Overexpression of Genes Encoding Glycolytic Enzymes in ...

Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions Shogo Yamamoto, Wataru Gunji, Hiroaki Suzuki, Hiroshi Toda, Masako Suda, Toru Jojima, Masayuki Inui, and Hideaki Yukawa Research Institute of Innovative Technology for the Earth (RITE), Kizugawadai, Kizugawa, Kyoto, Japan

We previously reported that Corynebacterium glutamicum strain ⌬ldhA⌬ppcⴙalaDⴙgapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159 –165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/ pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/ pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NADⴙ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copynumber plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses.

C

orynebacterium glutamicum is a Gram-positive, high-G⫹Ccontent, non-spore-forming bacterium widely used for the industrial production of amino acids such as glutamate and lysine (15, 19, 38). The production was mainly via conventional, growthdependent bioprocesses until aerobically grown C. glutamicum cells deprived of oxygen were discovered to efficiently convert glucose to organic acids despite cessation of growth (11, 21). Under these conditions, the cells exhibit increased enzymatic activities following elevated expression of genes encoding key enzymes of the glycolytic and anaplerotic pathways, as well as those of the reductive arm of the tricarboxylic acid (TCA) cycle. It represents a metabolic shift toward these pathways, culminating in accelerated carbon flow through the glycolytic and organic acid production pathways under oxygen deprivation (12, 42). This metabolic shift is the basis upon which the efficient bioprocess underlying the production of D-lactic acid (23), succinic acid (22), ethanol (10), alanine (14), and valine (7), under which by-product formation is strongly curtailed, is based. Recently, Blombach et al. reported isobutanol production by metabolically engineered C. glutamicum using the similar approach under oxygen deprivation (2). The tremendous promise that this approach holds is particularly borne out by the highly efficient alanine production by metabolically engineered C. glutamicum (14). Added to this, the successful engineering of strains capable of mixed sugar utilization can only cement the role of C. glutamicum as a premier microorganism in the fermentation of biomass hydrolysates containing mixtures of hexose and pentose sugars (30). Amino acids are widely used in food additives, pharmaceuticals, feed supplements, cosmetics, and polymer materials (8, 13, 17). They are industrially manufactured largely by aerobic fermentation, a pro-

June 2012 Volume 78 Number 12

cess that invariably involves side reactions that may lead to biomass formation, CO2 production, and heat generation, which in turn may adversely impact product yield and process energy efficiency. Moreover, as aerobic fermentation requires intensive agitation to supply sufficient oxygen for microbial growth, it complicates the establishment of a modern, sustainable bioprocess which meets current trends of high cost-effectiveness at reduced greenhouse gas emission levels. The aforementioned alanine production study confirmed the utility of recombinant C. glutamicum in amino acid production under oxygen deprivation (14). Alanine, the easiest amino acid to produce in bacteria, is formed from pyruvate in a single reaction step catalyzed by glutamate-pyruvate transaminase or alanine dehydrogenase (AlaDH) (Fig. 1). The overexpression of the NADH-linked AlaDH gene (alaD) derived from Lysinibacillus sphaericus into C. glutamicum enables C. glutamicum to produce considerable amounts of alanine by the direct delivery of an amino residue from ammonia to pyruvate. The present study pursues improvements in growth-independent alanine production through improvements in the glucose consumption rate occasioned by altered expression of select genes encoding glycolytic enzymes (herein referred to as glycolytic genes). Glycolysis is one of the most accessible metabolic engineering

Received 28 December 2011 Accepted 28 March 2011 Published ahead of print 13 April 2012 Address correspondence to Hideaki Yukawa, [email protected]. Supplemental material for this article may be found at http://aem.asm.org/. Copyright © 2012, American Society for Microbiology. All Rights Reserved. doi:10.1128/AEM.07998-11

Applied and Environmental Microbiology

p. 4447– 4457

aem.asm.org

4447

Yamamoto et al.

FIG 1 Biosynthetic pathway for alanine. Endogenous gapA, pyk, pfk, and pgi genes (in black boxes) were chromosomally integrated. Alanine dehydrogenase gene, alaD, from L. sphaericus was overexpressed via expression plasmid (white box). The genes ldhA and ppc were deleted (crossed bars) from chromosomal DNA of C. glutamicum. Relevant reactions are represented by the names of the genes coding for the enzymes as follows: pts, phosphoenolpyruvate:carbohydrate phosphotransferase system; glk, glucokinase; pgi, glucose-6-phosphate isomerase; pfk, phosphofructokinase; ald, fructose-1,6-biphosphate aldolase; gapA, glyceraldehyde-3-phosphate dehydrogenase; tpi, triosephosphate isomerase; pgk, phosphoglycerate kinase; pgm, phosphoglycerate mutase; eno, enolase; pyk, pyruvate kinase; alaD, alanine dehydrogenase; ldhA, lactate dehydrogenase; ppc, phosphoenolpyruvate carboxylase. Abbreviations: Glucose-6P, glucose-6phosphate; Fructose-6P, fructose-6-phosphate; Fructose-1,6BP, fructose-1,6-bisphosphate; Glyceraldehyde-3P, glyceraldehyde-3-phosphate; Dihydroxyacetone-P, dihydroxyacetone phosphate; Glycerate-1,3BP, glycerate-1,3-bisphosphate; Glycerate-3P, glycerate-3-phosphate; Glycerate-2P, glycerate-2-phosphate; Glucono-1,5-lactone-6P, glucono-1,5-lactone-6-phosphate; Ribulose-5P, ribulose-5-phosphate; Ribose-5P, ribose-5-phosphate; Xylulose-5P, xylulose-5-phosphate; Sedoheptulose-7P, sedoheptulose-7-phosphate; Erythrose-4P, erythrose-4-phosphate.

targets for flux control in carbon metabolism. Through this pathway, glucose is catabolized primarily to pyruvate, an intermediate of enzymatic production of amino acids, organic acids, and alcohols. Carbon flow through the pathway concomitantly yields the high-energy compounds ATP and NADH. Although many studies have evaluated the effects of individual glycolytic gene overexpression on carbon flux, little or no significant acceleration of carbon metabolism rate or product formation rate has been realized irrespective of notable increases in target enzymatic activities and changes in fermentation product patterns (1, 4, 16, 18, 27, 31, 33–36). Nonetheless, some recombinants overexpressing only one or two glycolytic enzymes do show improved glycolytic flux and product formation. For instance, a 10 to 30% increase in glucose consumption rate was observed in phosphofructokinase (PFK) gene (pfk)- and/or pyruvate kinase (PYK) gene (pyk)-overexpressing Escherichia coli strains under resting cell incubation (6, 9).

4448

aem.asm.org

Likewise, glucose consumption and ethanol production by pfkoverexpressing yeast improved 1.3-fold under immobilized-cell conditions (3). Both these results were obtained using “nongrowing cells” and are in agreement with our previous study in which increased endogenous glyceraldehyde-3-phosphate dehydrogenase (GAPDH) activity dramatically enhanced alanine formation as a result of the stimulation of glucose consumption under conditions of oxygen deprivation and growth arrest (14). In an opposite approach, an H⫹-ATPase-defective mutant of C. glutamicum exhibiting enhanced rates of glucose consumption under aerobic conditions has been reported (32). Based on these findings, we postulate that overexpression of glycolytic genes can generate even greater increases in glycolytic flux and product formation under these particular conditions. In the present study, we overexpress key endogenous genes encoding NAD⫹-dependent GAPDH, irreversible PYK and PFK,


Enhancing Alanine Production in C. glutamicum

TABLE 1 Strains and plasmids used in this study Strain/plasmid Strains E. coli JM109 JM110 C. glutamicum R ldhA-ppc mutant GLY1 GLY2 GLY3 ⌬ldhA ⌬ppc/pCRD500 GLY1/pCRD500 GLY2/pCRD500 GLY3/pCRD500 GLY3/pCRD914 Plasmids pCRD500 pCASE1 pCRB22 pCRD914 pKK223-3 pCRC200 pCRA725 pCold I pCRD903 pCRD904 pCRD905 pCRD908 pCRD909 pCRD910 pCRD900 pCRD901 pCRD902 pCRD906 pCRD907 pCRD913 pCRD911 pCRD912

Reference/ source

Description

recA1 endA1 gyrA96 thi hsdR17(rK⫺ mK⫹) e14-(mcrA⫺) supE44 relA1 ⌬(lac-pro0AB) [F= traD36 proAB⫹ lacIq lacZ⌬M15] dam dcm supE44 hsdR17 thi leu rpsL1 lacY galK galT ara tonA thr tsx ⌬(lac-proAB) [F= traD36 proAB⫹ lacIq lacZ⌬M15]

TaKaRa

ldhA::markerless, ppc::markerless Markerless two sets of Ptac-SD-gapA-term gene recombinantly integrated into SSI1 of C. glutamicum LLPEP strain Markerless Ptac-SD-pyk-term and Ptac-SD-pfk-term genes recombinantly integrated into SSI10 of C. glutamicum GLY1 strain Markerless Ptac-SD-gpi-term gene recombinantly integrated into SSI5 of C. glutamicum GLY2 strain Cmr; strain ldhA-ppc mutant bearing pCRD500 plasmid Cmr; strain GLY1 bearing pCRD500 plasmid Cmr; strain GLY2 bearing pCRD500 plasmid Cmr; strain GLY3 bearing pCRD500 plasmid Kmr; strain GLY3 bearing pCRD914 plasmid

10 This study This study

Cmr; Ptac-alaD gene inserted into pCRC200 Expression vector for C. glutamicum from C. casei ATCC 12072 Kmr; expression vector, E. coli-C. glutamicum shuttle vector derived from pCASE1 Kmr; Ptac-alaD gene inserted into pCRB22 Apr; expression vector Cmr; source of tac promoter and rrnB terminator Kmr; pHSG298 with Ptac-sacR-sacB genes Apr; expression vector Apr; pCold I with a 0.6-kb KpnI-XbaI PCR fragment containing Ptac-term gene Apr; pCRD903 with an EcoRI fragment containing SD region Apr; pCRD904 with a 1.0-kb EcoRI PCR fragment containing gapA gene Apr; pCRD904 with a 1.4-kb MunI fragment containing pyk gene Apr; pCRD904 with a 1.0-kb EcoRI fragment containing pfk gene Apr; pCRD904 with a 1.6-kb MunI fragment containing gpi gene Kmr; pCRA725 with a 2.0-kb SphI PCR fragment containing the SSI1 region Kmr; pCRA725 with a 2.8-kb SalI-SphI PCR fragment containing the SSI5 region Kmr; pCRA725 with a 3.1-kb XbaI PCR fragment containing the SSI10 region Kmr; pCRD900 with Ptac-SD-gapA-term gene Kmr; pCRD906 with Ptac-SD-gapA-term gene Kmr; pCRD901 with Ptac-SD-gpi-term gene Kmr; pCRD902 with Ptac-SD-pyk-term gene Kmr; pCRD911 with Ptac-SD-pfk-term gene

29

This study 14 This study This study This study This study

14 40 This study This study Pharmacia 41 10 TaKaRa This study This study This study This study This study This study This study This study This study This study This study This study This study

Abbreviations: term, rrnB terminator; SD, ribosome-binding site.

and the first enzyme specific to glycolysis, glucose-6-phosphate isomerase (PGI), in the chromosome of C. glutamicum in a stepwise approach. In a growth-arrested bioprocess under oxygen deprivation, we are able to ascribe incremental rises observed in glucose consumption and alanine accumulation after each cumulative step to the respective gene overexpression. The results reveal glycolytic enzyme activity as a legitimate target for metabolic engineering aimed at increasing C. glutamicum carbon metabolism under oxygen deprivation. MATERIALS AND METHODS Bacterial strains, media, growth conditions, and plasmids. All bacterial strains and plasmids used in this study are listed in Table 1. For genetic manipulations, E. coli strains were grown at 37°C in Luria-Bertani (LB) medium. For aerobic growth conditions, C. glutamicum R (JCM 18229) and its recombinants were precultured at 33°C in nutrient-rich medium (A medium) containing 2 g yeast extract, 7 g Casamino Acids, 2 g urea, 7


g ammonium sulfate, 0.5 g KH2PO4, 0.5 g K2HPO4, 0.5 g MgSO4 · 7H2O, 6 mg Fe2SO4 · 7H2O, 4.2 mg Mn2SO4 · H2O, 0.2 mg biotin, 0.2 mg thiamine per liter supplemented with 4% glucose. Where appropriate, media were supplemented with antibiotics and/or 1.5% agar. The final concentrations of antibiotics used were follows: chloramphenicol, 50 ␮g/ml for E. coli and 5 ␮g/ml for C. glutamicum; kanamycin, 50 ␮g/ml for both E. coli and C. glutamicum. DNA manipulations. Plasmid DNA was isolated either by the alkaline lysis procedure or by using a HiSpeed Plasmid Midi Kit (Qiagen Inc.) according to the manufacturer’s instructions, modified when extracting DNA from corynebacteria by using 4 mg/ml lysozyme at 37°C for 30 min. Chromosomal DNA was isolated from corynebacteria following methods previously described (29), modified by using 4 mg/ml lysozyme at 37°C for 30 min. Restriction endonucleases were purchased from TaKaRa (Japan). PCR was performed using a GeneAmp PCR system (Applied Biosystems) in a total volume of 100 ␮l with 50 ng of DNA, 0.2 mM deoxynucleoside triphosphates (dNTPs), 2% dimethyl sulfoxide in LA Taq polymerase buffer with MgCl2, and 4 units of LA Taq polymerase

aem.asm.org 4449

Yamamoto et al.

TABLE 2 Oligonucleotides used in this study Primer

Target gene

Sequence (5=–3=)a

Restriction site(s)

Primer 1 Primer 2 Primer 3 Primer 4 Primer 5 Primer 6 Primer 7 Primer 8 Primer 9 Primer 10 Primer 11 Primer 12 Primer 13 Primer 14 Primer 15 Primer 16

SSI1 region SSI1 region SSI5 region SSI5 region SSI10 region SSI10 region Ptac-term region Ptac-term region gapA gapA pyk pyk pfk pfk gpi gpi

ATGCATGCTTGCGTATTTCTGGAAGAAG ATGCATGCCACACCTCGATAAACCTCTC CTCTGTCGACCCAGTCAGTACATACAGGCT CTCTGCATGCCTCTCCGCGAACGAATCCGT CTCTTCTAGAACACACCTCATCACGAGTAG CTCTTCTAGACCTCGTCAGTTGCTGCAGTT CCCCGGTACCCAATTGAGATCTGGATCCGGCTGTGCAGGTCGTAAA CCCCTCTAGAGGATCCAGATCTCAATTGAAGAGTTTGTAGAAACGCAAAA CCCCGAATTCATGACCATTCGTGTTGGT CCCCGAATTCTTAGAGCTTGGAAGCTACG CCCCCAATTGATGGGCGTGGATAGACG CCCCCAATTGTTAGAGCTTTGCAATCCTTGT CCCCGAATTCATGGAAGACATGCGAATTGC CCCCGAATTCCTATCCAAACATTGCCTGGG GCCCCAATTGATGGCGGACATTTCGAC GCCCCAATTGCTACCTATTTGCGCGGT

SphI SphI SalI SphI XbaI XbaI KpnI, MunI, BamHI, BglII BglII, BamHI, MunI, KpnI EcoRI EcoRI MunI MunI EcoRI EcoRI MunI MunI

a

The restriction sites used in the cloning procedure are underlined.

(TaKaRa, Japan) for 30 cycles at temperatures of 94°C for denaturation (1 min), 55°C for annealing (1 min), and 72°C for extension (1 min/kb). Oligonucleotide primers used in this study are listed in Table 2. The resulting PCR fragments were purified with a QIAquick PCR purification kit (Qiagen Inc., Germany). The transformation of corynebacteria was carried out by electroporation with a 2.5-kV, 200-⍀, and 25-␮F electric pulse in a 0.2-cm cuvette using a Gene Pulser (Bio-Rad) (41). Transformation of E. coli was performed by the CaCl2 procedure (29). DNA sequencing. All sequencing was performed by the dideoxy chain termination method as previously described with an ABI Prism 3100 genetic analyzer (Applied Biosystems) using a BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems). The nucleotide sequences of both strands were determined. DNA sequence data were analyzed with the GENETYX program (Software Development, Japan). Chromosomal integration of glycolytic genes. Chromosomal integration of gapA, pyk, pfk, and pgi, coding GAPDH, PYK, PFK, and PGI respectively, was achieved via a markerless system using suicide vector pCRA725 carrying the sacB gene. The plasmids for the markerless system were constructed using a previously described method (10). The glycolytic genes were integrated into C. glutamicum R strain-specific islands (SSIs), previously identified as dispensable for cell growth (37). These DNA fragments (SSI1, 10, and 5 regions) were amplified by PCR using oligonucleotide primers 1 and 2 for gapA integration, 3 and 4 for pgi integration, and 5 and 6 for pyk and pfk integration, respectively (Table 2), and C. glutamicum R chromosomal DNA as the template. The amplified DNA fragments were cloned into the appropriate restriction sites of pCRA725 to yield plasmids pCRD900, pCRD901, and pCRD902, respectively. The tac promoter and rrnB terminator region was amplified using pCRC200 as the template and oligonucleotide primers 7 and 8 to generate a DNA fragment with appropriate restriction site. The obtained 0.6-kb DNA fragment of the Ptac-term gene was digested by KpnI and XbaI, and it was inserted into pCold I vector (TaKaRa, Japan) to generate pCRD903 plasmid. Furthermore, the SD sequence (5=-AATTGGAAACTTTTTAGAAAGGTGT GTTG-3=) was inserted into the EcoRI site between the tac promoter and the rrnB terminator in pCRD903 so that only the EcoRI site remained behind the SD sequence (pCRD904). The 1.0-kb DNA fragment of gapA gene was amplified using C. glutamicum R chromosomal DNA as the template and oligonucleotide primers 9 and 10 to generate a DNA fragment with EcoRI cohesive ends. The 1.0-kb EcoRI fragment carrying the gapA gene was cloned into pCRD904 to generate pCRD905. A 1.7-kb gapA gene under the control of the constitutive tac promoter was prepared by digestion of pCRD905 with BamHI or BglII. A BamHI-digested Ptac-SDgapA-term fragment was inserted into the BglII site of pCRD900 (pCRD906). A BglII-digested Ptac-SD-gapA-term fragment was inserted

4450

aem.asm.org

into the BglII site of pCRD906 (pCRD907). The 1.4-kb DNA fragment of the pyk gene, 1.0-kb DNA fragment of the pfk gene, and 1.6-kb DNA fragment of the pgi gene were amplified using C. glutamicum R chromosomal DNA as the template and oligonucleotide primers 11 and 12 for pyk, 13 and 14 for pfk, and 15 and 16 for pgi to generate a DNA fragment with appropriate cohesive ends. The 1.4-kb MunI fragment carrying the pyk gene, the 1.0-kb EcoRI fragment carrying the pfk gene, and the 1.6-kb MunI fragment carrying the pgi gene were cloned into pCRD904 to generate pCRD908, pCRD909, and pCRD910, respectively. The 2.1-kb pyk gene, the 1.7-kb pfk gene, and the 2.3-kb pgi gene under the control of the constitutive tac promoter were prepared by digestion of pCRD908, pCRD909, and pCRD910, respectively, with BamHI. A digested Ptac-SDpyk-term fragment was additionally digested with BglII. The BamHI- and BglII-digested Ptac-SD-pyk-term fragment was inserted into the BglII site of pCRD902 (pCRD911). The BamHI-digested Ptac-SD-pfk-term fragment was inserted into the BglII site of pCRD911 (pCRD912). The BamHI-digested Ptac-SD-pgi-term fragment was inserted into the BglII site of pCRD901 (pCRD913). The resultant plasmids were introduced into C. glutamicum by electroporation courtesy of a stepwise approach. Single-crossover mutants were selected on A medium agar plates containing 50 ␮g/ml kanamycin. They were cultivated for 12 h in BT medium containing 10% sucrose. Gene integration was confirmed by PCR and DNA sequencing. Conditions for alanine production under oxygen deprivation. For alanine production, 500 ml of culture was harvested by centrifugation (5,000 ⫻ g, 4°C for 10 min). The cell precipitate was subsequently washed once with BT medium. Appropriate amounts of washed cells were resuspended in 60 ml of BT medium with 400 mM glucose. Cell suspensions were incubated at 33°C with constant agitation without aeration. The pH of the cell reaction mix was maintained at 7.0 using a pH controller (DT1023; Biott, Japan) by supplementing with 5 N ammonia solution. Analytical procedures. Collected samples were centrifuged (15,000 ⫻ g, 4°C for 10 min) after dilution to dissolve precipitates, and the supernatant concentrations of glucose, alanine, and organic acids were determined. Alanine concentration was determined using high-performance liquid chromatography (HPLC) (Prominence; Shimadzu Corp., Japan) equipped with a Shim-pack Amino-Na column (Shimadzu Corp., Japan) and a spectrofluorometer after derivatization with o-phthalaldehyde according to the manufacturer’s protocol. Organic acids were quantified by the HPLC system (8020; Tosoh Corp., Japan) equipped with a UV and electric conductivity detector and TSKgel OApac-A column (7.8-mm inside diameter [i.d.] by 30 cm; Tosoh Corp., Japan) operating at 40°C with a 0.75 mM H2SO4 mobile phase at a flow rate of 1.0 ml/min. Glucose concentration was determined by an enzyme electrode glucose sensor



(BF-5; Oji Scientific Instruments, Japan). Cell growth was monitored by measuring absorbance at 610 nm using a spectrophotometer (DU800; Beckman Coulter). Enzyme assays. For enzymatic activity, 2 ml of reaction solution was harvested by centrifugation at 8,000 ⫻ g, 4°C for 10 min. Cell pellets were washed once with sonication buffer (100 mM Tris-HCl buffer, pH 7.5, 1 mM MgCl2, 2 mM dithiothreitol [DTT]). The cells were resuspended in 1 ml of the same buffer before adding 0.5 g of glass beads (150 to 212 ␮m; Sigma-Aldrich), and the suspensions were sonicated for 45 min (pulse, 5 s; interval, 10 s) with an ultrasonic homogenizer (UCD-200; Cosmo Bio, Japan) in an ice water bath. Cellular debris were removed by centrifugation (15,000 ⫻ g, 4°C for 10 min), and the supernatants were used as a crude extract. Protein concentrations were measured with a Bio-Rad protein assay kit (Bio-Rad Laboratories). Assays for glucokinase (GLK), PGI, PFK, fructose-1,6-biphosphate aldolase (ALD), triosephosphate isomerase (TPI), GAPDH, phosphoglycerate kinase (PGK), PYK, and AlaDH activities were done at 340 nm by monitoring the decrease or increase of NAD (phosphate) [NAD(P)H or NAD(P)⫹]. Briefly GLK activity was measured in 100 mM Tris-HCl buffer (pH 7.5) containing 4 mM MgCl2, 1 mM ATP, 0.2 mM NADP⫹, 40 mM glucose, and 1 U/ml glucose-6-phosphate dehydrogenase (G6PDH). PGI activity was measured in 100 mM Tris-HCl buffer (pH 7.5) containing 4 mM MgCl2, 0.2 mM NADP⫹, 10 mM fructose-6-phosphate, and 1 U/ml G6PDH. PFK activity was measured in 100 mM Tris-HCl buffer (pH 7.5) containing 4 mM MgCl2, 0.2 mM NADH, 5 mM DTT, 5 mM ATP, 10 mM fructose-6-phosphate, 1 U/ml ALD, 5 U/ml TPI, and 5 U/ml glycerol-3-phosphate dehydrogenase (G3PDH). ALD activity was measured in 100 mM Tris-HCl buffer (pH 7.5) containing 4 mM MgCl2, 0.2 mM NADH, 20 mM fructose-1,6-bisphosphate, 1 U/ml TPI, and 5 U/ml G3PDH. TPI activity was measured in 100 mM Tris HCl buffer (pH 7.5) containing 4 mM MgCl2, 0.2 mM NADH, 15 mM glyceraldehyde-3-phosphate, and 5 mM G3PDH. GAPDH activity was measured in 25 mM sodium phosphate-25 mM triethanolamine buffer (pH 7.5) containing 0.2 mM EDTA, 5 mM NAD⫹, and 5 mM glyceraldehyde-3-phosphate. PGK activity was measured in 100 mM Tris-HCl buffer (pH 7.5) containing 4 mM MgCl2, 4 mM ATP, 0.2 mM NADH, 20 mM 3-phosphoglycerate, and 5 U/ml GAPDH. PYK activity was measured in 100 mM Tris-HCl buffer (pH 7.5) containing 10 mM MgCl2, 2 mM ADP, 0.2 mM NADH, 10 mM phosphoenolpyruvate, and 20 U/ml lactate dehydrogenase. AlaDH activity was measured in 100 mM Tris-HCl buffer (pH 7.5) containing 0.2 mM NADH, 100 mM NH4Cl, and 2 mM sodium pyruvate. Units of these activities were calculated using an extinction coefficient for NAD(P)H/ NAD(P)⫹ of 6,220 M⫺1cm⫺1 at 340 nm. Assays for phosphoglycerate mutase (PGM) and enolase (ENO) activities were done at 240 nm by monitoring the increase of phosphoenolpyruvate (25). Briefly, PGM activity was determined in 100 mM Tris-HCl buffer (pH 7.5) containing 4 mM MgCl2, 10 mM 3-phosphoglycerate, and 5 U/ml ENO. ENO activity was measured in the same reaction mixture with PGM containing 5 U/ml PGM instead of ENO as a coupling enzyme. Units of these activities were calculated using an extinction coefficient for phosphoenolpyruvate of 1,400 M⫺1cm⫺1 at 240 nm. Measurement of intracellular metabolites. Intracellular metabolites were extracted from C. glutamicum cells as follows. Samples (100 ␮l) were taken 24 h after the reaction started and were immediately quenched by mixing with 1.0 ml of cold methanol (⫺80°C). The resultant cell suspension (0.5 ml) was mixed vigorously with 0.5 ml of chloroform and 0.5 ml of H2O (⫺20°C) to disrupt cells, and after being incubated for 60 min at ⫺20°C, the sample solution was centrifuged (20,000 ⫻ g, 4°C for 5 min). An aliquot of the upper layer (50 ␮l) was mixed with 50 ␮l of water or authentic standard mixture solution (5.0 ␮M each) and centrifuged (20,000 ⫻ g, 4°C for 5 min). The resultant supernatant was analyzed by liquid chromatography-tandem mass spectrometry (LC-MS/MS) using HPLC (Prominence 20A) coupled with a linear ion trap mass spectrometer (4000 Q TRAP; Applied Biosystems/MDS SCIEX) as previously described (5). Data were obtained from three independent culture sam-


ples. A factor of 1.8 ml/g cell dry weight was assumed as the cell volume for the calculation of intracellular concentrations. The ratio of intracellular metabolite level between the two strains was mapped using KaPPA-View 4 software (28, 39). Calculation of NADH utilization efficiency. NADH utilization efficiency was computed using product yields and their NADH utilization factor. The NADH utilization factor was defined as the amount of NADH consumption from 1 mol of glucose through their formation pathway; those of alanine, acetic acid, and succinic acid were ⫺2 (by alanine dehydrogenase), ⫹2 (by pyruvate dehydrogenase), and ⫺4 (by malate dehydrogenase and succinate dehydrogenase), respectively. The NADH utilization efficiency of each product was calculated based on the following formula: NADH utilization efficiency ⫽ ⫺1 ⫻ NADH utilization factor ⫻ yield (%)/100. The total NADH utilization efficiency was calculated by adding NADH utilization efficiencies of alanine, acetic acid, and succinic acid.

RESULTS

C. glutamicum strain chromosomally harboring extra copies of the glycolytic genes gapA, pyk, pfk, and pgi is based on an ldhA and ppc deletion mutant. Four glycolytic genes, gapA, pyk, pfk, and pgi, controlled by the constitutive tac promoter were integrated into the chromosomal DNA of C. glutamicum in a stepwise manner. To minimize any tendency for the formation of major by-products (lactic and succinic acids) by the eventual strain, an ldhA and ppc double deletion mutant (10) was used as the parental strain (Fig. 1). In the first step, two tandemly arranged sets of gapA were integrated in order to obtain GAPDH activity comparable to that of the previously constructed strain ⌬ldhA⌬ppc⫹alaD⫹ gapA. This strain is a high alanine producer overexpressing alaD and native gapA via the expression plasmid pCRD501 (14). The newly constructed GLY1 strain’s 6.5 U/mg protein GAPDH activity was 1.5-fold higher than that of strain ⌬ldhA⌬ppc⫹alaD⫹ gapA (4.5 U/mg protein) and was the preferred parental strain for the consequent integration of pyk and pfk. PYK and PFK were allosterically regulated enzymes that catalyze essentially irreversible reactions in glycolysis (26). To introduce pyk and pfk simultaneously into the GLY1 strain, a suicide vector for the integration was constructed by connecting both genes with a tac promoter. The resulting recombinant strain, named GLY2, was used as the parental strain for the integration of pgi. PGI is the branch point enzyme between the glycolytic pathway and the pentose-phosphate pathway (PPP). Integration of pgi resulted in recombinant GLY3. GLY1, GLY2, and GLY3 were each transformed with pCRD500 harboring the alaD gene for alanine formation, ending up with recombinants named GLY1/pCRD500, GLY2/pCRD500, and GLY3/pCRD500, respectively. Overexpression of glycolytic genes enhances productivity under oxygen deprivation without affecting growth under aerobic conditions. Enzymatic activity and alanine formation of three recombinants, GLY1/pCRD500, GLY2/pCRD500, and GLY3/pCRD500, and of their parental ⌬ldhA ⌬ppc/pCRD500 strain, were evaluated under oxygen deprivation. Table 3 reveals that gapA overexpression in GLY1/pCRD500, GLY2/pCRD500, and GLY3/pCRD500 resulted in GAPDH activities about 10-fold higher than those of the parental strain. PGK and AlaDH activities, which do not directly relate to the manipulated genes, were slightly depressed, but the reasons for this are not known. The effects of overexpression of gapA were therefore largely confined to GAPDH activity, as those of other genes were similarly confined to the corresponding activities. Overexpression of pyk, pfk, and

aem.asm.org 4451

Yamamoto et al.

TABLE 3 Enzymatic activities of glycolytic and alanine formation pathway in C. glutamicum variants under oxygen deprivation Enzymatic activity (U/mg protein) for indicated straina Enzyme name

⌬ldhA ⌬ppc/pCRD500

GLY1/pCRD500

GLY2/pCRD500

GLY3/pCRD500

AlaDH GLD PGI PFK ALD TPI GAPDH PGK PGM ENO PYK

13.0 ⫾ 0.4 0.011 ⫾ 0.0002 0.71 ⫾ 0.01 0.15 ⫾ 0.004 0.55 ⫾ 0.07 15.9 ⫾ 4.9 0.5 ⫾ 0.03 4.0 ⫾ 0.3 0.51 ⫾ 0.03 0.51 ⫾ 0.04 1.5 ⫾ 0.1

10.8 ⫾ 0.9 0.009 ⫾ 0.002 0.92 ⫾ 0.03 0.23 ⫾ 0.02 0.62 ⫾ 0.03 12.8 ⫾ 3.9 5.4 ⫾ 2.0 2.5 ⫾ 0.2 0.66 ⫾ 0.06 0.49 ⫾ 0.02 1.4 ⫾ 0.2

10.8 ⫾ 1.1 0.008 ⫾ 0.002 0.73 ⫾ 0.08 0.27 ⫾ 0.04 0.51 ⫾ 0.02 12.6 ⫾ 2.3 4.7 ⫾ 0.8 2.6 ⫾ 0.1 0.56 ⫾ 0.02 0.48 ⫾ 0.02 19.9 ⫾ 2.5

7.7 ⫾ 1.4 0.006 ⫾ 0.002 2.17 ⫾ 0.32 0.27 ⫾ 0.02 0.48 ⫾ 0.004 13.8 ⫾ 2.8 6.0 ⫾ 0.3 2.9 ⫾ 0.002 0.55 ⫾ 0.04 0.47 ⫾ 0.01 19.8 ⫾ 3.1

a

All activities were measured as described in Materials and Methods, and values are reported as averages ⫾ standard deviations from triplicate assays.

pgi, on the other hand, increased PYK, PFK, and PGI activities about 14-, 1.5-, and 3-fold, respectively. No significant alterations of other enzymatic activities of the glycolytic pathway were observed. Glucose consumption and alanine formation (Fig. 2 and Table 4) profiles of all four strains under oxygen deprivation revealed 1,520 mM alanine production by GLY1/pCRD500, a 4.5-fold increase over that of the ⌬ldhA ⌬ppc/pCRD500 strain (346 mM). This higher alanine production was comparable to that of the previously reported strain ⌬ldhA⌬ppc⫹alaD⫹gapA (14). Over the course of the fermentation, glucose consumption and alanine formation of GLY2/pCRD500 were progressively better than

FIG 2 Profiles of alanine production by metabolically engineered C. glutamicum under oxygen deprivation. Glucose consumption (A) and alanine production (B) by C. glutamicum recombinants ⌬ldhA ⌬ppc/pCRD500 (circles), GLY1/pCRD500 (triangles), GLY2/pCRD500 (squares), and GLY3/pCRD500 (diamonds) are shown. Data points represent the averages calculated from triplicate measurements. Error bars show standard deviation.

4452

aem.asm.org

those of GLY1/pCRD500, while those of GLY3/pCRD500 were similarly progressively better than those of GLY2/pCRD500. Consequently, alanine production, glucose consumption rate, alanine concentration, alanine productivity, and alanine yield increased with the increase in the number of overexpressed genes in the recombinant strains (Table 4). Surprisingly, strain GLY3/ pCRD500 produced so much alanine that it precipitated after 36 h. At 48 h, alanine formation by this strain reached 2,430 mM (216 g/liter), about 6.4-fold higher than that of the parental strain not overexpressing any glycolytic genes. In contrast to the improved alanine yield observed, the yield of major by-products reduced with increasing number of glycolytic genes overexpressed (Table 4). These results strongly suggested that increased glycolytic enzyme activities enabled efficient alanine formation by virtue of not only increasing glucose metabolism but also restraining by-product yield. On the other hand, both specific growth rates and glucose consumption rates of log-phase cultures of the four recombinants were not different under aerobic conditions (see Fig. S1 in the supplemental material). These results also suggested that enhancement of these glycolytic enzymes did not influence growth rate and glucose metabolism under growth-permitting conditions. Intracellular metabolite profiles reflect the extent of glycolytic gene overexpression of recombinants under oxygen deprivation. Intracellular metabolite levels and redox balances in alanine-producing recombinants under oxygen deprivation were analyzed by LC-MS/MS to monitor metabolite changes that correlate with enhanced glycolytic enzyme activities. gapA-overexpressing GLY1/pCRD500 revealed clearly depressed levels of the intermediates glucose-6-phosphate, fructose-6-phosphate, and glyceraldehyde-3-phosphate upstream of GAPDH and markedly increased levels of the intermediates glycerate-1,3-bisphosphate, glycerate-3-phosphate/glycerate2-phosphate, phosphoenolpyruvate, and pyruvate downstream, compared with the parental ⌬ldhA ⌬ppc/pCRD500 strain (Fig. 3A). The significant improvement of alanine formation and alterations of glycolytic intermediate profiles strongly suggest that GAPDH indeed catalyzed the rate-limiting step of glycolysis under oxygen deprivation. Furthermore, the decrease observed in the NADPH/NADP⫹ ratio (Fig. 4) and reduced concentrations of almost all PPP intermediates, ribulose-5-phosphate, xylulose-5-phosphate, sedoheptulose-7-



TABLE 4 Recombinant productivities under oxygen deprivationa

Strain ⌬ldhA ⌬ppc/pCRD500 GLY1/pCRD500 GLY2/pCRD500 GLY3/pCRD500 GLY3/pCRD914 a b

Reaction time (h)

Glucose consumption rate (mM/h)

Alanine concn (mM)

Alanine productivity (mM/h)

Yield (%)b Alanine

Acetic acid

Succinic acid

Total

48 48 48 48 48 72

5.8 ⫾ 0.2 19.6 ⫾ 0.1 22.2 ⫾ 1.4 27.6 ⫾ 1.8 32.0 ⫾ 0.8 25.8 ⫾ 1.0

378 ⫾ 58 1,520 ⫾ 20 1,820 ⫾ 180 2,430 ⫾ 150 2,640 ⫾ 40 3,090 ⫾ 160

7.2 ⫾ 1.1 31.6 ⫾ 0.3 37.9 ⫾ 3.8 50.6 ⫾ 3.1 54.9 ⫾ 0.9 42.9 ⫾ 2.2

68.3 ⫾ 3.7 80.3 ⫾ 0.4 85.1 ⫾ 4.3 91.8 ⫾ 2.2 86.0 ⫾ 1.6 83.0 ⫾ 2.1

3.1 ⫾ 0.8 1.9 ⫾ 0.1 1.6 ⫾ 0.1 1.3 ⫾ 0.1 1.4 ⫾ 0.08 1.3 ⫾ 0.05

7.1 ⫾ 0.9 6.0 ⫾ 0.3 4.8 ⫾ 0.1 4.5 ⫾ 0.2 4.1 ⫾ 0.03 4.3 ⫾ 0.1

78.5 ⫾ 7.3 88.5 ⫾ 0.6 91.5 ⫾ 4.0 97.6 ⫾ 2.4 91.5 ⫾ 1.6 88.6 ⫾ 2.3

Data are reported as averages ⫾ standard deviations from three different experiments. Yields are based on mol of alanine produced from mol of glucose consumption (100% means 2 mol of alanine per 1 mol of glucose).

phosphate, and erythrose-4-phosphate (Fig. 3A), pointed to the possibility of a reduction of carbon flow through the PPP and, consequently, NADPH formation (Fig. 1). Although the glycolytic and PPP intermediate profiles of GLY2/pCRD500 relative to GLY1/pCRD500 and GLY3/pCRD500 relative to GLY2/pCRD500 did not appear significantly different (Fig. 3B and C), a relative increase in glucose consumption (Fig. 2) and

a relative reduction in the NAD(P)H/NAD(P)⫹ ratio (Fig. 4) were apparent. The intermediate profiles of GLY3/pCRD500 relative to the parental strain are much more pronounced than those of GLY1/pCRD500 relative to the parental strain (Fig. 3D), corroborating the stronger glucose consumption and alanine productivity of GLY3/pCRD500. The measured NADH/ NAD⫹ ratio in the three glycolytic gene-overexpressing strains cor-

FIG 3 Comparative assessment of intracellular metabolite levels between the two recombinants. The ratios of GLY1/pCRD500 to ⌬ldhA ⌬ppc/pCRD500 (A), GLY2/pCRD500 to GLY1/pCRD500 (B), GLY3/pCRD500 to GLY2/pCRD500 (C), and GLY3/pCRD500 to ⌬ldhA ⌬ppc/pCRD500 (D) are shown. The target genes for comparison of glycolytic intermediate levels are indicated by red arrows. Intracellular metabolites shown in white could not be determined by this method. Abbreviations of intracellular metabolites are the same as those in Fig. 1. Data points represent the averages calculated from triplicate measurements.


aem.asm.org 4453

Yamamoto et al.

FIG 6 Alanine concentration by GLY3/pCRD914 strain under oxygen deprivation. Data points represent the averages calculated from triplicate measurements. Error bars show standard deviation.

FIG 4 Redox balances in C. glutamicum recombinants under oxygen depri-

vation. Ratio of intracellular NADH/NAD⫹ (open column) and NADPH/ NADP⫹ (solid column) were shown. Data points represent the averages calculated from triplicate measurements. Error bars show standard deviation.

related well with the total NADH utilization efficiency calculated from product yields and their NADH utilization factors (see Materials and Methods) (Fig. 5). This result suggested that the observed differences in NADH/NAD⫹ ratio among the three recombinants were caused by the relative changes in NADH-NAD⫹ conversiondependent product yields of alanine and acetic and succinic acids. Elevating alanine dehydrogenase activity raises C. glutamicum alanine production. To explore the further enhancement of AlaDH activity of recombinant GLY3, a strain bearing the alaDcontaining pCASE1 plasmid, which was isolated from Corynebacterium casei JCM 12072 and shows a high copy number in C. glutamicum (40), was constructed. AlaDH activity of the resulting GLY3/pCRD914 strain at 29.2 U/mg protein was about four times higher than the 7.7 U/mg protein of the GLY3/pCRD500 strain. In

FIG 5 NADH/NAD⫹ ratio measured by intracellular metabolites analysis and calculated NADH utilization efficiencies in three glycolytic gene-overexpressing recombinants, GLY1/pCRD500, GLY2/pCRD500, and GLY3/pCRD500. Total NADH utilization efficiency was calculated by adding NADH utilization efficiencies of alanine and acetic and succinic acids (see Materials and Methods).

4454

aem.asm.org

alanine production under oxygen deprivation, the initial rate of alanine formation (up to 12 h) was significantly high at 87.1 mM/h in this recombinant compared to the 34.5 mM/h in the GLY3/ pCRD500 strain (Fig. 2 and 6). Also, alanine concentration improved by 10% at the time point of 48 h and eventually reached 3,080 mM (275 g/liter) within 72 h (Table 4). DISCUSSION

In the present study, we demonstrated improved glucose metabolism of metabolically engineered C. glutamicum under oxygen deprivation, successfully establishing that glycolytic gene overexpression accelerates glucose consumption of C. glutamicum under oxygen deprivation. The genes gapA, pyk, pfk, and pgi were integrated into the chromosomal DNA of a C. glutamicum ldhA and ppc double deletion background using a stepwise approach, with the observation that glucose utilization and alanine formation increased in tandem with each integration step. Alanine production, glucose consumption rate, alanine concentration, alanine productivity, and alanine yield of the eventual GLY3/pCRD500 strain improved 4.8-, 6.4-, 7.0-, and 1.3-fold, respectively, relative to the parental strain, with the added bonus of decreased by-product yields. Most notably, the 50.6 mM/h alanine productivity of GLY3/pCRD500 represents the highest productivity reported to date, at the considerably high yield of 91.8% at 48 h (Table 4). Moreover, the strain was amenable to further improvement of AlaDH activity, with the resultant GLY3/pCRD914 strain finally able to produce a maximum of 3,080 mM alanine at 72 h. GAPDH, a key enzyme of glycolysis, catalyzes the NAD-dependent oxidation of glyceraldehyde-3-phosphate into glycerate-1,3bisphosphate. Of two C. glutamicum genes encoding GAPDHs, only gapA is essential for glycolysis (24). The susceptibility of the gapA-encoded GAPDH to the intracellular NADH/NAD⫹ ratio suggests that the enzyme may well catalyze a rate-limiting step of glycolysis under both aerobic culture (4) and oxygen deprivation (11, 14, 21) conditions. Strain GLY1/pCRD500 overexpressing only gapA revealed significantly increased glucose consumption and alanine formation (Fig. 2 and 4) due to a shift in intracellular metabolite balance characterized by decreased concentrations of intermediates upstream of GAPDH concurrent with increased downstream intermediates. These data betray the large extent to which GAPDH may control the glycolytic flux of alanine-producing C. glutamicum under oxygen deprivation. Although a 2-fold increase in the NADH/NAD⫹ ratio resulted from gapA overex-



FIG 7 Models of the flux balance for alanine formation from glucose. Values show glucose consumption rate and formation rates of each product (mM/h). Abbreviations: AA, acetic acid; SA, succinic acid; Ala, alanine.

pression, its potential negative effects on glucose consumption rate were most probably compensated for by the concomitant 10-fold increase in GAPDH activity. Co-overexpression of gapA, pfk, and pyk (GLY2/pCRD500) and gapA, pfk, pyk, and pgi (GLY3/pCRD500) also resulted in accelerated glucose consumption under oxygen deprivation even though the relative change was less than that attributable solely to gapA overexpression. Unexpectedly, the increase in alanine yield as well as alanine productivity resulting from increased activities of the glycolytic enzymes was accompanied by reduced by-product biosynthesis, even though no effort was made to engineer the reduction (Table 4). Lower NADH/ NAD⫹ ratios in GLY2/pCRD500 and GLY3/pCRD500 coupled to their higher activities of PFK-PYK and PFK-PYK-PGI, respectively, relative to the parental strain (Fig. 4) likely facilitated an increase in the glucose consumption rate by impairing GAPDH inhibition, which is at least partially responsible for the increased glucose consumption upon cumulative pfk, pyk, and pgi overexpression. These lower NADH/NAD⫹ ratios were likely caused by a shift in product yield ratios of alanine and acetic and succinic acids (Fig. 5); in particular, the increase in alanine yield largely contributed to this phenomenon. To explain why product yield ratios are altered by increased activities of glycolytic enzymes, we propose the model shown in Fig. 7. The carbon flux through the glycolytic pathway increased in step with additional glycolytic gene overexpression. Because enhancement in carbon flux in GLY1/pCRD500 likely exceeded the rate of by-product formation, acetic and succinic acid productivity between GLY2/pCRD500 and GLY3/pCRD500 remained essentially unchanged, meaning that their yields clearly decreased as the rate of glucose consumption increased (Table 4). The increase in alanine yield most likely resulted from an increased alanine production rate. This model does not fully account for the fact that high NADH/NAD⫹ levels limit alanine formation in GLY1/pCRD500 by inhibiting not only GAPDH activity but also AlaDH activity (4, 20). Because of the inhibi-


tion of AlaDH activity amid increased glycolytic flux, intracellular pyruvate significantly accumulated (Fig. 3A), decreasing the intracellular NADH/NAD⫹ levels in GLY2/pCRD500 and GLY3/pCRD500 and hence contributing to improved glucose metabolism by minimizing the inhibition of GAPDH and AlaDH activities. By elevating AlaDH activity even further in GLY3/pCRD914, accelerated glucose metabolism, particularly during the initial 12 h, led to the accumulation of higher amounts of alanine than possible with GLY3/pCRD500 (Fig. 6 and Table 4). This acceleration of glucose metabolism was thought to drive the remarkable accumulation of pyruvate pool in GLY3/pCRD500 toward alanine formation by the enhancement of AlaDH activity (Fig. 3D). This work is a demonstration of how the overexpression of glycolytic genes can be applied to improve the productivity of pyruvate-derived bioproducts using C. glutamicum under oxygen deprivation. Our results were surprising in view of the results from similar previous works, almost all of which showed no improvement of glucose consumption rate or product formation rates. For example, neither individual overproduction of many glycolytic enzymes, hexokinase, PGI, PFK, PGK, PGM, PYK, or simultaneous overproduction of PFK and PYK in yeast had any effect on the glycolytic flux or ethanol production rate (18, 31). In Lactococcus lactis, increasing the GAPDH activity resulted in no change in the glycolytic flux (35); the pyk overexpressing variant revealed a decreased rate of glucose consumption and product formation in spite of accelerated FBP intermediate metabolite depletion and NAD⫹ recovery (27). Snoep et al. reported that decreases in glycolytic flux and growth rate were observed in individual GAPDH-, PGK-, and PGM-overproducing Zymomonas mobilis (33). Also, aldolase had little effect on glucose flux in E. coli (1). Authors in several reports concluded that glycolytic enzymes were present in large excesses in microorganisms and, therefore, modulating glycolytic enzyme activity had very little effect on the glycolytic flux and product formation (18, 34). Others have reported that simultaneous modulation of several steps or accurate adjustment of

aem.asm.org 4455

Yamamoto et al.

individual activities to specific levels might be necessary in order to increase the glycolytic flux (31, 35). However, in our results, increase in one or two glycolytic enzyme activities significantly improved glucose consumption rate and alanine yield. In light of these differences between our results and previous reports, some primary factors thought to explain the results of our study include that (i) our bioprocess utilizes high cell density under oxygen deprivation (which is equivalent to nongrowth conditions of other works), promoting pronounced effects on the glucose consumption rate upon glycolytic gene overexpression (3, 6, 9); and (ii) our targeting of a simple and single end product by restraining by-product formation resulted in comparatively bigger effects than those that would be realized upon alteration of multiple end products (6). Previously, we reported the construction of genetically engineered C. glutamicum highly capable of lactic acid (23), succinic acid (22), ethanol (10), and valine (7) production. The approach in these reports was based on a tailor-made strategy involving metabolic optimization of a specific product pathway, not the common pathway, glycolysis. The present study, on the other hand, cast the spotlight on the overexpression of glycolytic genes to improve glucose metabolism by C. glutamicum under specific nongrowing conditions. Recombinants overexpressing these glycolytic genes have the potential to be widely used as hosts for biochemical production of many products. Great hope for further development lies in additional glycolytic gene overexpression. Investigation of carbon flux control by glycolytic enzyme manipulation is not completely understood yet, but the results of this study reveal a high potential for developments along this line. ACKNOWLEDGMENTS We thank Crispinus A. Omumasaba (RITE) for critical reading of the manuscript. This work was partially supported by a grant from the New Energy and Industrial Technology Development Organization, Japan.

REFERENCES 1. Babul J, Clifton D, Kretschmer M, Fraenkel DG. 1993. Glucose metabolism in Escherichia coli and the effect of increased amount of aldolase. Biochemistry 32:4685– 4692. 2. Blombach B, et al. 2011. Corynebacterium glutamicum tailored for efficient isobutanol production. Appl. Environ. Microbiol. 77:3300 –3310. 3. Davies SE, Brindle KM. 1992. Effects of overexpression of phosphofructokinase on glycolysis in the yeast Saccharomyces cerevisiae. Biochemistry 31:4729 – 4735. 4. Dominguez H, et al. 1998. Carbon-flux distribution in the central metabolic pathways of Corynebacterium glutamicum during growth on fructose. European journal of biochemistry / FEBS. 254:96 –102. 5. Ehira S, Shirai T, Teramoto H, Inui M, Yukawa H. 2008. Group 2 sigma factor SigB of Corynebacterium glutamicum positively regulates glucose metabolism under conditions of oxygen deprivation. Appl. Environ. Microbiol. 74:5146 –5152. 6. Emmerling M, Bailey JE, Sauer U. 2000. Altered regulation of pyruvate kinase or co-overexpression of phosphofructokinase increases glycolytic fluxes in resting Escherichia coli. Biotechnol. Bioeng. 67:623– 627. 7. Hasegawa S, et al. 2012. Improvement of the redox balance increases L-valine production by Corynebacterium glutamicum under oxygen deprivation. Appl. Environ. Microbiol. 78:865– 875. 8. Hashimoto S, Ozaki A. 1999. Whole microbial cell processes for manufacturing amino acids, vitamins or ribonucleotides. Curr. Opin. Biotechnol. 10:604 – 608. 9. Hatzimanikatis V, Emmerling M, Sauer U, Bailey JE. 1998. Application of mathematical tools for metabolic design of microbial ethanol production. Biotechnol. Bioeng. 58:154 –161.

4456

aem.asm.org

10. Inui M, Kawaguchi H, Murakami S, Vertes AA, Yukawa H. 2004. Metabolic engineering of Corynebacterium glutamicum for fuel ethanol production under oxygen-deprivation conditions. J. Mol. Microbiol. Biotechnol. 8:243–254. 11. Inui M, et al. 2004. Metabolic analysis of Corynebacterium glutamicum during lactate and succinate productions under oxygen deprivation conditions. J. Mol. Microbiol. Biotechnol. 7:182–196. 12. Inui M, et al. 2007. Transcriptional profiling of Corynebacterium glutamicum metabolism during organic acid production under oxygen deprivation conditions. Microbiology 153:2491–2504. 13. Jetten MS, Sinskey AJ. 1995. Recent advances in the physiology and genetics of amino acid-producing bacteria. Crit. Rev. Biotechnol. 15:73–103. 14. Jojima T, Fujii M, Mori E, Inui M, Yukawa H. 2010. Engineering of sugar metabolism of Corynebacterium glutamicum for production of amino acid L-alanine under oxygen deprivation. Appl. Microbiol. Biotechnol. 87:159 –165. 15. Kinoshita S. 1985. Glutamic acid bacteria, p 115–146. Biology of Industrial Microorganisms. Cummings, London, United Kingdom. 16. Koebmann B, Solem C, Jensen PR. 2006. Control analysis of the importance of phosphoglycerate enolase for metabolic fluxes in Lactococcus lactis subsp. lactis IL1403. Syst. Biol. (Stevenage) 153:346 –349. 17. Mueller U, Huebner S. 2003. Economic aspects of amino acids production. Adv. Biochem. Eng. Biotechnol. 79:137–170. 18. Muller S, Zimmermann FK, Boles E. 1997. Mutant studies of phosphofructo-2-kinases do not reveal an essential role of fructose-2,6bisphosphate in the regulation of carbon fluxes in yeast cells. Microbiology 143:3055–3061. 19. Nakayama K, Kitada S, Kinoshita S. 1961. Studies on lysine fermentation I. The control mechanism on lysine accumulation by homoserine and threonine. J. Gen. Appl. Microbiol. 7:145–154. 20. Ohashima T, Soda K. 1979. Purification and properties of alanine dehydrogenase from Bacillus sphaericus. Eur. J. Biochem. 100:29 –30. 21. Okino S, Inui M, Yukawa H. 2005. Production of organic acids by Corynebacterium glutamicum under oxygen deprivation. Appl. Microbiol. Biotechnol. 68:475– 480. 22. Okino S, et al. 2008. An efficient succinic acid production process in a metabolically engineered Corynebacterium glutamicum strain. Appl. Microbiol. Biotechnol. 81:459 – 464. 23. Okino S, Suda M, Fujikura K, Inui M, Yukawa H. 2008. Production of D-lactic acid by Corynebacterium glutamicum under oxygen deprivation. Appl. Microbiol. Biotechnol. 78:449 – 454. 24. Omumasaba CA, Okai N, Inui M, Yukawa H. 2004. Corynebacterium glutamicum glyceraldehyde-3-phosphate dehydrogenase isoforms with opposite, ATP-dependent regulation. J. Mol. Microbiol. Biotechnol. 8:91– 103. 25. Pal-Bhowmick I, et al. 2004. Cloning, over-expression, purification and characterization of Plasmodium falciparum enolase. Eur. J. Biochem. 271: 4845– 4854. 26. Pearce AK, et al. 2001. Pyruvate kinase (Pyk1) levels influence both the rate and direction of carbon flux in yeast under fermentative conditions. Microbiology 147:391– 401. 27. Ramos A, et al. 2004. Effect of pyruvate kinase overproduction on glucose metabolism of Lactococcus lactis. Microbiology 150:1103–1111. 28. Sakurai N, Shibata D. 2006. KaPPA-View for integrating quantitative transcriptomic and metabolomic data on plant metabolic pathway maps. J. Pestic. Sci. 31:293–295. 29. Sambrook J, Fritsh EF, Maniatis T. 1989. Molecular cloning: a laboratory manual, 2nd ed. New York Cold Spring Harbor Laboratory Press, New York, NY. 30. Sasaki M, Jojima T, Inui M, Yukawa H. 2008. Simultaneous utilization of D-cellobiose, D-glucose, and D-xylose by recombinant Corynebacterium glutamicum under oxygen-deprived conditions. Appl. Microbiol. Biotechnol. 81:691– 699. 31. Schaaff I, Heinisch J, Zimmermann FK. 1989. Overproduction of glycolytic enzymes in yeast. Yeast 5:285–290. 32. Sekine H, et al. 2001. H⫹-ATPase defect in Corynebacterium glutamicum abolishes glutamic acid production with enhancement of glucose consumption rate. Appl. Microbiol. Biotechnol. 57:534 –540. 33. Snoep JL, Yomano LP, Westerhoff HV, Ingram LO. 1995. Protein burden in Zymomonas mobilis: negative flux and growth control due to overproduction of glycolytic enzymes. Microbiology 141:2329 –2337. 34. Solem C, Koebmann B, Jensen PR. 2008. Control analysis of the role of



35. 36.

37. 38.

triosephosphate isomerase in glucose metabolism in Lactococcus lactis. IET Syst. Biol. 2:64 –72. Solem C, Koebmann BJ, Jensen PR. 2003. Glyceraldehyde-3-phosphate dehydrogenase has no control over glycolytic flux in Lactococcus lactis MG1363. J. Bacteriol. 185:1564 –1571. Solem C, Petranovic D, Koebmann B, Mijakovic I, Jensen PR. 2010. Phosphoglycerate mutase is a highly efficient enzyme without flux control in Lactococcus lactis. J. Mol. Microbiol. Biotechnol. 18: 174 –180. Suzuki N, et al. 2005. Large-scale engineering of the Corynebacterium glutamicum genome. Appl. Environ. Microbiol. 71:3369 –3372. Terasawa M, Yukawa H. 1993. Industrial production of biochemicals by native immobilization. Bioprocess Technol. 16:37–52.


39. Tokimatsu T, et al. 2005. KaPPA-view: a Web-based analysis tool for integration of transcript and metabolite data on plant metabolic pathway maps. Plant Physiol. 138:1289 –1300. 40. Tsuchida Y, Kimura S, Suzuki N, Inui M, Yukawa H. 2009. Characterization of a new 2.4-kb plasmid of Corynebacterium casei and development of stable corynebacterial cloning vector. Appl. Microbiol. Biotechnol. 81: 1107–1115. 41. Vertès AA, Inui M, Kobayashi M, Kurusu Y, Yukawa H. 1993. Presence of mrr- and mcr-like restriction systems in coryneform bacteria. Res. Microbiol. 144:181–185. 42. Yamamoto S, Sakai M, Inui M, Yukawa H. 2011. Diversity of metabolic shift in response to oxygen deprivation in Corynebacterium glutamicum and its close relatives. Appl. Microbiol. Biotechnol. 90:1051–1061.

aem.asm.org 4457