Plant Cell Rep DOI 10.1007/s00299-006-0287-2
GENETIC T RANSFORMAT ION AND HYBRIDIZATION
Overexpression of the chimeric gene of the floral regulator CONSTANS and the EAR motif repressor causes late flowering in Arabidopsis Tomoyuki Takase · Masahiro Yasuhara · Sudarshanee Geekiyanage · Yasunobu Ogura · Tomohiro Kiyosue
Received: 13 September 2006 / Revised: 15 November 2006 / Accepted: 14 December 2006 C Springer-Verlag 2006
Abstract The transcription factor CONSTANS (CO) plays a central role in the photoperiod pathway by integrating the circadian clock and light signals into a control for flowering time. CO induces FLOWERING LOCUS T (FT) and SUPPRESSOR OF OVEREXPRESSION OF CO 1 (SOC1) expression, and thereby promotes flowering. The ethyleneresponsive element-binding factor associated amphiphilic repression (EAR) motif was used to construct a CONSTANSEAR motif repressor gene (CO-Rep), which was overexpressed in Arabidopsis under the control of the Cauliflower mosaic virus 35S promoter in order to test its potential for flowering time regulation under inductive long day conditions. Morphological abnormalities in the root and cotyledon formation, and dwarfness were frequently seen in the transgenic plants, suggesting that the proper timing, location, and/or level of CO-Rep expression are important for its application. In morphologically normal CO-Rep plants, both bolting and flowering times under inductive long day conditions were twofold greater than in controls. As a result of the delay in flowering, rosette leaf number at bolting, and rosette and cauline leaf number at flowering increased significantly in CO-Rep plants. RT-PCR analysis demonstrated that FT expression was greatly reduced in the CO-Rep plants, while endogenous CO and SOC1 expression levels were not Communicated by P. Lakshmanan T. Takase · M. Yasuhara · Y. Ogura · T. Kiyosue () Division of Gene Research, Life Science Research Center, Kagawa University, 2393 Ikenobe, Miki-cho, Kita-gun, Kagawa, 761-0795 Japan e-mail:
[email protected] S. Geekiyanage · T. Kiyosue United Graduate School of Agricultural Sciences, Ehime University, 3-5-7 Tarumi, Matsuyama, Ehime, 790-8566 Japan
markedly affected. Conservation of CO among a diverse range of plant species, and its involvement in a variety of photoperiodic responses including flowering, suggests a high potential for use of CO-Rep to manipulate such responses in an agronomically desirable manner. Keywords Arabidopsis . Chimeric repressor . CONSTANS . Flowering time Abbreviations CaMV: Cauliflower mosaic virus . CO: CONSTANS . CO-Rep: CONSTANS-EAR motif repressor . EAR: Ethylene-responsive element-associated amphiphilic repression . LD: Long day . P5CS2: delta 1-pyrroline-5-carboxylate synthetase B . SD: Short day . SOC1: SUPPRESSOR OF OVEREXPRESSION OF CO 1
Introduction Flowering is regulated by endogenous factors and environmental stimuli such as day length, temperature, and light quality. In Arabidopsis, four major pathways of flowering; namely, the photoperiod pathway, autonomous pathway, vernalization pathway, and gibberellin pathway have been identified (Simpson and Dean 2002). The photoperiod pathway coordinates light and temporal information from the environment through a circadian clock to determine the flowering time. Arabidopsis is a facultative long day plant that flowers early under long day (LD) conditions. CONSTANS (CO), which encodes a zinc finger protein, promotes flowering under LD, while co mutants are late flowering under LD (Putterill et al. 1995). CO mRNA levels are regulated by the circadian clock and show a diurnal rhythm with an accumulation in the evening under LD conditions (Su´arez-L´opez et al. 2001). Springer
Plant Cell Rep
Flowering pathways are interconnected and converge on a few floral integrators such as FT (Kardailsky et al. 1999; Kobayashi et al. 1999) and SOC1 (SUPPRESSOR OF OVEREXPRESSION OF CO 1) (Onouchi et al. 2000). CO regulates FT and SOC1 and thereby promotes flowering (Samach et al. 2000), and FT is required for SOC1 induction by CO (Yoo et al. 2005). Activation of FT transcription is proposed to depend on posttranscriptional regulation of CO. CO protein accumulates only under LD: it is stabilized by blue and farred light through the photoreceptors CRY2 and PHYA in the evening and is degraded in red light and in the dark (Valverde et al. 2004). The FLAVIN-BINDING, KELCH REPEAT, F-BOX1 (FKF1) protein is a partial regulator of the daily rhythm of CO expression; FKF1 physically interacts with and degrades a DOF transcription factor, CYCLING DOF FACTOR 1 (CDF1), which binds to the CO promoter and acts as a repressor of CO (Imaizumi et al. 2005). The CO protein contains two highly conserved domains: an N-terminal zinc-finger region resembling a B-box domain, which is also found in animals, and a plant-specific C-terminal CCT (CO, CO-like, TIMING OF CAB EXPRESSION 1) domain (Strayer et al. 2000). B-boxes are generally considered to mediate protein–protein interactions either directly or indirectly and the CCT domain contains a putative nuclear localization signal (Robson et al. 2001). CCT domains may also have a role in protein–protein interactions (Kurup et al. 2000). CO belongs to a gene family of 17 putative transcription factors (Robson et al. 2001). CO-Like (COL) proteins in Arabidopsis are subdivided into three broad groups based on the variation of the zinc finger region. CO is included in group I with COL1, COL3, and COL5. Overexpression of COL9 delays flowering time by repressing CO and FT under LD, while overexpressed CO can suppress the late-flowering phenotype of the COL9 overexpressing plants (Cheng and Wang 2005). Furthermore, a loss-of-function COL3 mutant is early-flowering irrespective of day length (Datta et al. 2006). Orthologs of CO have been identified in both dicotyledons and monocotyledons suggesting that CO is conserved in the photoperiod pathway of flowering (Griffiths et al. 2003; Hayama et al. 2003). In addition to the control of flowering time, the CO/FT regulatory module determines the short day-induced growth cessation and bud set-occurring in a temperate forest tree (B¨ohlenius et al. 2006). Ethylene-responsive element (ERE) binding factor proteins, known as ERFs, and some of the Xenopus transcription factor IIIA (TFIIIA) type zinc finger proteins of plants can function as active repressors of transcription: the EAR (ERF-associated amphiphilic repression) motif is essential for this repression (Hiratsu et al. 2002; Ohta et al. 2001). In Arabidopsis, a TFIIIA-type transcription factor, SUPERMAN (SUP) protein is an active repressor and contains an EAR-like motif (Hiratsu et al. 2002). A chimeric protein of Springer
a transcription factor and a modified sequence of EAR-like motif of SUP (LDLDLELRLGFA) functions as a dominant repressor in Arabidopsis in the presence of both endogenous and functionally redundant transcription factors for a target gene, resulting in a loss-of-function phenotype (Hiratsu et al. 2003; Matsui et al. 2005). In this experiment, a chimeric repressor gene was constructed with CO and a modified EAR motif repressor (Hiratsu et al. 2003), and overexpressed to examine its potential for manipulation of flowering time in Arabidopsis, as a first step toward management of photoperiodic responses in crops in the long-term.
Materials and methods Plant material and growth conditions Arabidopsis thaliana ecotype Columbia was used in these experiments. Plants were grown on vermiculite in pots or on agar plates at 22◦ C under LD conditions of 16 h light and 8 h darkness. Fluorescent 40 W white tubes (Hitachi, Japan) served as the light source (90–100 µmol/m2 /s). For kanamycin selection, surface-sterilized Arabidopsis seeds were sown axenically on MS medium (Murashige and Skoog 1962) with 1% sucrose, 0.8% agar, 50 mg/l kanamycin, and 50 mg/l carbenicillin, incubated at 4◦ C in the dark for 3 days to break the dormancy, and then grown under LD. Construction of 35S:CO-Rep Double-stranded EAR repressor motif sequence with BamHI and BglII sites at the 5 and 3 ends, respectively, was synthesized in vitro (5 GGATCCCTTGATCTTGATCTTGAACTTAGACTTGGA TTTGCTTAGATCT-3 ). This was digested with Bam HI and Bgl II and inserted into the Bam HI site of the pBE2113 expression vector (Mitsuhara et al. 1996). The insert along with the upstream and downstream regions were sequenced to verify the sequence and orientation of the insert. The CO coding region was PCR-amplified from the CO cDNA (Fukamatsu et al. 2005) with the primers of forward 5 -AGGATCCGTATGTTGAAACAAGAGAGTAAC-3 and reverse 5 -TGGATCCTGCGAATGAAGGAACAATCCCA T-3 , which introduced a Bam HI site at each end, and an altered codon of GCA in place of the stop codon (TGA), for non-function. The PCR fragment was subcloned into pCR4TOPO (Invitrogen, USA), and sequenced entirely to verify the sequence. The CO fragment cut with Bam HI was ligated into the Bam HI site of pBE2113 vector carrying repressor sequence (Fig. 1). The chimeric CO-Rep sequence and its upstream and downstream sequences were sequenced and
Plant Cell Rep
Fig. 1 Schematic representation of the 35S:CO-Rep construct. EAR motif sequence with BamHI and BglII sites at the 5 and 3 ends, respectively, was inserted into the BamHI site of pBE2113 vector leaving a BamHI site at the 5 end of the EAR motif. CO cDNA for the coding region with an altered codon, eliminating the stop codon, and with a BamHI site at each end was ligated into the BamHI site of the pBE2113 vector, creating the vector pBE2113/CO-Rep
the correct orientation of the insert was verified. DNA sequences were determined by the BigDye terminator cycle sequencing method on a DNA sequencer (ABIPRISM 3100 Genetic Analyzer, Applied Biosystems,USA). The GENETYX (Software Development, Japan) and Sequencher (Gene Codes Corporation, USA) software systems were used for analysis of DNA sequences.
kit, Toyobo, Japan) using 1 µg of total RNA as template in a reaction mixture of 20 µl. RT-PCR was performed for the primer pairs of ACT2, CORep, endogenous CO, FT, SOC1, and P5CS2 using LA Taq (Takara, Japan). Primers for FT and SOC1 were designed according to previous reports (Endo et al. 2005; Kotake et al. 2003). For ACT2, endogenous CO and CO-Rep, specific primers were designed by Primer Express software (Applied Biosystems, USA) to avoid detecting homologous genes: ACT2 forward 5 -GGTAACATTGTGCTCAGTGGTGG3 and reverse 5 -AACGACCTTAATCTTCATGCTGC3 . CO-Rep forward 5 -CCGAGGAGCAAGGGTTCAA-3 and reverse 5 -GTCTAAGTTCAAGATCAAGATC-3 . Endogenous CO forward 5 -CCGAGGAGCAAGGGTTCAA3 and reverse 5 -TTTCTTTTTGCCACAGGAGTATCA-3 . P5CS2 forward 5 -GTATGGTGGGCCAAGAGCAA-3 and reverse 5 -GCCTCTGTCCTTTGTAAGACA-3 .
Results
Agrobacterium-mediated transformation
Abnormal phenotype of Co-Rep plants
Agrobacterium tumefaciens strain GV3101 was transformed with pBE2113 alone or pBE2113 carrying CO-Rep by triparental mating (Figurski and Helinski 1979). Arabidopsis plants were transformed by the floral dip method (Clough and Bent 1998).
This experiment was carried out to evaluate the potential of the chimeric CO-Rep gene for flowering time control in Arabidopsis initially, with the long-term prospect of use in photoperiod-sensitive crops. For that purpose, the chimeric CO-Rep gene was constructed using the coding region of CO cDNA and EAR motif sequence, under the control of the CaMV 35S promoter and including the Omega translational enhancer (Fig. 1). In the T1 generation CO-Rep transgenic plants, both normal seedlings (67%) and dwarf seedlings (33%) were obtained (Fig. 2A and B). Both types of seedling could grow and set seed. We frequently observed seedlings with morphological abnormalities (44%) in the T2 generation as well. The T2 seedlings showed different phenotypes which include clusters of hairy roots and very short or no primary root, and a single cotyledon, unequal-sized cotyledons or no cotyledons (Fig. 2D–F). CO-Rep expression in the normal T2 transgenic plants was checked by RNA gel blot analysis (Fig. 3), and the progenies of these plants were used for further experiments.
RNA gel blot hybridization Total RNA was extracted from leaves of Arabidopsis plants using Sepasol-RNA I, according to the manufacturer’s instructions (Nacalai tesque, Japan). RNA (1 µg) was fractionated in a 1% agarose gel containing formaldehyde and blotted onto a nylon membrane. A digoxigenin-11-dUTP (DIGdUTP)-labelled RNA probe prepared from the full length coding region of CO was used for hybridization according to the manufacturer’s instructions (Roche Diagnostics, Germany). Chemiluminescence signals were generated by a CDP star visualization kit (Amersham Biosciences, UK) and detected by a light capture system (Mode AE-6955: ATTO, Japan). RT-PCR
Flowering time is delayed and leaf numbers at bolting and flowering are increased in CO-Rep plants under LD.
Samples of approximately 20 CO-Rep seedlings (T3 generation) grown on MS medium containing kanamycin for 10 days were collected 15 h after the light exposure. Total RNA was extracted from whole seedlings using SepasolRNA I, treated with RNase-free DNase I (Takara, Japan) and reverse transcribed with oligo (dT) primer using the firststrand synthesis system for RT-PCR (ReverTra Ace RT-PCR
As CO mutants are late flowering under LD, we checked whether CO-Rep could induce a similar phenotype. Both wild-type plants and vector-only transformed plants flowered after around 1 month of seed sowing under LD, while CO-Rep T3 plants remained vegetative for an additional month, approximately, with proliferating rosette leaves (Fig. 4). Springer
Plant Cell Rep
Fig. 2 Abnormal phenotype 35S:CO-Rep plants. CO-Rep transgenic plants (T1 generation) showed normal morphology (A) or dwarf phenotype (B). CO-Rep transgenic seedlings (T2 generation) showed normal (C) or abnormal morphologies with unequal-sized cotyledons (D), a single cotyledon (E), and no cotyledons (F). Bar = 1 cm (A and B); bar = 1 mm (C–F) Fig. 4 CO-Rep transgenic plants showed a late-flowering phenotype under LD. A wild-type plant (A) and top view and side view of a CO-Rep (17–2) plant in the T3 generation (B, C) after 55 days of germination and growth under LD. Bar = 2 cm
number at flowering increased by 3.5-fold in both CO-Rep lines, relative to total leaf number of 29 ± 2.0 (mean ± SE) in controls.
Fig. 3 CO-Rep expression in transgenic plants measured by RNA gel blot hybridization. RNA gel blots (1 µg of total RNA) showing CO-Rep mRNA levels in wild-type control (lane 1) and two independent CO-Rep overexpressing lines (lane 2: CO-Rep 8–4, lane 3: CO-Rep 17–2). The lower panels show ethidium bromide-stained rRNA for equivalent loading and RNA quality
To evaluate the flowering time control by CO-Rep in Arabidopsis, measurements were taken on flowering time in two CO-Rep lines and one vector control line (Fig. 5). In vector control plants, bolting time and flowering time were 28.5 ± 0.3 and 31.8 ± 0.5 days, respectively (mean ± SE). In contrast, the bolting and flowering times in CO-Rep lines were about twofold longer than those of the controls. In control vector plants the respective rosette leaf numbers at bolting and flowering were 13 ± 0.5 and 22.2 ± 0.7 (mean ± SE). However, rosette leaf numbers in the two CO-Rep lines were higher than those of the controls by 5.4-fold at bolting and 4.4-fold at flowering (line 8-4), and 4-fold at bolting and 3.3-fold at flowering (line 17-2). Cauline leaf number at flowering in the vector control line was 6.8 ± 0.9 (mean ± SE). In the two CO-Rep plant lines, respective cauline leaf numbers were higher than those of control plants by 1.8 (line 8-4) and 4.3-fold (line 17-2). The total leaf
Springer
Overexpression of CO-Rep does not markedly affect expression of endogenous CO or SOC1, but downregulates FT In the RNA gel blot, high levels of CO-derived signals were observed in the 35S:CO-Rep transgenic plants (Fig. 3). However, the signals were derived both from the transgene, 35S:CO-Rep, and the native gene, CO. Therefore, RT-PCR analysis was carried out to distinguish the expression of the two genes. In the transgenic plants, a very high level of CO-Rep expression was detected, while endogenous CO expression was not affected relative to that in vector control transformants (Fig. 6). This suggests that the lateflowering phenotype is due not to suppression of endogenous CO, but to CO-Rep expression. As FT and SOC1 are important floral regulators and both are targets of CO (Kobayashi et al. 1999; Samach et al. 2000), we analyzed their expression to explain the late-flowering phenotype in CO-Rep lines. FT expression was found to be greatly reduced in CO-Rep lines, while a significant decrease in SOC1 expression levels was not detected, relative to empty vector transformants. The expression of P5CS, another previously reported CO-regulated gene (Samach et al. 2000), was also unaffected in the CO-Rep lines.
Plant Cell Rep
Fig. 5 Flowering time of CO-Rep transgenic plants under LD. Bolting time (A), rosette leaf number at bolting (B), flowering time (C) and total leaf number at flowering (D) were scored in CO-Rep plants (T3 generation) under LD. Transformants by the pBE2113 vector were used as the control. Bolting time was scored as the number of days taken from seed sowing to production of the visible flower stalk. The number of rosette leaves was scored at this point. Flowering time was
scored as the number of days taken from seed-sowing to production of the first visible open flower. Numbers of rosette and cauline leaves were scored at this point. Error bars represent the standard error (pBE2113, n = 6; CO-Rep 8-4, n = 4; CO-Rep 17-2, n = 6). The statistically significant differences of each parameter (Student’s T test, p < 0.05) among genotypes, versus control, are indicated by single or double asterisks
Fig. 6 Effect of CO-Rep on the expression of endogenous CO, FT, SOC1 and P5CS2 in transgenic plants grown under LD. CO-Rep, CO, FT, SOC1, and P5CS2 expression in two independent CO-Rep T3 transgenic lines of 8-4 and 17-2 and a vector control line as determined by RT-PCR. ACT2 was used as an internal control
Springer
Plant Cell Rep
Discussion In addition to the observed late flowering, many dwarf plants and abnormal seedlings were seen among the CO-Rep transgenic plants. Since we did not observe such dwarfness and abnormality in other transcription factor-EAR fusion overexpressing Arabidopsis plants that we have tested so far (unpublished results), this effect is not thought to be due to the influence of neighboring transgenes, but due to 35S:CORep. Proper expression of CO-Rep in terms of levels, timing, and space is likely to be important in avoiding these abnormalities. CO promoter analysis using the GUS reporter assay indicated that CO was expressed in vascular tissues of cotyledons and leaves (An et al. 2004; Takada and Goto 2003). These expression patterns were not affected by photoperiod length. Expression of CO from heterologous tissuespecific promoters suggested, CO functioned in the phloem to promote flowering by inducing FT expression (An et al. 2004). Therefore, expression of CO-Rep in the phloem may be sufficient to repress flowering and prevent dwarfness and abnormal development. FT expression was drastically reduced in CO-Rep plants, in accordance with the report by Matsui et al. (2005) that a chimeric transcription factor-EAR repressor gene suppresses the target gene. Our observation of down-regulation of FT is consistent with previous findings on transcription activation of FT by CO (Kardailsky et al. 1999; Kobayashi et al. 1999; Onouchi et al. 2000; Samach et al. 2000). Overexpressed CORep may competitively occupy the transcription activation site of FT and thereby inhibit its transcription, leading to late flowering. SOC1 and P5CS2 are induced by CO (Samach et al. 2000), and the induction of SOC1 is mediated through FT (Yoo et al. 2005). Meanwhile, Wigge et al. (2005) have shown that SOC1 and P5CS2 are not affected by CO in leaf after exposure to a single long day, suggesting that SOC1 and P5CS2 respond to only higher levels of CO, or that they respond to CO in tissues other than leaf. Since the effect on FT by CO-Rep was strikingly greater than the effect on SOC1 and P5CS2, our result suggests that FT is the main target of CO-Rep in Arabidopsis. The presence of CO in both short-day plants and longday plants suggests that CO is involved in a conserved pathway regulating flowering in response to inductive day length (Griffiths et al. 2003). Control of CO expression and activity is crucial in regulation of photoperiodic flowering in Arabidopsis (Valverde et al. 2004). Furthermore, overexpression of CO from Arabidopsis impacted negatively on tuber formation in potatoes under inductive conditions, suggesting that CO could be utilized in manipulation of desired traits in day length-sensitive crops (Mart´ınez-Garcia et al. 2002). Recent findings have revealed that the CO/FT regulatory module also exists in perennial trees, potentially enabling Springer
the manipulation of problems inherent to trees, particularly the long juvenile periods (B¨ohlenius et al. 2006). In addition to flowering, in Aspen trees the CO/FT regulatory module determines the short-day induced growth cessation and bud set-occurring (B¨ohlenius et al. 2006), indicating that a variety of photoperiodic responses could be manipulated via CO in tree crops as well. Since CO-Rep confers a dominant effect, CO-Rep could be utilized in desired manipulation of a variety of photoperiodic responses from a diverse range of crops. Acknowledgement This work was partly supported by the grant from the Program for Promotion of Basic Research Activities for Innovative Biosciences (PROBRAIN). We wish to thank Ms. K Satoh for technical assistance. We also thank Dr. Ohme-Takagi (Gene Function Research Center, Advanced Institute of Science and Technology (AIST)) for helpful discussion.
References An H, Roussot C, Su´arez-L´opez P, Corbesier L, Vincent C, Pi˜neiro M, Hepworth S, Mouradov A, Justin S, Turnbull C, Coupland G (2004) CONSTANS acts in the phloem to regulate a systemic signal that induces photoperiodinc flowering of Arabidopsis. Development 131:3615–3626 B¨ohlenius H, Huang T, Charbonnel-Champaa L, Brunner AM, Jansson S, Strauss SH, Nilsson O (2006) CO/FT regulatory module controls timing of flowering and seasonal growth cessation in trees. Science 312:1040–1043 Cheng X, Wang Z (2005) Overexpression of COL9, a CONSTANSLIKE gene, delays flowering by reducing expression of CO and FT in Arabidopsis thaliana. Plant J 43:758– 768 Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16:735–743 Datta S, Hettiarachchi GHCM, Deng X, Holm M (2006) Arabidopsis CONSTANS-LIKE3 is a positive regulator of red light signalling and root growth. Plant Cell 18:70–84 Endo M, Nakamura S, Araki T, Mochizuki N, Nagatani A (2005) Phytochrome B in the mesophyll delays flowering by suppressing FLOWERING LOCUS T expression in Arabidopsis vascular bundles. Plant Cell 17:1941–1952 Figurski DH, Helinski DR (1979) Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc Natl Acad Sci USA 76:1648– 1652 Fukamatsu Y, Mitsui S, Yasuhara M, Tokioka Y, Ihara N, Fujita S, Kiyosue T (2005) Identification of LOV KELCH PROTEIN2 (LKP2)-interacting factors that can recruit LKP2 to nuclear bodies. Plant Cell Physiol 46:1340–1349 Griffiths S, Dunford RP, Coupland G, Laurie DA (2003) The evolution of CONSTANS-like gene families in barley, rice and Arabidopsis. Plant Physiol 131:1855–1867 Hayama R, Yokoi S, Tamaki M, Yano K, Shimamoto K (2003) Adaptation of photoperiodic control pathways produces short-day flowering in rice. Nature 422:719–722 Hiratsu K, Ohta M, Matsui K, Ohme-Takagi M (2002) The SUPERMAN protein is an active repressor whose carboxy-terminal repression domain is required for the development of normal flowers. FEBS Lett 514:351–354
Plant Cell Rep Hiratsu K, Matsui K, Koyama T, Ohme-Takagi M (2003) Dominant repression of target genes by chimeric repressors that include the EAR motif, a repression domain, in Arabidopsis. Plant J 34:733– 739 Imaizumi T, Schultz TF, Harmon FG, Ho LA, Kay SA (2005) FKF1 F-Box protein mediates cyclic degradation of a repressor of CONSTANS in Arabidopsis. Science 309:293–297 Kardailsky I, Shukla V, Ahn JH, Dagenais N, Christensen SK, Nguyen JT, Chory J, Harrison MJ, Weigel D (1999) Activation tagging of the floral inducer FT. Science 286:1962–1965 Kobayashi Y, Kaya H, Goto K, Iwabuchi M, Araki T (1999) A pair of related genes with antagonistic roles in mediating flowering signals. Science 286:1960–1962 Kotake T, Takada S, Nakahigashi K, Ohto M, Goto K (2003) Arabidopsis TERMINAL FLOWER 2 gene encodes a heterochromatin protein 1 homolog and represses both FLOWERING LOCUS T to regulate flowering time and several floral homeotic genes. Plant Cell Physiol 44:555–564 Kurup S, Jones HD, Holdsworth MJ (2000) Interactions of the developmental regulator AB13 with proteins identified from developing Arabidopsis seeds. Plant J 21:143–155 Mart´ınez-Garcia JF, Virg´os-Soler A, Prat S (2002) Control of photoperiod-regulated tuberization in potato by the Arabidopsis flowering-time gene CONSTANS. Proc Natl Acad Sci USA 99:15211–15216 Matsui K, Hiratsu K, Koyama T, Tanaka H, Ohme-Takagi M (2005) A chimeric AtMYB23 repressor induces hairy roots, elongation of leaves and stems, and inhibition of the deposition of mucilage on seed coats in Arabidopsis. Plant Cell Physiol 46:147–155 Mitsuhara I, Ugaki M, Hirochika H, Ohshima M, Marakami T, Gotoh Y, Katayose Y, Nakamura S, Honkura R, Nishimiya S, Ueno K, Mochizuki A, Tanimoto H, Tsugawa H, Otsuki Y, Ohashi Y (1996) Efficient promoter cassettes for enhanced expression of foreign genes in dicotyledonous and monocotyledonous plants. Plant Cell Physiol 37:49–59 Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol Plant 15:473–497 Ohta M, Matsui K, Hiratsu K, Shinshi H, Ohme-Takagi M (2001) Repression domains of Class II ERF transcriptional repressors share an essential motif for active repression. Plant Cell 13:1959– 1968 Onouchi H, Igeˇno MI, P´erilleux C, Graves K, Coupland G (2000) Mutagenesis of plants overexpressing CONSTANS demonstrates novel interactions among Arabidopsis flowering-time genes. Plant Cell 12:885–900
Putterill J, Robson F, Lee K, Simon R, Coupland G (1995) The CONSTANS gene of Arabidopsis promotes flowering and encodes a protein showing similarities to zinc finger transcription factors. Cell 80:847–857 Robson F, Costa MMR, Hepworth SR, Vizir I, Piˇneiro M, Reeves PH, Putterill J, Coupland G (2001) Functional importance of conserved domains in the flowering-time gene CONSTANS demonstrated by analysis of mutant alleles and transgenic plants. Plant J 28:619– 631 Samach A, Onouchi H, Gold SE, Ditta GS, Schwarz-Sommer Z, Yanofsky MF, Coupland G (2000) Distinct roles of CONSTANS target genes in reproductive development of Arabidopsis. Science 288:1613–1616 Simpson GG, Dean C (2002) Arabidopsis, the Rosetta stone of flowering time? Science 296:285–289 Strayer C, Oyama T, Schultz TF, Raman R, Somers DE, M´as P, Panda S, Kreps JA, Kay SA (2000) Cloning of the Arabidopsis clock gene TOC1, an autoregulatory response regulator homolog. Science 289:768–771 Su´arez-L´opez P, Wheatley K, Robson F, Onouchi H, Valverde F, Coupland G (2001) CONSTANS mediates between the circadian clock and the control of flowering in Arabidopsis. Nature 410:1116– 1120 Takada S, Goto K (2003) TERMINAL FLOWER2, an Arabidopsis homolog of HETEROCHROMATIN PROTEIN1, counteracts the activation of FLOWERING LOCUS T by CONSTANS in the vascular tissues of leaves to regulate flowering time. Plant Cell 15:2856–2865 Valverde F, Mouradov A, Soppe W, Ravenscroft D, Samach A, Coupland G (2004) Photoreceptor regulation of CONSTANS protein in photoperiodic flowering. Science 303:1003–1006 Wigge PA, Kim MC, Jaeger KE, Busch W, Schmid M, Lohmann JU, Weigel D (2005) Integration of spatial and temporal information during floral induction in Arabidopsis. Science 309:1056–1059 Yoo SK, Chung KS, Kim J, Lee JH, Hong SM, Yoo SJ, Yoo SY, Lee JS, Ahn JH (2005) CONSTANS activates SUPPRESSOR OF EXPRESSION OF CONSTANS 1 through FLOWERING LOCUS T to promote flowering in Arabidopsis. Plant Physiol 139:770–778
Springer
