be a necessary molecular chaperone required for V-ATPase a1 folding, and was found to co-immunoprecipitate with the a1 subunit. The absence of presenilin-1 prevented V-ATPase assembly and exit from the ER, thus leading to insufficiently acidified autophagic vesicles. (2, 4).

Direct alterations in the amino acid sequence of V-ATPase due to inherited genetic mutations lead to disease. Ultimately, a mutation’s manifestation results in V-ATPase underperformance or ablation of activity in physiological roles. Several diseases caused by genetically inherited mutations are known. There are four known diseases in which mutations in V-ATPase genes lead to disease; these include: deafness, cutis laxa, osteopetrosis, and acidosis.

Mutations in the gene encoding V-ATPase B1 (ATP6V1B1) are responsible for deafness in individuals harboring G123V and R157C mutations (96). pH homeostasis varies in different regions of the inner ear. Deafness can result from changes in the pH of the endolymphatic sac, a sac found within the saccule of the ear, which continues into the cochlea (97). Recently, it was shown that ATP6V1B1 mRNA is expressed in both the fetal and adult cochlea (98). In mice, it is known that B1 containing V-ATPases are found in the interdental cells in the cochlea, and these cells interface directly with the endolymphatic sac (99). Patients with B1 mutations were reported to have enlargement of the vestibular aqueduct and endolymphatic sac. Presumably, the changes in pH homeostasis due to V-ATPase inactivity lead to changes in endolymphatic sac pH. Precisely how these mutations affect B1 structure and function remains to be investigated.

Mutations in the gene encoding V-ATPase a2 (ATP6V0a2) are responsible for cutis laxa. Cutis laxa is a rare inherited disorder where the patient presents with sagging skin, giving an aged appearance. Autosomal recessive forms of this disease are not fatal and have good clinical outcomes. Besides wrinkling and saggy skin, patients with autosomal recessive cutis laxa type II (ARCL-II) present with growth retardation, osteoporosis, and developmental delay (100). A

15 specific missense mutation in a2, P416L, is known to result in ARCL-II. Elastin is a key protein necessary for the cross-linking of collagen fibrils. Cells from patients with ARCL-II due to a2 mutations show accumulation of the inactive form of elastin, tropo-elastin, in the Golgi and cytoplasmic bodies. Furthermore, the secretion of elastin is impaired in these patients. It has been hypothesized that a2 mutations prevent acidification of the Golgi, and thus prevent the necessary pH in which modifying enzymes involved in the conversion of tropo-elastin to elastin is possible. The exact mechanism behind a2 mutations effect on V-ATPase structure and function and its connection to Golgi dysfunction and impaired tropo-elastin to elastin conversion remains unclear. It has been hypothesized that these a2 mutations may impair ARF6/ARNO interactions with VATPase, or that V-ATPase function may be affected. (101, 102).

Mutations in the gene encoding V-ATPase a3 (Tcirg1) are known to cause infantile autosomal recessive osteopetrosis (iARO). iARO is a disease in which normal bone resorption by osteoclasts is prevented during development, resulting in pathologically increased bone mass. Patients are severely osteopetrotic, anemic, exhibit growth retardation, cranial nerve compression, and macrocephaly. Current treatment modalities require extensive bone marrow transplantation. Approximately 50% of patients exhibiting iARO have mutations in Tcirg1 (103). The majority of mutations in Tcirg1 are intron-splicing errors, and these often prevent expression of coding DNA sequence. Missense mutations in Tcirg1 have also been found, which result in amino acid substitutions in a3 (104-106). The severity of the disease resulting from the effects of missense mutations suggests that these missense mutations alter a3 structure and/or function profoundly. The effects of some of these mutations on a subunit structure and function have been characterized by Ochotny et. al in 2006 and are described in the next section.

Mutations in the gene encoding for V-ATPase a4 (ATP6V0a4) are known to cause autosomal recessive distal renal tubular acidosis (dRTA). dRTA is an easily treatable condition characterized by a defect in H+ secretion into the urine, leading to decreased pH in the bloodstream and change in normal plasma CO2/HCO3 balance. Clinical symptoms of this disease include nephrocalcinosis and rickets. Several missense mutations in a4 have been identified. Two missense mutations have been characterized by Ochotny et. al in 2006, and were shown to affect V-ATPase functionality (107). Additionally, a third mutation was identified, R807Q,

16 which

resulted

in

altered

protein-protein

interaction

between

the

a

subunit

and

phosphofructokinase-1 (59). The effects of characterized mutations on a subunit structure and function are described in the next section.

3.1.7

Point mutations aid in the study of V-ATPase structure and function

A suitable model organism to study V-ATPase structure and function has been the S. cerevisiae (baker’s yeast). This is because most biochemical knowledge of V-ATPase has been elucidated through studies of yeast V-ATPase. Viability assays and V-ATPase activity assays have allowed for greater understanding of V-ATPase assembly, structure, activity, and its interactions with other proteins. The study of the effects of missense mutations on V-ATPase is possible because there is a high degree of sequence similarity and identity across the orthologous subunits of V-ATPase from different species. Vph1p and mammalian a subunits share 36% sequence identity, and an even greater sequence similarity (Table 2). Furthermore, certain amino acids are conserved across an even greater variety of V-ATPases (Fig. 5). One such example is the R735 amino acid of the a subunit, which is conserved across all species of V-ATPase and is weakly conserved in F1-F0 ATP synthase (56). Interestingly, amino acids where human mutations are present in a3 and a4 and that result in disease are perfectly conserved across human and yeast V-ATPases. The study of these mutations in yeast V-ATPase has provided new information regarding the structure and function of V-ATPases. For example, the G820R mutation in a4, resulting in dRTA, is conserved across all a subunit isoforms in mammalian organisms and in Vph1p. Previous studies have shown that the G820R mutation recreated in Vph1p affects V-ATPase hydrolytic and pumping activity, but not V-ATPase assembly (107). G820R was also found to impair Vph1p interaction with phosphofructokinase-1, thus indicating that the C-terminal of Vph1p participates in proteinprotein interactions with the glycolytic enzyme phosphofructokinase-1 (59). 3.1.8

Human mutations at R444

The R444 amino acid is of interest evolutionarily, as this amino acid’s identity is conserved across yeast, mammalian, and bacterial a subunit isoforms, representing a gamut of organisms with this amino acid (Fig. 6). An arginine to leucine mutation at this amino acid in a3

17 is known to result in iARO (108). An arginine to histidine point mutation at this amino acid in a4 has been shown to result in dRTA (96). Curiously, study of the R444L mutation in a3, reconstructed in yeast Vph1p as R462L, showed that the arginine to leucine mutation resulted in wild-type like vacuolar acidification, and reduced proton translocation by 30-35% (107). This amino acid has strong biological relevance in the human a subunit, as mutation of this arginine at position 444 results in two different diseases in both the a3 and a4 isoforms of the mammalian a subunit. 3.2

Statement of the problem

Despite the clear evolutionary conservation of R444, and despite evidence from human diseases associated with the R444 mutation that this residue is important for V-ATPase function; attempts to elucidate the effects of the arginine to leucine mutation at amino acid 444 have not yielded a molecular mechanism that may explain the phenotype seen in humans with iARO and dRTA, nor explain the role of this conserved residue in yeast or mammalian systems.

3.3

Hypothesis

I hypothesize that mutation of arginine at position 444 in mammalian a subunit alters a subunit protein conformation and thus changes a subunit structure, thereby preventing the cell’s ability to produce a functional a3 or a4 containing V-ATPase.

3.4

Objective

The objective of this study was to characterize the effects of the R444L mutation on a3 containing V-ATPase structure and function, and ascertain the role this arginine plays in a subunit structure and function. To approach this study, I first studied the relevance of the R462 amino acid in yeast Vph1p to V-ATPase function, to judge whether Vph1p could be used as a suitable model system. Then, I addressed the effects of this mutation in mammalian V-ATPases by directly studying the effects of this mutation in mouse mammalian a3.

18 3.5

Significance of research

This research adds significantly to our overall understanding of the structure and function of the V-ATPase a subunit. It provides us an opportunity to understand some of the unique biochemical characteristics of the mammalian a subunit. Furthermore, this work highlights a possible disconnect between mammalian and yeast V-ATPase ER processing. Utilization of this knowledge could be beneficial clinically. Knowledge of the effects this mutation plays in VATPase may lead to new therapeutic avenues for patients suffering from iARO or dRTA.

4

METHODOLOGY 4.1

Reagents and antibodies

TPCK-trypsin (catalog no. T1426), mammalian protease inhibitors (P8340), phosphatase inhibitors (P5726) and puromycin (P7255) were from Sigma-Aldrich. Peptide:N-glycosidase F (PNGase F; P0704S) and endo-β-N-acetylglucosaminidase H (Endo H; P0702S) were from New England Biolabs. Fugene HD was from Roche Applied Science. Site-directed mutagenesis was performed using the Quikchange Lightning Site-Directed Mutagenesis Kit from Agilent Technologies. 10X RIPA buffer (9806) was from Cell Signaling Technologies and was diluted with ultraPURE water (GIBCO). High-glucose DMEM (11965-118) and α-MEM (12561-072) were from Invitrogen. Antibodies were from: anti-GFP (G1544) Sigma; anti-LAMP2 (ABL-93), the Developmental Hybridoma State Bank, Iowa; anti-calnexin (Ma3-27), BD Biosciences; Alexa Fluor 568 goat anti-rabbit IgG (A11011), Invitrogen.

4.2

Yeast strains

All strains used in this work are shown in Table 1 and were derived from the yeast strain MM53 MATa ura3-52 Δvph1::LEU2 and plasmids pMM112 (pRS316 vector), and pMM322 pRS316 + VPH1 (61). To generate pMM981-982, pMM322 was subjected to mutagenesis with primers for R462D resulting in pRS316 + R462D Vph1p, and with primers for R462E resulting in pRS316 + R462E Vph1p. Mutagenesis was performed using the Quikchange site directed mutagenesis kit (Agilent Technologies) using manufacturers suggested conditions. Yeast cells were transiently transformed and selected on SD –URA plates. For a complete list of yeast mutagenesis primers used, see Table 4. 4.3

Scoring growth phenotype

To score the growth phenotype of transiently transformed yeast, exponentially growing yeast cells were cultured to a concentration of 1×107 cells/mL and placed in 1 well of a 96-well plate. Five serial dilutions were made from the original stock such that the final concentration in the last well was 1×105 cells/mL. 10µL of each well was spotted onto SD –URA plates, and 4mM YPD ZnCl2 plates. Plates were incubated at 30°C for 5 days. For temperature sensitivity

19

20 experiments, yeast plated onto SD –URA plates, and 4mM YPD ZnCl2 plates were incubated at 25°C and 37°C. 4.4

Mammalian constructs

The R445L, N41Q, N484Q and N504Q mutations were introduced by site-directed mutagenesis into mouse a3 subunit cDNA (a gift of Dr. Beth S. Lee, Ohio State University), which was previously cloned into the pEGFP-N1 plasmid (Clontech) by cutting the plasmid and insert with EcoRI and SacII, and through mutagenesis using Quikchange site directed mutagenesis kit (Agilent Technologies). Primers for mutagenesis are provided in Table 4. 4.5

Cell culture, media, and reagents

Yeast cells were typically grown YPD medium consisting of 10 g/L yeast extract (Difco), 20 g/l bacto-peptone (Difco), and 20 g/L dextrose. RAW cells were grown in DMEM supplemented with 10% FBS and antibiotics (Invitrogen). Mammalian cells were grown at 37 °C in a 5% CO2 humidified incubator. FBS was heat inactivated in-house at 56 °C for 1 h.

4.6

Mammalian cell transfection

Wild type a3, a3(N41Q) and the double-mutant, a3(N484Q/N504Q) constructs were used for exogenous expression of C-terminally GFP-tagged a3 proteins. HeLa cells were seeded at 1.0 x 106 cells/well in 100 mm tissue culture dishes and maintained in DMEM supplemented with 10% FBS until 85% confluent. The medium was replaced with Opti-MEM after washing cells with PBS, 24 h prior to transfection. Cells were transfected with 10 µg of DNA, using Fugene HD at a Fugene/DNA ratio of 6:2.

4.7

Creation of mammalian cell lines

Primer pairs were designed according to GenBank numbers NM_001136091.2 and U55761.1 to generate XhoI and EcoRI restriction sites flanked WT V-ATPase a3-EGFP and R445L V-ATPase a3-EGFP fragments, using a recombinant pEGFP-N1 (Clontech, Palo Alto, CA) containing the corresponding cDNA as the template. The resulting PCR products were ligated into retroviral vector pMSCVpuro (Clontech; provided by Drs. Helen Sarantis and Scott D. Gray-Owen, Department of Molecular and Medical Genetics, University of Toronto) digested by XhoI/EcoRI. A control recombinant retrovirus vector pMSCVpuro-EGFP was kindly

21 provided by Drs. Helen Sarantis and Scott D. Gray-Owen (Department of Molecular and Medical Genetics, University of Toronto). Briefly, EGFP was amplified from pEGFP-N1 using cloning primers generating BamHI and EcoRI sites flanking EGFP. The PCR product was digested with BamHI and EcoRI and ligated into pMSCVpuro, which had been digested with BglII and EcoRI. The sequences of the inserts were confirmed by sequencing (ACGT Corporation, Toronto, Canada). Viruses were generated by co-transfecting GP-293 (Clontech) cells (30–40% confluent, six-well tissue culture plate) with 2 µg pVSV-G and 2 µg pMSCVpuro V-ATPase (WT or R445 a3)-EGFP or pMSCVpuro-EGFP with FuGENE HD. The resulting virus supernatant was used to infect RAW264.7 cells (passage 3). The positive cells were selected by adding puromycin for two weeks (final concentration 7 µg/mL) 48 hours after infection. The stable cell lines were maintained in cell culture medium containing 4 µg/mL puromycin for all the experiments. A list of cloning primers and constructs used is summarized in Table 4.

4.8

RNA extraction

RAW 264.7 cells plated in 100 mm tissue culture treated dishes at a density of 0.7×106 cells/dish were differentiated for osteoclastogenesis with 100 ng/mL soluble recombinant RANK-L. Cells were cultured for 120 hrs. Total RNA was extracted using TRIzol reagent, by following manufacturer’s protocol. Total RNA was treated with DNAse I (Invitrogen) at 1 unit of DNAse I/µg RNA and then reverse transcribed using Revert Aid H － First Strand Kit (Fermentas). Primers used for probing GAPDH, and GFP are summarized in Table 4. PCR was performed using HotStar Taq enzyme (Qiagen). 4.9

Protein extraction

For macrophage whole cell lysates, transduced RAW 264.7 cells plated in 10 cm2 tissue culture dishes at a cell density of 1×106 cells/dish were cultured for 48 hrs. For osteoclast whole cell lysates, transduced RAW 264.7 cells plated in 10 cm2 tissue culture dishes at a cell density of 0.7×106 cells/dish were differentiated for osteoclastogenesis with 100 ng/mL soluble, recombinant RANK-L. Cells were cultured for 24, 72, or 120 hrs depending on experimental time point. Both macrophage and osteoclast proteins were collected by washing cells with 1x PBS twice followed by 1x RIPA buffer (Cell Signaling Technologies). Proteins were harvested by following manufacturers instructions. For macrophage membrane proteins, cells plated on 10

22 cm2 tissue culture dishes at a cell density of 1×106 cells/dish were cultured for 48 hrs. After cells were washed twice in ice-cold PBS, cells were scraped on ice in the presence of membrane protein collection buffer (10 mM KCl, 1.5 mM MgCl2, 10 mM Tris-HCl, pH 7.4 at 25 °C, 50mM Na2HPO4, 2 mM DTT, mammalian protease inhibitor cocktail (1:200, v/v) and 1 mM phenylmethylsulfonyl fluoride (PMSF) from 100 mM stock in anhydrous ethanol). The cell suspension was homogenized by passage through a 0.5 in., 27.5 ga. syringe needle 15–20 times and was then centrifuged at 5,000 x g for 10 min. The supernatant was centrifuged at 100,000 x g for 1 h and the membrane pellet was resuspended in 150 µl membrane protein collection buffer. For proteins isolated from HeLa cells, cells were harvested 48 h post-transfection, after washing twice in ice-cold PBS, by scraping on ice in the presence of hypotonic lysis buffer (10 mM KCl, 1.5 mM MgCl2, 2 mM dithiothreitol, 10 mM Tris-HCl, pH 7.4 at 25 °C, with the addition of mammalian protease inhibitor cocktail (1:200, v/v) and 1 mM phenylmethylsulfonyl fluoride (PMSF) from 100 mM stock in anhydrous ethanol). The cell suspension was homogenized by passage through a 0.5 in., 27.5 ga. syringe needle 15–20 times and was then centrifuged at 5,000g for 10 min. The supernatant was centrifuged at 100,000g for 1 h and the microsomal membrane pellet was resuspended in 50 µl hypotonic lysis buffer. 4.10 Isolation of mouse whole cell lysate Bone marrow-derived osteoclasts from femurs of two month old male mice were plated in 100 mm tissue culture dishes (1 x 105 cells/mL) in 10% FBS in alpha-MEM + 1% antibiotics supplemented with 50 ng/mL M-CSF (Calbiochem) for two days, and then with 50ng/mL MCSF and 200 ng/mL RANK-L for another 4 days. At day 6, plates were washed 2x cold PBS and lysed in lysis buffer (0.1% triton X-100, 50 mM Tris, 300 mM NaCl, 5 mM EDTA, protease inhibitors Sigma P8340, phosphatase inhibitors Sigma P5726, and 1 mM PMSF). 4.11 Deglycosylation of a3 and a3-GFP Glycoproteins were deglycosylated with PNGase F or Endo H (New England Biolabs) according to a modification of the suppliers’ protocol. Membrane pellets or whole cell lysates (15-20 µg total protein) were diluted to a final volume of 30 µl in glycoprotein denaturing buffer (manufacturer supplied). Proteins were denatured at 65°C for 10 min. then 1/10th vol. each of 10% Nonidet P-40 and 10X G7 reaction buffer (manufacturer supplied) were added, followed by 1000 u PNGase F. The final volume was adjusted to 40 µl with distilled water). The reaction

23 mixture was incubated for 1 h at 37 °C. Proteins were then solubilized by addition of 5X SDSPAGE gel-loading buffer and resolved on 7% or 10% polyacrylamide gels. The a3-GFP fusion proteins were visualized by immunoblotting with anti-GFP antibody. 4.12 Western blotting Anti-GFP antibodies were used at a concentration of 1/100, and anti-GAPDH at a concentration of 1/10,000, secondary antibodies were HRP-GαRabbit. Images were developed with Western Lightning ECL detection solution (cat. no. NEL102001, PerkinElmer) and bands were photographed and quantified in a Bio-Rad Molecular Imager ChemiDoc™ XRS system using Quantity One 4.6.9 Software. 4.13 Immunostaining and confocal microscopy a3-GFP, a3R445L-GFP and GFP cell lines were fixed in 2% paraformaldehyde (pH 7.4 at 25°C) in microtubule stabilizing buffer (MTSB) (127 mM NaCl, 5 mM KCl, 1.1 mM Na2HPO4, 0.4 mM K2HPO4, 2 mM MgCl2 5.5 mM Glucose, 20 mM PIPES, pH 7.4 at 25 °C) for 20 min. followed by permeabilization in 0.1% Saponin with 100 mM glycine in MTSB for 20 min. Cells were then blocked in 5% fetal calf serum in 0.05% Saponin in MTSB at room temperature for 1 hr. Cells were stained with primary antibodies (anti-LAMP2 ABL-93 (1/200), and anti-Calnexin Ma3-27 (1/100)) overnight. Cells were subsequently washed with 0.05% Saponin in MTSB and then incubated with compatible fluorescence-conjugated secondary antibodies (1/500). The cells were then incubated in PBS with 4’,6-diamidino-2-phenylindole (DAPI) (1:10,000) for 10 min for nuclear staining. Image acquisition was conducted with a Leica DMIRE2 inverted fluorescence microscope equipped with a Hamamatsu Back-Thinned EM-CCD camera and spinning disk confocal scan head. Image processing was conducted with Volocity 5.2 image acquisition software (Perkin Elmer, Waltham, MA) and post processed using Adobe Photoshop and Illustrator CS4 (Adobe Systems Inc.) 4.14 Quantitative confocal analysis Quantiative image colocalization analysis was conducted with Volocity 5.2. The values shown represent Pearson’s correlation coefficient (r). A threshold of r > 0.6 was used to define the presence of colocalization. Statistical analysis was conducted using a student’s paired t-test (Microsoft Excel, Redmond, WA) Error bars represent standard error of the mean (±SEM).

24 4.15 Trypsin proteolysis Transduced macrophage membrane protein was harvested as described earlier, however with Trypsin Proteolysis Buffer (TPB) (10 mM KCl, 1.5 mM MgCl2,10 mM Tris-HCl, pH 7.4 at 25°C, and 50mM Na2HPO4). Membrane proteins were lyophilized and then reconstituted in 100 µl TPB. A final concentration of 2.5 µg/mL or 5µg/mL of TPCK treated trypsin (prepared in 1 mM HCl pH 3 at 25°C with 20 mM CaCl2) was added to 15 µg of membrane protein. Proteolysis was conducted for strictly 1 hr at 37°C. Proteolysis was stopped using 10 mM TLCK; prepared in 1 mM HCl pH 3 at 25°C. Following this, trypsin treated proteins were deglycosylated using PNGase F as described earlier. 4.16 Quantitative protein analysis Quantification of proteins was conducted with the BioRad QuantityOne 4.6.9 software. (BioRad, Hercules, CA) Both glycosylated and unglycosylated protein from each sample was treated as a single band and quantified using rolling disk method, and normalized to GAPDH. For proteins quantified after trypsin proteolysis and subsequent deglycosylation, quantification was performed as mentioned above, but was normalized to control, untreated band intensity as follows; (intensity of band of interest) / (intensity of control untreated band) and then interpreted as a percentage. Statistical analysis was conducted using a student’s paired t-test (Microsoft Excel, Redmond, WA). Error bars represent standard error of the mean (±SEM).

5

RESULTS 5.1

A negatively charged amino acid at position 462 does not affect Vph1p function

Previous studies of amino acid 462 established that the substitution of a positively charged, polar amino acid for a non-polar residue reduced proton translocation by 30-35% (107). To test the functional relevance a positively charged amino acid at position 462 in Vph1p, Δvph1 yeast were transformed with VPH1 containing mutations at position 462 to produce negatively charged residues, R462D or R462E in Vph1p. To test for V-ATPase activity, R462D or R462E Vph1p containing yeast was cultured on Zn2+ containing plates. Yeast are sensitive to changes in ionic homeostasis in the cytosol. Hence, yeast must sequester cations into the vacuole in exchange for protons (61). Δvph1 yeast transformed with R462D or R462E Vph1p grew at comparable rates compared to a WT strain on YPD with 4mM ZnCl2 (Table 5). 5.2

a3R445L-GFP has significantly reduced protein expression in mature osteoclasts

Neither a positive, nor negatively charged amino acid at 462 was required for Vph1p function; hence, we decided to turn to a murine mammalian system to study the role of this arginine, which in mammalian a3 is R445. The disease mutation results in a primarily bone specific phenotype, hence, the RAW 264.7 cell line was chosen due to its capacity for osteoclastogenesis. WT and R445L a3 were fused C-terminally to EGFP, inserted into pMSCV murine stem cell virus retroviral expression constructs, and stably transduced into RAW 264.7 murine macrophages natively expressing WT a3. The resulting cell lines reliably expressed a3GFP fusion transcripts (Fig. 7A).

To confirm whether a3-GFP fusion proteins were membrane inserted, membrane proteins isolated from transduced macrophages differentiated into mature osteoclasts were run on SDSPAGE and subsequently immunoblotted with antibodies to GFP. The a3-GFP fusion protein has a theoretical predicted molecular weight of 121 kDa. Curiously, a3-GFP protein ran at 134 kDa, but a 152 kDa was also observed. Contrary to WT proteins, membrane proteins from a3R445LGFP osteoclasts revealed that the 152 kDa protein was absent, as only the 134 kDa protein was seen (Fig. 7B).

25

26 In Fig. 7B, a3R445L-GFP protein expression appeared diminished from a3-GFP. To quantify this decrease, whole cell lysates were collected from transduced macrophages cultured for 120 hrs in the presence and absence of RANK-L (Fig. 7C). To quantify a3-GFP, both 152 kDa and 134 kDa bands were interpreted as a single band. For a3R445L-GFP, the 134 kDa band was quantified. For the control pMSCV-GFP, the 27 kDa band was quantified. a3-GFP and pMSCVGFP expression were significantly increased in RANK-L treated cultures in comparison to nonRANK-L cultures (P=0.0040, P=0.0481). In contrast, a3R445L-GFP was found to significantly decrease in RANK-L treated cultures in comparison to non RANK-L cultures (P=0.0392) (Fig. 7D). 5.3

a3R445L-GFP is core-glycosylated but not processed

It has been demonstrated that the a1 subunit is N-glycosylated (4). To confirm whether the 152 kDa band present in a3-GFP was a result of N-glycosylation of a3, lysates of primary bone marrow derived mouse osteoclasts were treated with PNGase F. PNGase F is an enzyme that cleaves between the innermost N-acetylglucosamine and asparagine residues of highly mannosylated and complex oligosaacharides from N-linked glycoproteins. PNGase F treated WT a3 was resolved through SDS-PAGE and immunoblotted with antibodies specific to a3. a3 was found to be deglycosylated following PNGase F treatment, resulting in an unglycosylated protein at 95 kDa, and a core glycosylated protein at 100 kDa (Fig. 8A).

PNGase F treatment of a3-GFP from whole cell lysates deglycosylated the 152 kDa band in WT, leaving the unglycosylated protein at 134 kDa (Fig. 8B). Since the a3R445L-GFP protein did not show the same banding pattern as a3-GFP, we next decided to investigate whether the 134 kDa band in a3R445L-GFP was N-glycosylated. a3R445L-GFP macrophage cell lysate protein was treated with PNGase F. Interestingly, a3R445L-GFP protein was sensitive to PNGase F, and treatment resulted in a small 2-3 kDa shift (Fig. 8B). To confirm whether a3R445L-GFP N-glycosylation was not an artifact of transduction or a cell specific phenotype, R445L a3 and WT a3 DNA were cloned into pEGFP-N1 plasmid and membrane proteins were harvested from transfected HeLa cells. a3-GFP protein was found to be PNGase F sensitive, and a3R445L-GFP ran at the same size of the deglycosylated WT protein (Fig. 8C).

27 To discriminate whether the N-glycosylation of a3R445L-GFP was a result of its coreglycosylation, and not hybrid or complex glycosylation, we treated the protein with EndoH. Endo H, an endoglycosidase capable of cleaving the chitobiose core of highly mannosylated oligosaccharides, can be used to discriminate ER retained core-glycosylated proteins from hybrid or complex glycoproteins that have moved beyond the ER (85, 109). Treatment of a3-GFP and a3R445L-GFP protein with EndoH and followed by SDS-PAGE and subsequent immunoblotting with anti-GFP antibodies revealed that the N-glycosylated 152 kDa band was found to be insensitive to Endo H in a3-GFP samples. The core-glycosylated 134 kDa band was found to be sensitive to Endo H treatment in both a3-GFP and a3R445L-GFP samples (Fig. 8D). 5.4

a3R445L-GFP is retained within the endoplasmic reticulum

The Endo H sensitivity of a3R445L-GFP suggested to us that the a3R445L-GFP protein was ER retained. Misfolded glycoproteins targeted for degradation often are endoplasmic reticulum retained, and are held by ER-integral lectin binding chaperones such as calnexin. These proteins are often targeted for degradation (86, 88, 110). Normally, a3 in macrophages localizes to lysosomal membranes (111).Immunolabeling of a3-GFP macrophages with LAMP2 revealed a strong colocalization of a3-GFP with LAMP2 positive compartments as expected (Fig. 9A). In cells with a3R445L-GFP, a3 was found to localize in a perinuclear region nearby to, but not colocalized with LAMP-2-positive compartments (Fig. 9B). Calnexin strongly co-localized with a3R445L-GFP, (Fig. 9D) but not with a3-GFP (Fig. 9C). Quantification of LAMP2 colocalization, and calnexin colocalization with a3-GFP or a3R445L-GFP showed that a significantly greater extent of a3-GFP associated with lysosome rather than ER, and the converse proved to be the case with a3R445L-GFP (Fig. 9E). 5.5

a3R445L-GFP alters protein conformation

Since a3R445L-GFP protein was ER retained, core-glycosylated, and expressed less than a3GFP, it was of interest to determine if the R445L mutation affected the protein conformation of a3-GFP. To test this, WT and R445L membrane proteins were proteolytically cleaved in limiting amounts of trypsin.

28 a3-GFP and a3R445L-GFP membrane proteins were treated with 2.5µg/mL of trypsin, deglycosylated with PNGase F, run on SDS-gels and subsequently immunoblotted for antibodies to GFP. a3R445L-GFP membrane protein cleaved at a concentration of 2.5µg/mL resulted in a novel cleavage product at 26 kDa and 60 kDa, not found in a3-GFP membrane protein at the same trypsin concentration (Fig. 10A,B). a3R445L-GFP and a3-GFP membrane protein from transduced macrophages were also compared for susceptibility to trypsin proteolysis, a measure of the accessibility of trypsin to cleavage sites. a3-GFP and a3R445L-GFP protein was treated with 2.5µg/mL and 5µg/mL trypsin, deglycosylated with PNGase F, and resolved through SDS-PAGE and subsequently immunoblotted for antibodies to GFP. a3R445L-GFP was found to be more susceptible to trypsin proteolysis in comparison to a3-GFP at both tested concentrations of trypsin (P=0.049 for 2.5µg/mL, and P=0.038 for 5µg/mL) (Fig. 10C).

5.6

N484 and N504 are the glycosylation sites of a3

The contrast between the anomalous mobility of a3-GFP to a3R445L-GFP on SDS-PAGE due to a3-GFP’s increased apparent molecular weight (differing from theoretical molecular weight of 121 kDa), banding pattern, and sensitivity to PNGase F suggested to us that a3 is an Nglycosylated protein. This was confirmed by directly assessing the N-glycosylation of a3, which was also PNGase F sensitive. Examining the potential glycosylation sites in the mouse a3 polypeptide sequence in silico yielded two sites, N484 and N504, within the putative EL2 loop that were highly conserved (Fig. 11A, B). N41, a site within the NTa was also informative regarding topology, but studies have established that the NTa is within the cytoplasm (52, 112). Determining the location of these N-glycosylation sites, which must be luminally exposed, would assist in determining orientations of TMs in the N-terminal half of the CTa. Membrane proteins harvested from HeLa cells were transfected with site directed mutagenesis (N→Q) variants of a3-GFP, which lacked either the N41, or N484 and N504 glycosylation sites. Membrane proteins were treated with PNGase F and run on SDS-PAGE, with subsequent immunoblotting with anti-GFP antibodies. As expected, N41Q did not yield a change in the N-glycosylation of a3-GFP, as PNGase F treatment deglycosylated a3N41Q-GFP.

29 Double mutation of N484Q/N504Q into a3-GFP, creating a3N484Q/N504Q-GFP resulted in a sharp, smaller-sized unglycosylated a3-GFP band, insensitive to PNGase F treatment. These results demonstrated for the first time that the mouse a3 EL2 loop is N-glycosylated at two sites, N484 and

N504.

6

DISCUSSION 6.1

R462 is not critical for Vph1p function

In the present work, we sought to define the role of R462 in Vph1p function, in order to understand the molecular underpinnings behind the iARO phenotype caused by a R444L mutation in a3. More broadly, this study aimed to define the role of this arginine in a subunit function. Recent Vph1p topologies suggest that R462 is a buried residue in the TM3 domain (52, 112). TM3 has been hypothesized as a luminal hemi-channel. This luminal hemi-channel has been thought to exist as a series of charged residues that mediate the transfer of protons from the glutamic acids in the c, c’ and c’’ subunits out into the luminal space. Relatively little information regarding the location or characteristics of these residues has been elucidated (52, 113-115). Switching the charge of the R462 residue from positive to negative (R to D and E respectively) allowed us ascertain if a positively charged residue at position 462 was required for proton translocation. The precedence for this was set due to previous studies demonstrating that R→L mutagenesis reduced proton translocation by 30-35% (100, 106, 107). Notably, this reduction resulted in yeast viability on ZnCl2 comparable to WT (107). Our results demonstrated that the mutagenesis of amino acid 462 in yeast Vph1p from a positive to negative charge resulted in a comparable growth phenotype to WT on ZnCl2. This result, coupled with findings from (107) suggest that an arginine at position 462 is not critical for Vph1p function, as both oppositely charged, and non-polar uncharged residue substitutions at this position do not affect yeast viability. This is demonstrably unlike R735, an arginine essential for proton translocation. Site directed mutagenesis of this amino acid to almost any other amino acid abrogates proton translocation almost completely. The function of this R735 is also conserved in mouse a3 (R740 in mouse) (56, 116). Considering that R462 is not important in the function of the yeast a subunit, one could argue that yeast is not a good model system for studying human mutations at this residue. It could be, however, that the effects of mutations at this residue are mammalian a subunit specific. Pursuing this suggestion, we found evidence to suggest that the R444L mutation resulted in a mammalian a subunit specific phenotype.

30

31 6.2

R445 is necessary for proper mouse a3 folding

In humans, the R444L mutation leads to severe osteopetrosis. This missense mutation is phenotypically identical to a full a3 deletion, suggesting that the R444 residue in mammalian a3 is critical for its structure and/or function (117). Introduction of both WT and R445L mouse a3GFP into the mouse macrophage-like RAW264.7 cell line allowed us to directly compare the biochemical characteristics of both proteins in differentiated osteoclasts.

Quantitative comparison of protein expression showed that a3-GFP protein expression was significantly increased, and a3R445L-GFP protein expression significantly decreased in differentiated mature osteoclasts compared to undifferentiated RAW cells cultured for the same length of time. The increase of a3-GFP and pMSCV-GFP was at first an interesting finding. We speculated that transcriptional activation of the pMSCV viral LTR promoter by RANK-L downstream effectors drove up the expression of a3-GFP in retrovirally-transduced cells. The promoter is constitutive and can by induced by other signaling pathways. RANK-L activates a plethora of downstream anti-apoptotic kinases including the ERK pathway. ERK in particular is able to phosphorylate Sp1, a transcription factor-binding site within the LTR, and may increase translational output (118-120). We speculated that the reduced protein expression of a3R445L-GFP in mature osteoclasts was due to ER stress resulting from increased translational output of potentially misfolded a3R445L-GFP caused by RANK-L transcriptional activation of Sp1 on the LTR of pMSCV. Proteins that need post-translational modifications, such as N-glycosylation, are processed through the ER. Terminally misfolded protein can induce ER stress, followed by ER associated degradation (ERAD). If misfolded proteins accumulate, the unfolded protein response (UPR) can be triggered, eventually leading to attenuation of protein folding to reduce ER load, while increasing the rate of protein degradation (121). To account for this, we pursued whether a3R445L-GFP was misfolded by pursuing its ER processing.

There is no known mechanistic knowledge of a subunit ER processing, or if the a3 subunit partakes in post-translational modifications such as N-glycosylation, hence, we first pursued if WT a3 was a N-glycosylated glycoprotein. Enzymatic deglycosylation of a3-GFP resulted in a 134 kDa band. This suggested to us that a3 was an N-glycosylated protein. Analysis of mouse a3 confirmed for the first time that a3 is an N-glycosylated glycoprotein. This finding was an

32 interesting but not a completely unexpected result. Studies by Apps et. al in 1989, which predate current knowledge of a subunit isoforms, have shown that the 120-kDa subunit found in bovine chromaffin granules was sensitive to PNGase F treatment. The authors of this study then suggested that portions of the 120 kDa subunit might have certain luminally exposed regions (95). More recently, Lee et al. in 2010 demonstrated that the a1 subunit is N-glycosylated (4). Taken together, these results suggested that one of the post-translational modifications of the mammalian a subunit in the ER is N-linked glycosylation. Recent studies have suggested that the enzymes responsible for the N-glycosylation of the a1 subunit, Oligosaccharyltransferase (OST), and the Sec61ɑ translocon are aided by presenilin1, a molecular chaperone that facilitates the presentation of the a1 subunits to these enzymes (4). We initially hypothesized that the R445L mutation impaired a critical point in a potential ‘molecular scaffold’ similar to that seen in the interactions between the a2 and ARNO (8). We speculated that the region affected by the R445L mutation could be responsible for the interaction of a3 and presenilin-1. We found, however, that the introduction of the R445L mutation in a3 prevented the processing of highly mannosylated a3. This was unlike the complete deglycosylation of a1 as seen in PS1 knockout mice (4), suggesting a3R445L-GFP was still able to be co-translationally modified by OST. To lend further support to our observations, we found that independent recreation of the phenotype in other cell lines (HeLa) could be seen, suggesting that the a3R445L-GFP phenotype was not the result of a stable cell line artifact. Confirmation that a3R445L-GFP may have been ER retained came from immunofluorescent micrographs of a3R445L-GFP, which showed the co-localization of a3R445L-GFP with calnexin, a lectin ER chaperone that binds to highly mannosylated proteins. This suggested that the a3R445LGFP protein was ER retained. Taken together, our results suggest that a3R445L-GFP was targeted for ERAD. Highly mannosylated a3R445L-GFP may have interacted with calnexin and calreticulin. Misfolded a3R445L-GFP could have possibly been reintroduced to calnexin and calreticulin until a correct folding pattern was found. Because a3R445L-GFP was terminally misfolded it may have been retro-translocated outside the ER and processed for degradation. Greater levels of expressed protein may have caused the cell to adaptively trigger ER stress, leading to the degradation of misfolded a3R445L-GFP through UPR.

33 The likelihood that the R445L resulted in a terminally misfolded a3 protein due to our previous observations led us to ask if R445L mutation significantly alters the structure of a3. We probed the a3R445L-GFP protein for susceptibility to proteolysis with trypsin. We found a3R445LGFP was significantly more susceptible to trypsin proteolysis. Furthermore, the trypsin cleavage pattern of a3R445L-GFP yielded products at 26 and 60 kDa, not seen in a3-GFP under the same conditions. One could speculate that site-directed mutagenesis of R445 may have resultantly altered a potential trypsin cleavage site in a3, however, the R445 residue has been predicted by two independent topology studies to be a membrane buried residue in TM3 of the N-Terminal half of CTa, suggesting that in WT a3 it would not be accessible to trypsin proteases (52, 112). Taken together, these results suggested that the R445L mutation altered the protein conformation of a3. 6.3

How might the R445L point mutation alter protein conformation?

Current structural topology data for Vph1p suggests that the R462 residue is found within TM3 (52). The paucity of structural data regarding the mammalian a subunit makes a rationale regarding the structural role of the R445 residue highly speculative. Nonetheless, a large body of literature studying polar to non-polar amino acid mutations in TM’s of other membrane embedded proteins such as; CFTR (cystic fibrosis), Connexin 32 (Charcot-Marie-Tooth Syndrome), and OA1 (Ocular Albinism) (116, 121, 122) have demonstrated that TM regions of membrane proteins rely on the presence of inter-helical atomic contacts between polar atoms to encourage helical interactions (122). The polar groups can often form hydrogen bonds (H+ bonds) with polar side chains with carbonyl backbone groups (123), and can also form specialized inter-helical H+ bond spatial motifs between three amino acids on two different helices; these are known as “polar clamps” (124). The mutational formation of non-native interhelical bonds can have severe phenotypic consequences. A neutral-to-charged, cystic fibrosis phenotypic point mutation in TM4 of CFTR leads to altered helical packing through changes in inter-helical bonding. The mutation of V232D in CFTR TM4 was hypothesized to either pathologically increase helix-helix interaction, or cause a helix reorientation within the membrane. In either situation, the presence of a polar bond allowed for binding to a ‘polar partner’ to minimize energetically unfavorable interactions within the membrane core (125). We speculate that the absence of a polar amino acid to aid in the formation of inter-helical bonds

34 could have caused altered helical packing, helix-helix interaction, or helix reorientation between TM-3 and other TM segments within a3.

It might seem counterintuitive that a conserved arginine residue results in changes in mammalian a subunit structure but not in yeast Vph1p structure, however, a disconnect between final folded Vph1p and a3 structure may exist. The R444L mutation could possibly interfere with protein folding in Vph1p, but assembly chaperones for the a subunit between yeast and mammalian organisms could vary, and thus the folding outcomes of the a subunit could vary with the same missense mutation. Vph1p relies on Vma12p, Vma21p, Vma22p, and Voa1p chaperones for the proper assembly of the Vo subunit (83, 126). Our studies suggest that calnexin may be a chaperone involved in a subunit folding. Disruption of the calnexin homolog in S. cerevisiae, CNE1, does not affect growth of yeast on challenging media (127, 128). Beyond presenilin-1, knowledge of chaperones involved in a subunit folding is scarce. Perhaps folding intermediates of R444L a3 and R462L Vph1p have similar structural alterations, but a different repertoire of chaperones responsible for a subunit folding between organisms may result in different folding outcomes for each homolog. Further studies would need to be conducted to assess this potential difference. 6.4

Disease mechanisms resulting from mutations at this residue

In summary, it has been demonstrated that the R444L point mutation responsible for a type 1 infantile malignant osteopetrosis is caused by protein misfolding that results in retention of the V-ATPase a3 subunit in the ER. The misfolded protein consequently does not traffic to the plasma membrane, where it needs to be to make its functional contribution to the process of bone resorption.

Hematopoietic stem cell transplantation (HSCT) is performed only in severe cases of ARO, and it has poor availability in the countries where the R444L mutation occurs. Moreover, there are associated high risks (25%) of disease progression and poor 5-year survival (24%) for recipients of HLA-haplotype-mismatched HSCT. Furthermore, preservation of vision requires intervention prior to 3 months of age, however, radiological prenatal diagnosis can be obtained at 25 weeks gestation, suggesting that, in principle, pharmacological intervention, if available, could begin in utero, prior to development of severe manifestations of disease. (125, 126)

35 Ultimately, the molecular mechanism of the iARO phenotype seen with the R445L a3 point mutation phenotypically resembles a full a3 deletion. oc/oc mice contain a naturally occurring Tcirg1 truncation mutation, which prevents the full expression of the a3 subunit. The osteoclasts of these mice lack a ruffled border, however, non a3 containing V-ATPases are present in the cytoplasm, but not in apical membrane. oc/oc mice are severely osteopetrotic, and this lethal phenotype causes death among mice at 3 weeks of age (129). The R445L point mutation alters the protein conformation of a3, and this prevents a3 ER exit. This likely prevents the localization of a3 to lysosomal and apical membranes. Therefore, the severe osteopetrotic phenotype seen with the R445L point mutation in humans may be reconcilable with the phenotype seen in oc/oc mice.

This study can be used as a blueprint for the study of other human disease missense mutations at this residue, such as the R449H missense mutation in a4 resulting in dRTA. This will aid in confirming the role of this arginine in mammalian a subunit structure and folding. There are, however, notable differences between the resulting mutant residues between both diseases, and the a3 and a4 subunit isoforms in which these mutations occur. Unlike the disease mutation resulting in iARO, the disease mutation in dRTA is a conserved change, resulting in a similarly polar, charged amino acid. Furthermore, little is known about the N-glycosylation of the a4 isoform. Prediction algorithms of a4 suggest one glycosylation site at N489 that is in alignment with our consensus that N-glycosylation of the mammalian a subunit occurs in EL2. Potentially, this site could be membrane buried, and if this is the case, it could be that the protein folding pathway of a4 may be different from a3, independent of lectin chaperones calnexin and calreticulin. Studies of the effects of R449H on the a4 isoform are key in confirming the structural relevance of this arginine residue. 6.5

Refining the topology of the N-terminal half of CTa

Our observations demonstrated for the first time that a3 is an N-glycosylated protein. Through these observations, and in silico mapping of putative N-glycosylation sites through prediction algorithms matched with current predicted topologies of the a subunit, we correctly determined that the N-glycosylation sites of a3 lie at N484 and N504. Most importantly, our findings provide a first glimpse into an otherwise undefined mammalian a subunit topology. Our

36 mammalian a subunit findings support the validity of previously published topologies of Vph1p by Toei et. al. in 2011. These findings also support the validity of requiring an even number of TMs between EL2 and CL3, thus eliminating the possibility of another membrane spanning TM between TM5 and TM6, thus extending the length of EL3. The location of these N-glycosylation sites also may provide further biochemical evidence in defining the TM/lumen boundary between TM2 and EL2. OST’s active site resides 30Å into the ER lumen, facing away from the inner membrane surface of the ER lipid bilayer. For topological analysis of transmembrane domain positions, locating where N-glycosylation sites are provides reasonable accuracy of the distance from an NxS/T site to the membrane surface. Studies of leader peptidase in E. coli have shown that the NxS/T site must be placed 12 residues away from the hydrophobic end of a TM segment, and 14 residues prior to the beginning of a TM segment (94). Though current topologies provide a level of definition of the TM2 boundary through PEG-NAM insensitivity studies, our findings could be useful for refining these findings, and thus refining the mapping of TM boundaries (52). While there is no evidence to suggest that Vph1p is N-glycosylated, nor are there any glycosylation sites predicted in the EL2 sequence of Vph1p, due to the high degree of homology between Vph1p and mammalian a subunit it is reasonable to suggest that the EL2 loop should also be lumenal in Vph1p. 6.6

Summary of findings

In summary, our study demonstrated that the R445L point mutation responsible for iARO in patients is a result of a mammalian a subunit specific defect that leads to the altered folding and thus prevention of complex N-glycosylation of a3. Our results also for the first time demonstrate the N-glycosylation of a3. Additionally, this study suggests putative structural roles the conserved R444 residue in the mammalian a subunit. Our study provides a blueprint for the study of other disease causing mutations in the mammalian a subunit, most importantly the dRTA disease causing mutation found at the same residue but in the a4 isoform (R449). Lastly, new knowledge of a3 N-glycosylation obtained from this study was used to generate and execute the correct prediction of the location of two N-glycosylation sites (N484, N504) in mammalian a3, thus refining our knowledge of a subunit topology.

37 7

FUTURE STUDIES 7.1

Do molecular therapeutics such as chemical chaperones rescue R444L a3 to WT?

Terminally misfolded proteins become ERAD candidates for degradation. The degradation process begins by demannosylation by α(1-2)-mannosidases. BiP binds to a hydrophobic stretch of residues on misfolded, demannosylated proteins, trafficking them to ER-degradation enhancing 1,2-mannosidase-like proteins (EDEM). This targets the protein for retrotranslocation outside the ER, and subsequently proteosomal degradation. ERAD degradation of misfolded protein can be rescued by using a growing variety of agents designed to function as: proteasomal inhibitors, inhibitors of ERAD processing, and chemical chaperones that assist in proper protein folding (88). The ΔF508 deletion in CFTR is one of the most common protein folding mutations. Presence of the ΔF508 causes ER retention of CFTR and processing by ERAD for degradation. Vij et. al. in 2006 showed the partial functional rescue of ΔF508-CFTR through treatment of cells with proteasomal inhibitor bortezomib (130). A growing list of inhibitors of ERAD is becoming known. One such target of the ERAD pathway is the α(1-2)-mannosidase. Kifuenensine and deoxymannojirimycin are two such inhibitors that target the mannosidase family. Lastly, a number of chemical and pharmacological chaperones may also assist protein folding. These include chemical chaperones such as Cyclosporine A, DMSO, glycerol, 4Phenylbutyric acid, and Trimethylamine N-oxide (88, 110). Investigating whether treatment of cells transduced with a3R445L-GFP with these agents rescues functional localization of a3R445L-GFP to lysosomal compartments could be of therapeutic interest for patients afflicted with iARO. 7.2

Does R444L prevent V1-V0 assembly?

Ochotny et. al. in 2006 showed that the R462L mutation does not affect the assembly of VATPase. Our results show that R444L leads to a misfolded a3, which is ER retained. Immunoprecipitation of R444L a3 and subsequent probing with antibodies to V1 subunits would allow us to determine if the mutation prevents the assembly of V1 subunits to the V0. This would be beneficial in determining whether R444L induced a3 misfolding affects a subunit-subunit assembly.

38 7.3

Identifying the polar partners interacting with R444

One of our hypotheses from this study was that the absence of a polar amino acid to aid in the formation of inter-helical bonds could have caused altered helical packing, helix-helix interaction, or helix reorientation between TM3 and other TM segments within a3. Identification of the polar partner involved in potential helix-helix interaction or orientation would identify the relative proximity between TMs, thus providing a better 3D topological map of the locations of TMs relative to one another. There are a limited number of potential ‘polar partners’ in the a subunit. Using our most recent a subunit topology, three embedded polar residues can be identified, and charge switching of these putative ‘partner’ amino acids through mutagenesis could identify interacting pairs of residues involved in the structure of the a subunit. Knowledge of this would provide meaningful biochemical data to support 3D topological maps obtained through sub-nanometer EM studies .

FIGURES AND TABLES Table 1: V-ATPase subunits and subunit isoforms Com plex

V1

V0

Subunit A

Stoichiometry 3

M.W. (kDa) 70

B

3

56

C

1

42

D

1

34

E

3

31

F

1

14

G

3

13

H

1

50

a

1

116 (m) 100 (y)

c c’ c’’

4 1 1

16-21 16-21 16-21

d

1

38-42

Isoforms (mammalian)

B1: Specific to kidney, ear B2: Enriched in osteoclast C1: Ubiquitous C2a: Lung C2b: Kidney E1: Acrosomal lumen E2: Ubiquitous G1: Ubiquitous G2: Brain G3: Kidney a1: Ubiquitous a2: Acrosomal membrane a3: Enriched in osteoclasts a4: Specific to kidney, epididymis

d1: ubiquitous d2: Kidney and osteoclast

e 1 9 Ac45 1 45 m; mouse, y; yeast, M.W.; Molecular Weight.

39

Subunit (yeast) Vma1p

Group

Vma2p

Stator

Vma5p

Stator

Vma8p

Rotor

Vma4p

Stator

Vma7p

Rotor

Vma10p

Stator

Vma13p

Stator

Vph1p and Stv1p

Stator

Vma3p Vma11p Vma16p

Rotor Rotor Rotor

Vma6p

Rotor

Vma9p

Stator

Stator

40 Table 2 – Sequence identity conservation across human a subunit isoforms and Vph1p a1 a1

a2

a3

a4

Vph1p

54.4

45.4

61.8

40.8

49.9

51.4

36.8

49.7

36.1

a2

54.4

a3

45.4

49.9

a4

61.8

51.4

49.7

Vph1p

40.8

36.8

36.1

37.9 37.9

41 Table 3 - yeast strains, plasmids and primers used in this thesis Straina

Genotype

Ref.

MM53

MATα ura3-52 Δvph1::LEU2

(61)

Plasmid

Construct

Ref.

MM112

pRS316 vector only

This study

MM322

pRS316_VPH1 CEN-ARS plasmid expressing wild-type Vph1p

This study

MM981

pRS316_VPH1_R462D (MM322 mutagenized with MO562 and

This study

MO563)

MM982

pRS316_VPH1_R462E (MM322 mutagenized with MO564 and MO565)

Primer

5’ to 3’ sequence (mutations underscored)

MO562

5'-gaaattttcgatatggccttcactggtgattacattattttgttgatgggtgtcttt-3'

MO563

5'-aaagacacccatcaacaaaataatgtaatcaccagtgaaggccatatcgaaaatttc-3'

MO564

5'-gaaattttcgatatggccttcactggtgagtacattattttgttgatgggtgtcttt-3'

MO565 a

5'-aaagacacccatcaacaaaataatgtactcaccagtgaaggccatatcgaaaatttc-3'

See Experimental Procedures for details of plasmid construction.

This study

42 Table 4 – mammalian plasmids, strains used in this thesis Primer (5’–3’)a

Application

accttctttgggggtctatacctactcctgctc gagttcagagacctccaggaatccgtgagcgcc ggctgccatggcccagcagtcaggctgga gctcaccctgaaccctcagatcactggtgtcttcc gcgcctcgagcgccaccatgggctctatgttccggagtga gcgcgaattcctattacttgtacagctcgtccatgccgag gttaacggatcccgccaccatggtgagcaa gttaacgaattctctagagtcgcggccgct tgccagcctcgtcccgtagac cctcaccccatttgatgttag cacatgaagcagcacgacttct aactccagcaggaccatgtgat

R445L mutation of mouse a3 N41Q mutation of mouse a3 N484Q mutation of mouse a3 N504Q mutation of mouse a3 XhoI-a3 (pMSCV cloning) EcoRI-a3 (pMSCV cloning) BamHI-GFP (pMSCV cloning) EcoRI-GFP (pMSCV cloning) GAPDH detection (upper) GAPDH detection (lower) GFP detection (upper) GFP detection (lower)

Plasmidb

Constructc

Expression product

pMM789 pMM919 pMM928 pMM981 pMM982 pMM983 pMM984 pMM985

pEGFP-N1 pEGFP-N1-a3 pEGFP-N1-a3R445L pMSCV-a3-GFP pMSCV-a3R445L-GFP pMSCV-GFP pEGFP-N1- a3N41Q-GFP pEGFP-N1-a3N484Q/N504Q-GFP

GFP a3-GFP a3R445L-GFP a3-GFP a3R445L-GFP GFP a3N41Q-GFP a3N484Q/N504Q-GFP

Cell Line

Description

RAW-a3-GFP RAW-a3R445L-GFP RAW-GFP

RAW 264.7 cells expressing integrated a3-GFP RAW 264.7 cells expressing integrated a3R445L-GFP RAW 264.7 cells expressing integrated GFP

a

Underlining corresponds to target amino acid or restriction site. Designations refer to the strains collection of the laboratory. c See “Experimental Procedures” for details of plasmid construction. The constructs were all in pMSCVpuro, which were used to produce retroviral supernatants to stably integrate the constructs into RAW 264.7 cells, resulting in the listed cell lines. b

43 Table 5 – A negatively charged amino acid at position 462 is not required for Vph1p function Exponentially growing yeast were assayed for growth on 4 mM ZnCl2 media. Cells lacking Vph1p (Δvph1) were transformed with the single copy of plasmid pRS316 containing MM322 (VPH1), or MM981 (VPH1_R462D), or MM982 (VPH1_R462E), and were spot plated in 10-fold serial dilutions, as described in “Methodology”. Growth was scored relative to VPH1 strain as follows; ++++, for 100% to 75% growth relative to VPH1, -, no detectable growth. n=3 (independent experiments) 4mM Zn2++

-URA

VPH1

++++

++++

Δvph1 + Vector

-

++++

R462D

++++

++++

R462E

++++

++++

44

Figure 1: Functions of plasma membrane V-ATPases – (A) In renal α-intercalated cells, VATPases are trafficked to the apical membrane to acidify the urine. In conjunction to this, these cells also absorb CO2 and release HCO3- through a Cl-/HCO3- exchanger, thus maintaining the pH homeostasis in the blood. (B) In osteoclasts, V-ATPases are trafficked to the ruffled border, and acid is secreted onto the bone, acidifying the extracellular matrix and activating proteases. This action is necessary for proper bone remodeling. (C) During tumor metastasis, V-ATPases on the plasma membrane pump acid, creating an acidified environment that allows cell detachment. This process is likely mediated by cathepsins and other proteases. (D) Epididymal clear cells traffic V-ATPases to the luminal membrane. The decreased pH aids in sperm cell maturation. L; Lysosome. Derived from (12).

45

Figure 2 - V-ATPase nomenclature, and structural and functional comparisons – VATPases share a high degree of structural and functional homology between F-ATPases. Top Panel, V-ATPases operate by catalyzing ATP in the catalytic headpiece, thus driving the central stalk to rotate the barrel of c, c’, c’’ subunits within the proton channel, translocating protons across the membrane. The a subunit holds together elements of the catalytic headpiece while the central stalk rotates the barrel of c, c’, c’’ subunits. Bottom Panel, F-ATPases operate by the proton motive force, which powers the rotation of the barrel of c subunits, which in turn turns the central stalk region and thus causing the catalytic headpiece to drive the production of ATP from ADP. F-ATPase is almost exclusively located in the mitochondrial inner membrane, whereas VATPases are functionally more diverse. Derived from (131)

46

Figure 3: Consensus model of yeast Vph1p (a subunit) topology – N- and C- termini are both cytoplasmic region; the N-terminal domain, NTa, is in the cytosol. The membrane spanning CTa domain, 8 TM α-helices (blue rectangles), is embedded in the phospholipid bilayer (yellow). Kartner et al., used the consensus of 7 predictive modeling algorithms to indicate which amino acids are within a TM α-helix, experimental methods are detailed in (112). NTa is described en bloc here; CTa contains transmembrane α-helicies, TM1-8, cytoplasmic loops, CL1-3, and reentrant luminal (extracellular) loops, EL2-4, with EL1 being hypothesized depending on whether TM1 and TM2 form a reentrant loop that penetrates the lumen. R735 is shown here to be in TM7, and is known to be essential for proton translocation. Red, and green arrows represent locations of experimental Flag-Tag, and Glu-C protease cleavage sites from experiments conducted by Kartner et. al., 2012. Image prepared by N. Kartner from (112).

47

Figure 4 – a subunit N-glycosylation site mapping - Using (112), Vph1p topology as a bona fide model for a subunit topology, N-glycosylation NxS/T motifs predicted using Net-N-Glyc server (http://www.cbs.dtu.dk/services/NetNGlyc/) were mapped onto the topological map after sequence alignment to Vph1p. Positions on the topology represent an estimate of the location of N-glycosylation sites on each isoform residue. CL; Cytoplasmic loops, EL; re-entrant (extracellular) loops, CTD; C-terminal domain. Blue; a1, Green; a2, Red; a3, Yellow; a4, Purple; Vph1p

48

Figure 5 – Sequence identity conservation across a subunit isoforms – Using (112) as a bona fide model for a subunit topology, sequence identity of V-ATPase a subunits from several organisms were compared to mouse a3 sequence using MegAlign using the Clustal V algorithm, The resulting alignment was grouped by number of organisms having sequence identity with mouse a3. Key residues mentioned in this study, the R444 and R735 residues, are denoted by black triangles to indicate their relative position in reference to a subunit topology.

49

Figure 6 – Conservation of the R444 amino acid in a subunits – Multiple sequence alignments of human a3, mouse a3, and yeast Ortholog Vph1p compiled using Clustal V algorithm on MegAlign. Amino acid R444 under green box indicates its conservation across multiple a subunit isoforms.

50

51 Figure 7 - a3R445L-GFP has significantly reduced protein expression in mature osteoclasts. A, Fluorescence image of Sybr Green-stained agarose gel showing PCR products representing detection of GFP or GAPDH. Target cDNA was from reverse-transcribed mRNA extracted from RAW-derived osteoclasts stably transduced with retroviral constructs of a3-GFP, a3R445L-GFP, GFP (Table 1), or extracted from untransduced control cells. Bands detected with GFP primers indicate that full-length a3 constructs are being transcribed. B, Cells described for panel A were homogenized and microsomal membranes prepared by differential centrifugation. 20 µg of membrane protein per lane was separated by SDS-PAGE on 7% polyacrylamide gels, electroblotted and probed with anti-GFP antibody. Specific bands observed for a3-GFP were 134 and 152 kDa, the latter being a diffuse band. These are the core-glycosylated and mature glycosylated forms of a3-GFP, respectively (see “Results”). For a3R445L-GFP, only the coreglycosylated 134 kDa band was observed, with a much lower intensity compared with that seen for a3-GFP bands. Smaller-sized bands are non-specific, appearing also in the control GFP lane. C, Cells described for panel A were cultured for 5 days in standard medium, or were differentiated into osteoclasts in medium containing RANKL. Cell lysate proteins (20 µg per lane) were separated by SDS-PAGE, electroblotted and probed with anti-GFP or anti-GAPDH antibody. GFP staining revealed a3-GFP with a diffuse, mature glycosylated band at 152 kDa and a core-glycosylated band at 134 kDa (upper left panel). Arrowheads indicate band positions. The 152 kDa band was absent in the lanes containing a3R445L-GFP (upper middle panel). The 134 and 152 kDa bands were not observed in control cells expressing only un-fused GFP (upper right panel). GAPDH staining provided a loading standard (lower panels). D, Proteins from panel C were quantified as described in “Methodology”. The 134 and 152 kDa bands were combined for a3-GFP protein, and the 134 kDa band was used to quantify a3R445L-GFP protein. Background was subtracted using the rolling disk method. Results were plotted as ratios normalized to GAPDH. The amount of a3R445L-GFP protein was significantly decreased in mature osteoclasts (+RANK-L) compared with that in undifferentiated cells (-RANK-L). Additionally, GFP protein was significantly increased compared with that in undifferentiated cells (-RANK-L) (asterisk indicates p < 0.05; immunoblots show typical results from one of three independent experiments).

52

53 Figure 8 – a3R445L-GFP is core-glycosylated but not processed A, native, endogenous a3 from bone marrow-derived primary mouse osteoclasts (20 µg cell lysate per lane) was resolved on 7% SDS-PAGE gels and immunoblotted with anti-a3 antibody after incubation with (+) and without (-) PNGase F. Left lane, without treatment a diffuse, putative, mature glycosylated band was observed at 116 kDa and a faint, putative, core-glycosylated band at 102 kDa (the intermediate, sharp band is non-specific). Right lane, upon PNGase F treatment, the major 116 kDa band was absent and a new, sharp band was observed at 93 kDa that is equivalent in size to the predicted, unglycosylated size of the a3 subunit. B, 20 µg of cell lysates obtained from stably-transduced RAW 264.7 cells (RAW-a3-GFP and RAW-a3R445L-GFP) were processed as in panel A, but blots were probed with anti-GFP and anti-GAPDH antibodies. The major diffuse band observed for wild type fusion protein was 152 kDa in size (⦻) and was reduced to 128 kDa (deglycosylated) after PNGase F treatment. The faint 134 kDa band (●) was also absent in the PNGase F treated lane. For a3R445L-GFP the major specific band was at 134 kDa (●), and this was also reduced to 128 kDa (○) after PNGase F treatment. GAPDH staining provided a loading standard (lower panels). C, 20 µg of membrane proteins obtained from transiently transfected HeLa cells (transfected with a3-GFP and a3R445L-GFP) were processed as in panel B. a3-GFP was treated with PNGase F, resulting in an unglycosylated band at 134 kDa. Untreated a3R445LGFP was found at that same size. Images in this figure are representative of three independent experiments. D, blot was processed as in panel B, but cell lysates were incubated with (+) and without (-) Endo H, instead of PNGase F. The mature glycosylated 152 kDa a3-GFP band was only partially Endo H sensitive, showing a slight reduction in apparent molecular weight (by 2 kDa) and appearance of a band at 128 kDa, while the 134 kDa band was absent upon Endo H treatment. For a3R445L-GFP, only the core-glycosylated 134 kDa band was seen, which was Endo H sensitive. After Endo H treatment, an unglycosylated band of 128 kDa was observed, the higher band at approximately 140 kDa being a non-specific band observed in all lanes in all experiments; Immunoblots show typical results from one of three independent experiments. ⦻; glycosylated, ●; core-glycosylated, ○; de/un-glycosylated.

54

Figure 9 – a3R445L-GFP is retained within the endoplasmic reticulum A and B, representative confocal fluorescence images of wild type a3-GFP or mutant a3R445L-GFP expressed in stably transduced RAW cells, immunostained with anti-GFP (green) and antiLAMP-2 antibodies (red). LAMP-2 localizes to lysosomes. MERGE panels reveal colocalization

55 of a3-GFP and LAMP-2 (panel A, yellow), but not of a3R445L-GFP and LAMP-2 (panel B). C and D, representative confocal fluorescence images as in panels A and B but showing colocalization with calnexin (red), an ER chaperone. MERGE panels show colocalization of a3R445L-GFP and calnexin (panel D, yellow), but not of a3-GFP and calnexin (panel C). Scale bars are 5 µM. Insets in MERGE panels are fluorescence images of nuclei stained with DAPI, shown at lower magnification. Images are representative of 25 each from three independent experiments. E, quantitative colocalization analysis of confocal microscopy images, as described above, using Improvision Volocity 5.2 software (Perkin Elmer). Ordinate is Pearson’s correlation coefficient (r). Values of r > 0.6 indicate a moderate to high degree of colocalization. Significance between wild type and mutant correlations was assessed using unpaired, two-tailed t tests (p < 0.001).

56

Figure 10 - a3R445L-GFP alters protein conformation A, 15 µg of membrane proteins obtained from RAW cells stably transduced to express a3-GFP, or a3R445L-GFP were treated with trypsin (2.5 µg/mL, or 5.0 µg/mL) for 1 h. Subsamples were then treated with PNGase F to deglycosylate tryptic fragments (untreated control samples were subjected to the same

57 incubation conditions, but without enzyme; see “Experimental Methods”) and all samples were resolved by SDS-PAGE on 4–20% gradient gels and electroblotted. Blots were probed with antiGFP antibody. Wild type a3-GFP showed a major, uncleaved band at 152 kDa (glycosylated) in the absence of enzyme treatment (lane a, black arrowhead; banding pattern is due to endogenous protease activity during long incubation period), but on trypsinolysis the band intensity was reduced substantially (lane b). After PNGase F treatment the major band shifted to 128 kDa (lane c, white arrowhead), as expected (unglycosylated), and the trypsin banding was somewhat altered (lane d). Mutant a3R445L-GFP showed a major uncleaved band at 134 kDa (core-glycosylated) in the absence of enzyme (lane e, asterisk), but on trypsinolysis the band intensity was reduced almost to background (lane f). After PNGase F treatment the major band shifted to 128 kDa (lane g, white arrowhead), as expected (unglycosylated), and the trypsin banding was somewhat altered (lane h). Comparing lanes d and h, showed novel bands appearing at 26 and 60 kDa in lane h (small left-pointing arrowheads at right margin, indicating bands at approximately 26 and 60 kDa). Note corresponding right-pointing small arrowheads at lane d, indicating differences at the same positions). B, in panel A the lanes are somewhat distorted, making precise horizontal alignments of bands difficult. To emphasize differences in banding patterns of lanes d and h in panel A, parallel vertical tranches were cropped from panel A and aligned precisely, side-by-side. No alterations to relative lengths of lanes were made; only vertical alignment was adjusted to account for gel “smiling”. While some band intensities are quite different, the only novel bands are those of lane h at 26 and 60 kDa, as indicated. C, deglycosylated 128 kDa protein bands were quantified from scans of blots shown in panel A. Background was subtracted by the rolling disk method. Rates of degradation of mutant a3R445LGFP bands were found to be significantly greater than those for wild type a3-GFP (p < 0.05). Immunoblots show typical results from one of three independent experiments.

58

Figure 11 – N484 and N504 are the glycosylation sites of mouse a3 A, Alignments of putative EL2 polypeptide sequences from mammalian, avian, amphibian and yeast a subunits. Mouse (Mmu), human (Hsa), bovine (Bta), chicken (Gga) and Xenopus (Xtr) a3 subunit sequences are aligned with yeast Vph1p and Stv1p. Highly conserved residues are highlighted in grey and glycosylation sites indicated in black boxes. The numbers above the top line indicate the glycosylated Asn residues in the mouse sequence. Note the conservation of two glycosylation sites in all higher species, but not in yeast. B, HeLa cells were transfected with constructs for transient expression and microsomal membrane proteins (20 µg per lane) were treated with PNGase F, as described in “Methodology”. Upper row of panels are from immunoblots probed with anti-GFP antibody, indicating: wild type, unmodified a3 polypeptide with C-terminal GFP fusion (arrowhead indicates diffuse glycosylated a3-GFP band (right lane) that is absent after PNGase F treatment (left lane)); N41Q, knockout of glycosylation site in NTa domain had no effect compared with wild type; N484Q and N504Q, double knockout of EL2 glycosylation sites eliminated glycosylated diffuse band (open arrowhead indicates position of unglycosylated band); control, is HeLa host cells treated with Fugene only (no a3-GFP expression), showing non-specific bands seen in all lanes. Bottom inset panel shows native a3 from mouse BMM-derived osteoclasts (see “Methodology”), with (left lane) and without (right lane) PNGase F treatment. This shows (right lane) a diffuse glycosylated band at approximately 120 kDa, a core-glycosylated band at approximately 110 kDa and (left lane) an unglycosylated band at under 100 kDa, the approximate predicted size of the a3 subunit polypeptide. The sharp intermediate band is a common, non-specific band. Immunoblots show typical results from one of three independent experiments.

8 1. 2. 3. 4. 5. 6. 7. 8.

9. 10.

11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26.

REFERENCES Maxfield, F. R., and McGraw, T. E. (2004) Nat Rev Mol Cell Biol 5, 121–132 Williamson, W. R., and Hiesinger, P. R. (2010) Commun Integr Biol 3, 604–607 Mijaljica, D., Prescott, M., and Devenish, R. J. (2011) Autophagy 7, 666–668 Lee, J.-H., Yu, W. H., Kumar, A., Lee, S., Mohan, P. S., Peterhoff, C. M., Wolfe, D. M., Martinez-Vicente, M., Massey, A. C., and Sovak, G. (2010) Cell 141, 1146–1158 Ghosh, P., Dahms, N. M., and Kornfeld, S. (2003) Nat Rev Mol Cell Biol 4, 202–212 Manolson, M. F., Proteau, D., and Jones, E. W. (1992) J Exp Biol 172, 105–112 Recchi, C., and Chavrier, P. (2006) Nat Cell Biol 8, 107–109 Hurtado-Lorenzo, A., Skinner, M., Annan, el, J., Futai, M., Sun-Wada, G.-H., Bourgoin, S., Casanova, J., Wildeman, A., Bechoua, S., Ausiello, D. A., Brown, D., and Marshansky, V. (2006) Nat Cell Biol 8, 124–136 Bayer, M. J., Reese, C., Buhler, S., Peters, C., and Mayer, A. (2003) The Journal of Cell Biology 162, 211–222 Hiesinger, P. R., Fayyazuddin, A., Mehta, S. Q., Rosenmund, T., Schulze, K. L., Zhai, R. G., Verstreken, P., Cao, Y., Zhou, Y., Kunz, J., and Bellen, H. J. (2005) Cell 121, 607– 620 Sun-Wada, G.-H., Toyomura, T., Murata, Y., Yamamoto, A., Futai, M., and Wada, Y. (2006) J Cell Sci 119, 4531–4540 Jefferies, K. C., Cipriano, D. J., and Forgac, M. (2008) Arch. Biochem. Biophys. 476, 33–42 Wagner, C. A., Finberg, K. E., Breton, S., Marshansky, V., Brown, D., and Geibel, J. P. (2004) Physiol Rev 84, 1263–1314 Sun-Wada, G.-H., Wada, Y., and Futai, M. (2003) Cell Struct Funct 28, 455–463 Pietrement, C., Sun-Wada, G.-H., Silva, N. D., McKee, M., Marshansky, V., Brown, D., Futai, M., and Breton, S. (2006) Biol Reprod 74, 185–194 Pérez-Sayáns, M., Somoza-Martín, J. M., Barros-Angueira, F., Rey, J. M. G., and García-García, A. (2009) Cancer Treat Rev 35, 707–713 Toei, M., Saum, R., and Forgac, M. (2010) Biochemistry 49, 4715–4723 Hirata, R., Ohsumk, Y., Nakano, A., Kawasaki, H., Suzuki, K., and Anraku, Y. (1990) J Biol Chem 265, 6726–6733 Liu, Q., Leng, X. H., Newman, P. R., Vasilyeva, E., Kane, P. M., and Forgac, M. (1997) J Biol Chem 272, 11750–11756 MacLeod, K. J., Vasilyeva, E., Baleja, J. D., and Forgac, M. (1998) J Biol Chem 273, 150–156 Vasilyeva, E., Liu, Q., MacLeod, K. J., Baleja, J. D., and Forgac, M. (2000) J Biol Chem 275, 255–260 Kane, P. M., and Parra, K. J. (2000) J Exp Biol 203, 81–87 Zuo, J., Jiang, J., Chen, S.-H., Vergara, S., Gong, Y., Xue, J., Huang, H., Kaku, M., and Holliday, L. S. (2006) J Bone Miner Res 21, 714–721 Lu, M., Holliday, L. S., Zhang, L., Dunn, W. A., and Gluck, S. L. (2001) J Biol Chem 276, 30407–30413 Paunescu, T. G., Da Silva, N., Russo, L. M., McKee, M., Lu, H. A. J., Breton, S., and Brown, D. (2008) Am J Physiol Renal Physiol 294, F130–8 Kawasaki-Nishi, S., Nishi, T., and Forgac, M. (2001) J Biol Chem 276, 17941–17948 59

60 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43.

44. 45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. 58.

Lee, B. S., Holliday, L. S., Ojikutu, B., Krits, I., and Gluck, S. L. (1996) Am. J. Physiol. 270, C382–8 Xu, T., and Forgac, M. (2000) J Biol Chem 275, 22075–22081 Graham, L. A., Hill, K. J., and Stevens, T. H. (1995) J Biol Chem 270, 15037–15044 Nelson, H., Mandiyan, S., and Nelson, N. (1995) Proc Natl Acad Sci USA 92, 497–501 Basak, S., Gayen, S., Thaker, Y. R., Manimekalai, M. S. S., Roessle, M., Hunke, C., and Grüber, G. (2011) Biochim Biophys Acta 1808, 360–368 Graham, L. A., Hill, K. J., and Stevens, T. H. (1994) J Biol Chem 269, 25974–25977 Jones, R. P. O., Durose, L. J., Findlay, J. B. C., and Harrison, M. A. (2005) Biochemistry 44, 3933–3941 Sun-Wada, G.-H., Imai-Senga, Y., Yamamoto, A., Murata, Y., Hirata, T., Wada, Y., and Futai, M. (2002) J Biol Chem 277, 18098–18105 Imai-Senga, Y., Sun-Wada, G.-H., Wada, Y., and Futai, M. (2002) Gene 289, 7–12 Smith, A. N., Borthwick, K. J., and Karet, F. E. (2002) Gene 297, 169–177 Drory, O., Frolow, F., and Nelson, N. (2004) EMBO Rep. 5, 1148–1152 Drory, O., and Nelson, N. (2006) Biochim Biophys Acta 1757, 297–303 Vitavska, O., Wieczorek, H., and Merzendorfer, H. (2003) J Biol Chem 278, 18499– 18505 Armbrüster, A., Hohn, C., Hermesdorf, A., Schumacher, K., Börsch, M., and Grüber, G. (2005) FEBS Lett 579, 1961–1967 Rishikesan, S., Thaker, Y. R., and Grüber, G. (2011) J Bioenerg Biomembr 43, 187–193 Ho, M., Hill, K., and Lindorfer, M. (1993) Journal of Biological Chemistry Owegi, M. A., Carenbauer, A. L., Wick, N. M., Brown, J. F., Terhune, K. L., Bilbo, S. A., Weaver, R. S., Shircliff, R., Newcomb, N., and Parra-Belky, K. J. (2005) J Biol Chem 280, 18393–18402 Choi, K., Ji, Y., Dhakal, B., Yu, J., and Cho, C. (2003) Gene Supeková, L., Supek, F., and Nelson, N. (1995) J Biol Chem 270, 13726–13732 Charsky, C. M., Schumann, N. J., and Kane, P. M. (2000) J Biol Chem 275, 37232– 37239 Ho, M. N., Hirata, R., Umemoto, N., Ohya, Y., Takatsuki, A., Stevens, T. H., and Anraku, Y. (1993) J Biol Chem 268, 18286–18292 Jefferies, K. C., and Forgac, M. (2008) J Biol Chem 283, 4512–4519 Geyer, M., Fackler, O. T., and Peterlin, B. M. (2002) Mol Biol Cell 13, 2045–2056 Lu, X., Yu, H., Liu, S. H., Brodsky, F. M., and Peterlin, B. M. (1998) Immunity 8, 647– 656 Kartner, N., Yao, Y., Li, K., Crasto, G. J., Datti, A., and Manolson, M. F. (2010) Journal of Biological Chemistry 285, 37476–37490 Toei, M., Toei, S., and Forgac, M. (2011) Journal of Biological Chemistry Duarte, A. M. S., de Jong, E. R., Wechselberger, R., van Mierlo, C. P. M., and Hemminga, M. A. (2007) Biochim Biophys Acta 1768, 2263–2270 Lau, W. C. Y., and Rubinstein, J. L. (2010) Proceedings of the National Academy of Sciences 107, 1367–1372 Lau, W. C. Y., and Rubinstein, J. L. (2011) Nature Kawasaki-Nishi, S., Nishi, T., and Forgac, M. (2001) Proc Natl Acad Sci USA 98, 12397–12402 Kane, P. M. (2000) FEBS Lett 469, 137–141 Peri, F., and Nüsslein-Volhard, C. (2008) Cell 133, 916–927

61 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69. 70. 71. 72. 73.

74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84.

Su, Y., Blake-Palmer, K. G., Sorrell, S., Javid, B., Bowers, K., Zhou, A., Chang, S. H., Qamar, S., and Karet, F. E. (2008) Am J Physiol Renal Physiol 295, F950–8 Merkulova, M., Bakulina, A., Thaker, Y. R., Grüber, G., and Marshansky, V. (2010) Biochim Biophys Acta 1797, 1398–1409 Manolson, M. F., Wu, B., Proteau, D., Taillon, B. E., Roberts, B. T., Hoyt, M. A., and Jones, E. W. (1994) J Biol Chem 269, 14064–14074 Kawasaki-Nishi, S., Bowers, K., Nishi, T., Forgac, M., and Stevens, T. H. (2001) J Biol Chem 276, 47411–47420 Marshansky, V., Fleser, A., Noël, J., Bourgoin, S., and Vinay, P. (1996) J Membr Biol 153, 59–73 Morel, N., Dedieu, J.-C., and Philippe, J.-M. (2003) J Cell Sci 116, 4751–4762 Hirata, R., Graham, L. A., Takatsuki, A., Stevens, T. H., and Anraku, Y. (1997) J Biol Chem 272, 4795–4803 Flannery, A. R., Graham, L. A., and Stevens, T. H. (2004) J Biol Chem 279, 39856– 39862 Huss, M., and Wieczorek, H. (2009) J Exp Biol 212, 341–346 Whyteside, G., Meek, P. J., Ball, S. K., Dixon, N., Finbow, M. E., Kee, T. P., Findlay, J. B. C., and Harrison, M. A. (2005) Biochemistry 44, 15024–15031 Strasser, B., Iwaszkiewicz, J., Michielin, O., and Mayer, A. (2011) EMBO J 30, 4126– 4141 Bauerle, C., Ho, M. N., Lindorfer, M. A., and Stevens, T. H. (1993) J Biol Chem 268, 12749–12757 Owegi, M. A. (2006) Journal of Biological Chemistry 281, 30001–30014 Kim, T., Ha, H.-I., Kim, N., Yi, O., Lee, S. H., and Choi, Y. (2009) Biochem Biophys Res Commun 390, 585–590 Lee, S. H., Rho, J., Jeong, D., Sul, J.-Y., Kim, T., Kim, N., Kang, J.-S., Miyamoto, T., Suda, T., Lee, S.-K., Pignolo, R. J., Koczon-Jaremko, B., Lorenzo, J., and Choi, Y. (2006) Nat Med 12, 1403–1409 Compton, M. A., Graham, L. A., and Stevens, T. H. (2006) J Biol Chem 281, 15312– 15319 Supek, F., Supeková, L., Mandiyan, S., Pan, Y. C., Nelson, H., and Nelson, N. (1994) J Biol Chem 269, 24102–24106 Jansen, E. J. R., Scheenen, W. J. J. M., Hafmans, T. G. M., and Martens, G. J. M. (2008) Biochim Biophys Acta 1783, 2301–2310 Qin, A., Cheng, T. S., Lin, Z., Pavlos, N. J., Jiang, Q., Xu, J., Dai, K. R., and Zheng, M. H. (2011) PLoS ONE 6, e27155 Kane, P. M., Tarsio, M., and Liu, J. (1999) J Biol Chem 274, 17275–17283 Kane, P. M. (1999) J Bioenerg Biomembr 31, 49–56 Hill, K. J., and Stevens, T. H. (1995) J Biol Chem 270, 22329–22336 Ryan, M., and Graham, L. (2008) Mol Biol Cell Graham, L. A., Hill, K. J., and Stevens, T. H. (1998) The Journal of Cell Biology 142, 39–49 Malkus, P., Graham, L. A., Stevens, T. H., and Schekman, R. (2004) Mol Biol Cell 15, 5075–5091 Kinouchi, K., Ichihara, A., Sano, M., Sun-Wada, G.-H., Wada, Y., Kurauchi-Mito, A., Bokuda, K., Narita, T., Oshima, Y., Sakoda, M., Tamai, Y., Sato, H., Fukuda, K., and Itoh, H. (2010) Circ. Res. 107, 30–34

62 85. 86. 87. 88. 89. 90. 91. 92. 93.

94. 95. 96.

97.

98. 99. 100. 101.

102.

103. 104. 105.

Cheung, J. C., and Reithmeier, R. A. F. (2007) Methods 41, 451–459 Lederkremer, G. Z. (2009) Curr. Opin. Struct. Biol. 19, 515–523 Malhotra, J. D., and Kaufman, R. J. (2007) Semin Cell Dev Biol 18, 716–731 Hebert, D. N., and Molinari, M. (2007) Physiol Rev 87, 1377–1408 Yan, A. (2004) Journal of Biological Chemistry 280, 3121–3124 Dwek, R. A., Butters, T. D., Platt, F. M., and Zitzmann, N. (2002) 1, 65–75 Dean, N. (1999) Biochimica et Biophysica Acta (BBA) - General Subjects 1426, 309– 322 Dennis, J., and Granovsky, M. (1999) Bioessays Nagaya, H., Tamura, T., Higa-Nishiyama, A., Ohashi, K., Takeuchi, M., Hashimoto, H., Hatsuzawa, K., Kinjo, M., Okada, T., and Wada, I. (2008) The Journal of Cell Biology 180, 129–143 Nilsson, I. M., and Heijne, von, G. (1993) J Biol Chem 268, 5798–5801 Apps, D. K., Percy, J. M., and Perez-Castineira, J. R. (1989) Biochem J 263, 81–88 Stover, E. H., Borthwick, K. J., Bavalia, C., Eady, N., Fritz, D. M., Rungroj, N., Giersch, A. B. S., Morton, C. C., Axon, P. R., Akil, I., Al-Sabban, E. A., Baguley, D. M., Bianca, S., Bakkaloglu, A., Bircan, Z., Chauveau, D., Clermont, M.-J., Guala, A., Hulton, S. A., Kroes, H., Li Volti, G., Mir, S., Mocan, H., Nayir, A., Ozen, S., Rodriguez Soriano, J., Sanjad, S. A., Tasic, V., Taylor, C. M., Topaloglu, R., Smith, A. N., and Karet, F. E. (2002) J Med Genet 39, 796–803 Karet, F. E., Finberg, K. E., Nelson, R. D., Nayir, A., Mocan, H., Sanjad, S. A., Rodriguez Soriano, J., Santos, F., Cremers, C. W., Di Pietro, A., Hoffbrand, B. I., Winiarski, J., Bakkaloglu, A., Ozen, S., Dusunsel, R., Goodyer, P., Hulton, S. A., Wu, D. K., Skvorak, A. B., Morton, C. C., Cunningham, M. J., Jha, V., and Lifton, R. P. (1999) Nat Genet 21, 84–90 Lang, F., Vallon, V., Knipper, M., and Wangemann, P. (2007) Am J Physiol, Cell Physiol 293, C1187–208 Zakzouk, S. M., Sobki, S. H., Mansour, F., and Anazy, al, F. H. (1995) J Laryngol Otol 109, 930–934 Guillard, M., Dimopoulou, A., Fischer, B., Morava, E., Lefeber, D. J., Kornak, U., and Wevers, R. A. (2009) Biochim Biophys Acta 1792, 903–914 Kornak, U., Reynders, E., Dimopoulou, A., van Reeuwijk, J., Fischer, B., Rajab, A., Budde, B., Nürnberg, P., Foulquier, F., ARCL Debré-type Study Group, Lefeber, D., Urban, Z., Gruenewald, S., Annaert, W., Brunner, H. G., van Bokhoven, H., Wevers, R., Morava, E., Matthijs, G., van Maldergem, L., and Mundlos, S. (2008) Nat Genet 40, 32– 34 Hucthagowder, V., Morava, E., Kornak, U., Lefeber, D. J., Fischer, B., Dimopoulou, A., Aldinger, A., Choi, J., Davis, E. C., Abuelo, D. N., Adamowicz, M., Al-Aama, J., BaselVanagaite, L., Fernandez, B., Greally, M. T., Gillessen-Kaesbach, G., Kayserili, H., Lemyre, E., Tekin, M., Türkmen, S., Tuysuz, B., Yüksel-Konuk, B., Mundlos, S., van Maldergem, L., Wevers, R. A., and Urban, Z. (2009) Hum Mol Genet 18, 2149–2165 Scimeca, J.-C., Quincey, D., Parrinello, H., Romatet, D., Grosgeorge, J., Gaudray, P., Philip, N., Fischer, A., and Carle, G. F. (2003) 21, 151–157 Kornak, U., Schulz, A., Friedrich, W., Uhlhaas, S., Kremens, B., Voit, T., Hasan, C., Bode, U., Jentsch, T. J., and Kubisch, C. (2000) Hum Mol Genet 9, 2059–2063 Frattini, A., Orchard, P. J., Sobacchi, C., Giliani, S., Abinun, M., Mattsson, J. P., Keeling, D. J., Andersson, A. K., Wallbrandt, P., Zecca, L., Notarangelo, L. D., Vezzoni,

63 106. 107. 108.

109. 110. 111. 112.

113. 114. 115. 116.

117.

118. 119. 120. 121. 122. 123. 124. 125. 126. 127. 128. 129. 130.

P., and Villa, A. (2000) Nat Genet 25, 343–346 del Fattore, A., Cappariello, A., and Teti, A. (2008) Bone 42, 19–29 Ochotny, N., van Vliet, A., Chan, N., Yao, Y., Morel, M., Kartner, N., Schroeder, von, H. P., Heersche, J. N. M., and Manolson, M. F. (2006) J Biol Chem 281, 26102–26111 Sobacchi, C., Frattini, A., Orchard, P. J., Porras, O., Tezcan, I., Andolina, M., BabulHirji, R., Baric, I., Canham, N., Chitayat, D., Dupuis-Girod, S., Ellis, I., Etzioni, A., Fasth, A., Fisher, A., Gerritsen, B., Gulino, V., Horwitz, E., Klamroth, V., Lanino, E., Mirolo, M., Musio, A., Matthijs, G., Nonomaya, S., Notarangelo, L. D., Ochs, H. D., Superti Furga, A., Valiaho, J., van Hove, J. L., Vihinen, M., Vujic, D., Vezzoni, P., and Villa, A. (2001) Hum Mol Genet 10, 1767–1773 Shin, J., Dunbrack, R. L., Lee, S., and Strominger, J. L. (1991) Proc Natl Acad Sci USA 88, 1918–1922 Molinari, M. (2007) Nat. Chem. Biol. 3, 313–320 Toyomura, T., Murata, Y., Yamamoto, A., Oka, T., Sun-Wada, G.-H., Wada, Y., and Futai, M. (2003) J Biol Chem 278, 22023–22030 Kartner, N., Yao, Y., Bhargava, A., and Manolson, M. F. Topology, Glycosylation and Conformational Changes in the Membrane Domain of the V-ATPase a Subunit, Manuscript in Revision, J Biol Chem (2012) Cipriano, D. J., Wang, Y., Bond, S., Hinton, A., Jefferies, K. C., Qi, J., and Forgac, M. (2008) Biochim Biophys Acta 1777, 599–604 Inoue, T., and Forgac, M. (2005) J Biol Chem 280, 27896–27903 Wang, Y., Toei, M., and Forgac, M. (2008) J Biol Chem 283, 20696–20702 Ochotny, N., Flenniken, A. M., Owen, C., Voronov, I., Zirngibl, R. A., Osborne, L. R., Henderson, J. E., Adamson, S. L., Rossant, J., Manolson, M. F., and Aubin, J. E. (2011) J Bone Miner Res del Fattore, A., Peruzzi, B., Rucci, N., Recchia, I., Cappariello, A., Longo, M., Fortunati, D., Ballanti, P., Iacobini, M., Luciani, M., Devito, R., Pinto, R., Caniglia, M., Lanino, E., Messina, C., Cesaro, S., Letizia, C., Bianchini, G., Fryssira, H., Grabowski, P., Shaw, N., Bishop, N., Hughes, D., Kapur, R. P., Datta, H. K., Taranta, A., Fornari, R., Migliaccio, S., and Teti, A. (2006) J Med Genet 43, 315–325 Hawley, R. G., Lieu, F. H., Fong, A. Z., and Hawley, T. S. (1994) Gene Ther 1, 136–138 Guo, L., Eviatar-Ribak, T., and Miskimins, R. (2010) J. Neurosci. Res. 88, 3233–3242 Taniguchi, S., Kimura, T., Umeki, T., Kimura, Y., Kimura, H., Ishii, I., Itoh, N., Naito, Y., Yamamoto, H., and Niki, I. (2011) Mol Cell Endocrinol Chakrabarti, A., Chen, A. W., and Varner, J. D. (2011) Biotechnol. Bioeng. 108, 2777– 2793 Partridge, A. W., Therien, A. G., and Deber, C. M. (2002) Biopolymers 66, 350–358 DeGrado, W. F., Gratkowski, H., and Lear, J. D. (2003) Protein Sci 12, 647–665 Adamian, L., and Liang, J. (2002) Proteins 47, 209–218 Therien, A. G., Grant, F. E., and Deber, C. M. (2001) Nat. Struct. Biol. 8, 597–601 Hill, K., and Cooper, A. A. (2000) EMBO J 19, 550–561 Parlati, F., Dominguez, M., Bergeron, J. J., and Thomas, D. Y. (1995) J Biol Chem 270, 244–253 Li, X., Su, R. T., Hsu, H. T., and Sze, H. (1998) Plant Cell 10, 119–130 Nakamura, I., Takahashi, N., Udagawa, N., Moriyama, Y., Kurokawa, T., Jimi, E., Sasaki, T., and Suda, T. (1997) FEBS Lett 401, 207–212 Vij, N., Fang, S., and Zeitlin, P. L. (2006) J Biol Chem 281, 17369–17378

64 131. 125. 126.

Marshansky, V., and Futai, M. (2008) Curr Opin Cell Biol Driessen, R. L., Johnston, H. M., and Nilsson, S. K. (2003) Exp Hematol 31, 1284–1291 Oğur, G., Oğur, E., Celasun, B., Baser, I., Imïrzalioğlu, N., Oztürk, T., and Alemdaroğlu, A. (1995) Prenat. Diagn. 15, 477–481