Overexpression of theskNACgene in human rhabdomyosarcoma cells ...

Clin Exp Metastasis (2014) 31:869–879 DOI 10.1007/s10585-014-9676-z

Overexpression of the skNAC gene in human rhabdomyosarcoma cells enhances their differentiation potential and inhibits tumor cell growth and spreading Janine Berkholz • Weronika Kuzyniak Michael Hoepfner • Barbara Munz

•

Received: 2 May 2014 / Accepted: 13 August 2014 / Published online: 11 September 2014 Ó Springer Science+Business Media Dordrecht 2014

Abstract Skeletal and heart muscle-specific variant of the alpha subunit of nascent polypeptide complex (skNAC) is exclusively present in striated muscle cells. During skeletal muscle cell differentiation, skNAC expression is strongly induced, suggesting that the protein might be a regulator of the differentiation process. Rhabdomyosarcoma is a tumor of skeletal muscle origin. Since there is a strong inverse correlation between rhabdomyosarcoma cell differentiation status and metastatic potential, we analyzed skNAC expression patterns in a set of rhabdomyosarcoma cell lines: Whereas RD/12 and RD/18 cells showed a marked induction of skNAC gene expression upon the induction of differentiation—similarly as the one seen in nontransformed myoblasts—skNAC was not induced in CCA or Rh30 cells. Overexpressing skNAC in CCA and Rh30 cells led to a reduction in cell cycle progression and cell proliferation accompanied by an upregulation of specific myogenic differentiation markers, such as Myogenin or Myosin Heavy Chain. Furthermore, in contrast to vectortransfected controls, a high percentage of the cells formed long, Myosin Heavy Chain-positive, multinucleate myotubes. Consistently, soft agar assays revealed a drop in the metastatic potential of skNAC-overexpressing cells. Taken together, these data indicate that reconstitution of skNAC expression can enhance the differentiation potential of rhabdomyosarcoma cells and reduces their metastatic J. Berkholz W. Kuzyniak M. Hoepfner Charite´ – University Medicine Berlin, Institute of Physiology, Charite´platz 1, 10117 Berlin, Germany B. Munz (&) Department of Sports Medicine, Medical Clinic, University Hospital Tubingen, Hoppe-Seyler-Str. 6, 72076 Tu¨bingen, Germany e-mail: [email protected]

potential, a finding which might have important therapeutic implications. Keywords skNAC Rhabdomyosarcoma Myogenic differentiation Metastasis

Introduction Rhabdomyosarcoma is the most common sporadic softtissue sarcoma of childhood. Because of the fact that rhabdomyosarcoma cells share many characteristics with skeletal muscle cells, it is assumed that they might originate from mesenchymal stem cells of the myogenic lineage. One specific feature is that they are rarely found in skeletal muscle tissue itself, but particularly in the headneck-region, in the extremities and in the genitourinary system. Based on histopathological findings, two different types, embryonal and alveolar rhabdomyosarcoma, have been described. In addition, specific chromosomal translocations and deletions have been identified that are often associated with rhabdomyosarcomas of both types [for review, see 1, 2]. Despite considerable progress within the last few years, therapeutic options, especially for high-risk patients, are still limited [3]. As early as in 1991, Lollini et al. [4] could demonstrate a strict inverse correlation between differentiation status and metastatic ability of rhabdomyosarcoma cells. Thus, potential therapeutic strategies might aim at increasing the differentiation potential of these cells. NAC (nascent polypeptide associated complex) is a heterodimeric protein complex consisting of a 33 kD a and a 21 kD b subunit [5]. The protein plays a role in regulating assembly and targeting of nascent polypeptide chains just emerging from the ribosome [for review, see 6].

123

870

Clin Exp Metastasis (2014) 31:869–879

Table 1 Characteristics of the rhabdomyosarcoma cell lines analyzed in this study Cell line

RD/ 18

Same clonal origin

Cell type

Origin

Embryonal rhabdomyosarcoma cells

Human

RD/ 12


Human

CCA


Human

Alveolar rhabdomyosarcoma cells

Human

Rh30

Differentiation behaviour Morphology

Expression of differentiation markers

Fuse and form myotubes

Myogenin p21

Metastatic behaviour

References

Low metastatic potential

Lollini et al. [4]

Desmin Do not form myotubes

Vimentin

Form metastases


Vimentin

Myogenin

Otten et al. [8]

Form metastases

De Giovanni et al. [13]

Form metastases

Douglass et al. [14]


Astolfi et al. [9]

Desmin

Thulasi et al. [15] Miekus et al. [16]

Summary of differentiation and metastatic characteristics of the four rhabdomyosarcoma cell lines used in this study

In skeletal and heart muscle tissue, a specific splice variant of the aNAC subunit is also known: skNAC (skeletal and heart muscle specific variant of aNAC) is generated by splicing-in of a large additional exon in between the aNACspecific amino- and carboxyterminal coding regions, thus generating a large, 220 kD, proline-rich protein [7]. Since in normal myogenesis, skNAC expression is strongly upregulated, we hypothesized that rhabdomyosarcoma cells might show a defect with respect to skNAC gene expression. In this study, we analyzed skNAC expression in selected, well-characterized rhabdomyosarcoma cell lines, the three embryonal cell lines RD/12, RD/18, and CCA, and the alveolar cell line Rh30. As shown previously, these cell lines display different differentiation characteristics (Table 1): Whereas RD/18 cells express Myogenin, fuse, and form multinucleate myotubes, RD/12 cells, which originate from the same clonal background, are Vimentin- and Desminpositive, but do not express specific myogenic differentiation markers [4, 8, 9] when cultured in differentiation medium alone. However, they can be induced to express markers of terminal myogenic differentiation when forced to express high levels of Myogenin [10], and differentiation of RD cells can generally be pushed forward by treatment with specific agents, such as 12-O-tetradecanoyl phorbol-13-acetate (TPA) [11]. Furthermore, RMS cells can be forced into terminal differentiation by specifically blocking the expression of certain pro-neoplastic genes [12]. CCA cells express Desmin, a minority of cells are also positive for embryonic myosin and display an elongated shape, however, somatic fusion is not observed in vitro [13]. Rh30 cells [14] express Myogenin and low levels of Skeletal Muscle Myosin [15].

123

Except for RD/18 cells, which are characterized by a low metastatic potential, all of the cell lines are known to be highly metastatic [4, 13, 16–18]. Our hypothesis was that the differentiation defects seen in rhabdomyosarcoma cells might, at least in part, be due to low or absent skNAC expression. We speculated that if this was the case, engineering the cells to re-express skNAC might enhance their differentiation potential and thus decrease their metastatic potential, which might open novel therapeutic perspectives.

Materials and methods Cell culture Human RD/12, RD/18, CCA (Pier-Luigi Lollini and Lorena Landuzzi, University of Bologna), and Rh30 cells (ATCC ATCCÒ CRL-2061TM) (Table 1), were grown in Dulbecco’s modified Eagle’s medium containing 10 % fetal bovine serum (FBS) (growth medium) at 37 °C and 5 % CO2. To induce differentiation, cells were grown to 80 to 90 % confluence and then switched to differentiation medium (Dulbecco’s modified Eagle’s medium containing 2 % horse serum). Transfection with skNAC expression vectors For overexpression of full-length skNAC, the plasmid pCIskNAC [7] was used in combination with the ‘‘TurboFect’’ reagent (Fermentas) according to the manufacturer’s instructions. Transfection efficiency was controlled with a

Clin Exp Metastasis (2014) 31:869–879 Table 2 qPCR primers

Summary of all qPCR primers used in this study

Gene name

871 Forward primer (50 ?30 )

Reverse primer (50 ?30 )

a sarcomeric Actin

AGGGCCAGAGTCAGAGCAGCA

GGGGCATCATCCCCGGCAAA

Calpain 1

CCGGGACTTCATACGTGAGT

AGGTGCCCTCGTAAAATGTG

Desmin

TCCTCCTACCGCCGCACCTT

ACCGAAGCCTGCTCGAGGGA

MyoD

AGCATAGTGGAGCGCATCTC

GGTCTGGGTTCCCTGTTCTG

Myogenin

TGGGTGTGCATGTGAGCCCC

CGCTGGGCTGGGTGTTAGCC

SIRT1

TTGGCACCGATCCTCGAAC

CCCAGCTCCAGTCAGAACTAT

skNAC

CTCTAAACCCCTTGCCCCTG

TCGTAACAGGTTGCTTGGCA

Green Fluorescent Protein expression vector and was 40–50 % in all experiments.

Table 3 Antibodies Antibody

Company

Cat. no

RNA isolation

a sarcomeric Actin

Abcam (clone 5C5)

ab49672

Total cellular RNA from cultured cells was extracted with the RNeasy RNA isolation kit (Qiagen) according to the manufacturer’s instructions.

a-Tubulin

Cell signaling (11H10)

2125

Calpain 1

Cell signaling

2556

CyclinD2

Cell signaling

2924

Desmin

Abcam

ab15200

Ki-67

DCS innovative diagnostic

KI68IR06

MyHC (recognizes a and b chains of skeletal and cardiac myosins)

Novus (clone 3–48)

NB300-284

MyoD

Novocastra

MYOD1

Myogenin

Abcam (F5D)

ab1835

p21

Santa Cruz (F-5)

sc-6246

SIRT1

Santa Cruz (H-300)

sc-15404

skNAC

polyclonal rabbit antiserum

–

Vimentin

Abcam (VI-10)

ab20346

Northern blot analysis Northern blot analysis was carried out as previously described [19]. For the detection of the skNAC transcript, a 453 bp digoxigenin-labeled riboprobe corresponding to the human skNAC sequence [20] was employed. Concentration of the 28S rRNA transcript was analyzed as a control for equal loading. qPCR Semi-quantitative real time PCR analysis was carried out using the Rotor Gene 2000 cycler (LTF, Wasserburg, Germany). Gene expression was analyzed using the GoTaq qPCR Master Mix (Promega). For the detection of skNAC, MyoD SIRT1 (Sirtuin 1), and Calpain 1, self- and pre-designed primers (Qiagen QuantiTect Primer Assays) were used. For the detection of Myosin Heavy Chain type I (MyHCI), only pre-designed primers were employed. Primer Sequences are displayed in Table 2. In each experiment, melting curve analysis was performed to verify that a single transcript was produced. RT-qPCR relative gene expression was calculated using the comparative CT (2-DDC ) T method, where expression was normalized to GAPDH. NonRT- and non-template controls were run for all reactions. Unless otherwise specified, data from at least three independent experiments were expressed as mean ± SEM, n = 3–5. Significance was accepted at p \ 0.05. Preparation of protein lysates and Western blot analysis Cultured cells were lysed in lysis buffer (1 % Triton X-100, 20 mM Tris–HCl pH 8.0, 137 mM NaCl, 10 %

Summary of all primary antibodies used for Western Blot and immunofluorescence

glycerol, 2 mM EDTA pH 8.0). 20–40 micrograms of total protein were loaded on a sodium dodecyl sulfate–polyacrylamide gel and transferred to nitrocellulose membranes. Membranes were pre-blocked in 3 % powdered milk in Tris-buffered saline containing 0.5 % Tween 20 (TBS-T) for 30 min; incubated with a dilution of the first antibody (for a summary of all antibodies used in this study, see Table 3) in blocking solution for at least 1 h, washed three times with TBS-T; incubated for 30 min with a 1:5,000 dilution of the second antibody, a peroxidaseconjugated monoclonal anti rabbit or anti mouse antibody (Amersham) in blocking solution; washed three times with TBS-T; and developed with the ECL Western blot detection system (Amersham). All blots were reprobed with an antibody directed against a-Tubulin as a control for equal loading. All immunoblots were performed at least three times with samples from at least three independent transfections.

123

872

Immunofluorescence Immunofluorescence was carried out as previously described [19], for a summary of all antibodies used in this study, see Table 3. BrdU (5-bromo-20 -deoxyuridine) ELISA 24 h after transfection, cell proliferation was evaluated using a colorimetric cell proliferation BrdU-ELISA (Roche Applied Science) according to the manufacturer’s instructions. The incubation time was 5 h. Experiments were carried out in triplicates and repeated at least three times. Determination of Caspase-3 activity Changes in Caspase-3 activity were calculated from cleavage of the fluorogenic substrate AC-DEVD-AMC (Ac-Asp-Glu-Val-Asp-AMC (AMC = 7-amino-4-methylcoumarin); Calbiochem-Novabiochem, Bad Soden, Germany), as described previously [21]. In brief, cell lysates were prepared after culturing the cells in differentiation medium for 48 h. Subsequently, lysates were incubated for 1 h at 37 °C with a substrate solution containing 20 lg/ml AC-DEVD-AMC, 20 mM HEPES, 10 % glycerol, 2 mM DTT, pH 7.5. Substrate cleavage was measured fluorometrically using a VersaFluor fluorometer (filter wavelengths: excitation: 360/40 nm, emission: 460/10 nm) from Bio-Rad (Munich, Germany). Experiments were carried out in triplicates and repeated at least three times.


(Fig. 1a). It should be mentioned that the term ‘‘differentiation’’ is used here in general when referring to cells cultured in differentiation medium (DMEM containing 2 % horse serum), although, as explained in more detail in the introduction, it should be pointed out that most rhabdomyosarcoma cell lines undergo only incomplete differentiation, at least when cultured in differentiation medium alone. Subsequently, skNAC expression levels were analyzed at both the RNA and—for Rh30 cells—at the protein level at different time points. As shown in Fig. 1b, the skNAC gene was only expressed at low levels in proliferating rhabdomyosarcoma cells. After the induction of myogenic differentiation by low-serum medium containing only 2 % horse serum, strong induction of skNAC expression, similarly as in non-transformed myoblasts [7, 20, 22], was observed in both RD/12 and RD/18 cells. By contrast, hardly any skNAC induction could be detected in CCA and Rh30 cells. These data suggest that certain rhabdomyosarcoma cells do not upregulate expression of the skNAC gene in differentiation medium, whereas others show a pretty much normal skNAC expression kinetics, similar to the one observed in non-tumorigenic myoblasts, such as C2C12 cells or primary human myoblasts [7, 20, 22]. Interestingly, in Rh30 cells, induction of skNAC expression was more pronounced at the protein level than at the RNA level (however, still low when compared to RD/18 cells). This could be due to translational regulation or stabilization of the skNAC protein with proceeding differentiation. Overexpression of the skNAC gene in rhabdomyosarcoma cells

Soft agar assay 48 h after transfection, a total of 2 9 105 cells were suspended in 2 ml of DMEM/10 % FBS containing 0.35 % Noble agar (Sigma Aldrich). Cells were plated in triplicate on a layer of 2 ml 0.7 % Noble agar in DMEM/10 % FBS onto a 6 mm culture dish. Cells were cultured at 37 °C and fresh medium was added every 5 days. After 30 days, all colonies were stained with 0.05 % crystal violet and counted using a phase contrast microscope. Two independent experiments were carried out.

From this background, we speculated that overexpression of the skNAC gene in rhabdomyosarcoma cells might enhance the cells’ differentiation potential, thereby reducing their metastatic ability. To test this hypothesis, we overexpressed the full-length skNAC gene in Rh30 and in CCA cells. As shown in Fig. 2, at the mRNA level, we achieved a strong expression of the recombinant cDNA in both cell lines. For the Rh30 cell line, this was also confirmed at the protein level, both via Western Blot and immunofluorescence analysis (Fig. 2).

Results

skNAC overexpression reduces proliferation and induces apoptosis in rhabdomyosarcoma cells

Specific rhabdomyosarcoma cell lines lack inducible skNAC expression All rhabdomyosarcoma cell lines (Table 1) were induced to differentiate in vitro and differentiation was monitored microscopically and via analysis of specific differentiation markers, such as Desmin, Vimentin, and Myogenin

123

When culturing equal numbers of skNAC-overexpressing cells and vector controls for 48 h in differentiation medium, we observed much lower cell densities for the skNACoverexpressing cells when compared to the vector controls (Fig. 3a). These differences might reflect decreased cell proliferation, increased apoptosis, or both. Thus, we next studied the question whether skNAC overexpression has an


873

Fig. 1 skNAC expression kinetics in rhabdomyosarcoma cells after the induction of differentiation. a The four rhabdomyosarcoma cell lines RD/12, RD/18, CCA, and Rh30 were induced to differentiate in vitro. Histological pictures were taken and Desmin, Vimentin, and Myogenin expression was analyzed by Western blot at the indicated time points. b skNAC expression kinetics in proliferating cells and after the induction of differentiation were analyzed at the indicated time points at the RNA (Northern blot, top panels) and at the protein level (Western blot, bottom panels) as depicted. As a marker for myogenic differentiation, Myogenin expression was also analyzed at the protein level (bottom panels)

effect on rhabdomyosarcoma cell proliferation and apoptosis. For this purpose, the proliferation rate of Rh30 cells overexpressing full-length skNAC as well as of vectortransfected and non-transfected controls was determined by BrdU pulse labeling. As shown in Fig. 3b, we found that Rh30 cells engineered to express high levels of the skNAC gene were characterized by an around 40 % lower proliferation rate when compared to the respective control cells. Consistently, expression of the proliferation marker Ki-67 and the cell cycle-promoting Cyclin D2 gene was reduced at the protein level, whereas expression of the gene encoding the cell cycle inhibitor p21 was enhanced

(Fig. 3a). These data indicate that skNAC indeed inhibits rhabdomyosarcoma cell cycle progression and cell proliferation. Further exploring possible pro-apoptotic effects of skNAC overexpression by Caspase-3 measurements, we found that the skNAC-overexpressing cells exhibited an approximately 50 % increased apoptosis rate when compared to vector-transfected controls (Fig. 3c). As a control for potential unspecific effects, we overexpressed the unrelated Lrp6 gene in the cells, since recent data generated in the Rh30 cell line suggest a role of this protein and the Wnt signalling pathway in general in rhabdomyosarcoma pathogenesis [23], however, there is no known link

123

874


Fig. 2 Overexpression of the skNAC gene in rhabdomyosarcoma cells. The full-length skNAC gene was overexpressed in the rhabdomyosarcoma cell lines CCA and Rh30. skNAC expression was analyzed at the RNA (top panels; *p \ 0.05) and—for Rh30 cells—

also at the protein level (Western blot, immunofluorescence, bottom panels) as indicated. To demonstrate specificity of the staining, a negative control (2nd antibody only) is shown as indicated

between skNAC and the Wnt pathway. We found that proliferation was enhanced and the degree of apoptosis was unaltered in Lrp6-overexpressing cells (Fig. 3b, c), suggesting that the observed effects on cell proliferation and apoptosis were indeed due to skNAC overexpression, and not only the unspecific results of the production of high levels of a recombinant protein in these cells in general.

protein level, a broad variety of myogenic differentiation markers, such as MyHC or MyoD, was induced in the Rh30 cells engineered to express high levels of skNAC (Fig. 4c). By contrast, expression of the SIRT 1 gene, which might be an skNAC target (J. Berkholz and B. Munz, unpublished results) was suppressed in skNAC-transfected Rh30 cells (Fig. 4a, c). When the transfected cells were analyzed for expression of the MyHC and a sarcomeric Actin genes via immunofluorescence, we found that Rh30 cells engineered to express high levels of skNAC formed long, MyHC- and a sarcomeric Actin-positive myocytes and even small, multinucleate myotubes, whereas this was not observed in the corresponding control cells (Fig. 4d). These data indicate that overexpression of the skNAC gene can indeed enhance the differentiation potential of CCA and Rh30 rhabdomyosarcoma cells.

skNAC overexpression stimulates expression of myogenic differentiation markers in rhabdomyosarcoma cells In contrast to control, vector-transfected Rh30 cells, the skNAC-overexpressing cells formed long, spindle-shaped structures resembling myocytes or myotubes when incubated in differentiation medium (Fig. 3a). To decipher whether overexpression of skNAC in CCA and/or Rh30 cells influences the cells’ differentiation potential, we analyzed the expression of specific myogenic differentiation markers in both the skNAC-transfected cells and the respective controls, at both the mRNA and the protein level. As shown in Fig. 4a, b, upregulation of a broad range of differentiation markers was observed in both cell lines. Specifically, we found that expression of the genes encoding the myogenic transcription factor myogenin and the MyHC I gene were upregulated in both cell lines when engineered to overexpress skNAC. Correspondingly, at the

123

skNAC overexpression reduces the metastatic potential of rhabdomyosarcoma cells To study the question whether skNAC overexpression affects the metastatic potential of rhabdomyosarcoma cells, skNAC-overexpressing Rh30 cells were tested in a classical soft agar assay. As shown in Fig. 5, using this approach, we found that the number of colonies forming in soft agar was reduced by approximately 75 % upon skNAC overexpression. These results suggest that reconstituting skNAC


875

Fig. 3 Determination of cell proliferation and apoptosis rates after transfection with skNAC expression vectors. a Rh30 cells were transfected with the skNAC expression plasmid and incubated in differentiation medium for 48 h (for histological pictures, see top panels). Subsequently, they were analyzed for cell proliferation using BrdU pulse labeling, and expression analysis of the genes encoding the proliferation marker Ki-67, and the cell cycle-regulatory proteins Cyclin D2 and p21 was carried out. b Cellular apoptosis was determined using the Caspase-3 activity assay. As a control for potential unspecific effects, Rh30 cells overexpressing an unrelated gene (Lrp6) were also analyzed in all assays. BrdU incorporation and relative Caspase-3 activity were calculated by normalization to untreated control (ctrl DM) values. Data are expressed as mean ± SEM (n = 3). *p \ 0.05

expression in rhabdomyosarcoma cells can reduce their metastatic potential. This might be due to decreased Calpain activities, since we could previously show that skNAC regulates myoblast migration by influencing Calpain 1 and 3 gene expression [24], and since we found decreased Calpain 1 expression in skNAC-overexpressing Rh30 cells (Fig. 6).

Discussion In the present study, we analyzed skNAC expression kinetics after the induction of myogenic differentiation in various rhabdomyosarcoma cell lines. We could show that

whereas certain rhabdomyosarcoma cell lines, specifically the RD/12 and RD/18 cells, showed a pretty normal skNAC expression kinetics resembling the one seen in nontumorigenic myoblasts such as C2C12 cells or primary human myoblasts [7, 20, 22], others, specifically CCA and Rh30 cells, were unable to upregulate skNAC expression upon a differentiation stimulus. Since specifically RD/12 cells are characterized by a very low differentiation potential, whereas their clonal variant RD/18 differentiates comparatively well along the myogenic lineage, there does not seem to be a direct correlation between a particular rhabdomyosarcoma cell’s differentiation potential and its ability to upregulate skNAC expression after the induction of differentiation.

123

876 Fig. 4 Characterization of myogenic differentiation in skNAC-overexpressing rhabdomyosarcoma cells. Rh30 cells (a, c), and CCA cells (b) engineered to express high levels of skNAC and induced to differentiate for 72 h were analyzed for expression of specific myogenic differentiation markers at both the mRNA and the protein level as indicated. (d) Transfected cells and controls were differentiated for 96 h, fixed and analyzed for total MyHC and a sarcomeric Actin expression via immunofluorescence. Representative pictures of at least n = 3 independent experiments are shown. *p \ 0.05

123



Fig. 5 Analysis of the metastatic potential of skNAC-overexpressing rhabdomyosarcoma cells. Rh30 cells transfected with the skNAC expression vector and vector-transfected controls were analyzed in a soft agar assay. Note the lower number of colonies formed by the

877

skNAC-overexpressing cells. Bars represent the averages of two independent experiments. Error bars represent standard deviations. *p \ 0.05

Fig. 6 Calpain 1 expression in skNAC-overexpressing Rh30 cells. Calpain 1 expression was analyzed at the mRNA and at the protein level in skNACoverexpressing cells and vectortransfected controls as indicated

In addition, the fact that both the embryonal rhabdomyosarcoma cell line CCA and the alveolar rhabdomyosarcoma cell line Rh30 were defective in skNAC induction upon a differentiation stimulus indicates that there might also be no correlation between rhabdomyosarcoma histotype and the regulation of skNAC expression. These data suggest that reconstitution of skNAC expression might not be sufficient to push rhabdomyosarcoma cells in general towards terminal myogenic differentiation. Moreover, this is unlikely, given the finding that overexpression of skNAC in C3H10T1/2 embryonic fibroblasts has no effect on these cells, suggesting that unlike the myogenic transcription factors of the bHLH family, skNAC can not independently induce all aspects of the myogenic differentiation program [7]. However, the

protein might promote specific aspects of the differentiation program in particular cell lines. When we overexpressed the skNAC gene in CCA and in Rh30 cells, we found that cell proliferation was reduced. This finding indicates that high levels of skNAC protein might be a prerequisite for the cells’ ability to exit the cell cycle and enter the myogenic differentiation program. Surprisingly, blocking skNAC expression in non-tumorigenic myoblasts had no effect on the cells’ proliferation rate after serum withdrawal [22], indicating that skNAC is not required for the differentiation-associated proliferation arrest in these cells. In addition, we could detect enhanced apoptosis in the cells overexpressing skNAC. Since resistance to the apoptosis-inducing action of chemotherapeutics is a major

123

878

problem in the treatment of rhabdomyosarcoma [for review, see 25], this might have interesting clinical implications. Finally, the fact that rhabdomyosarcoma cells engineered to express high levels of skNAC showed enhanced differentiation indicates that the differentiation defects seen in these cells are at least in part related to low skNAC levels. It is possible that the re-introduction of this factor, which operates at the transition between early and later stages of myogenesis, allows later differentiation steps, such as Myogenin expression, to proceed normally, regardless of the potential absence of more upstream differentiation factors, which might also be missing in these cells. Interestingly, expression of the gene encoding the class III histone deacetylase SIRT1 was reduced in Rh30 cells engineered to express high levels of the skNAC gene. Since (a) skNAC and its binding partners are involved in the regulation of histone methylation and acetylation (J. Berkholz and B. Munz, manuscript in preparation), since (b) skNAC regulates the expression of the gene encoding the class II transactivator CIITA (J. Berkholz and B. Munz, unpublished results), which, in response to interferon c signaling, inhibits SIRT1 [26] and modulates myogenesis [27], and since (c) CIITA has been shown to be silenced in rhabdomyosarcoma cells by epigenetic mechanisms [28], this suggests the existence of an skNAC-CIITA-SIRT1 axis which might be disrupted in rhabdomyosarcoma cells. Finally, since high SIRT1 levels are associated with poor prognosis of soft tissue sarcomas [29], this might be an interesting aspect on which further research should focus in the future. Based on these findings, we speculated that the metastatic potential of the skNAC-overexpressing rhabdomyosarcoma cells might also be reduced. This appears to be indeed the case, since these cells formed a much lower number of colonies in soft agar when compared to controls. This is a first evidence that reconstitution of skNAC expression might reduce the metastatic potential of rhabdomyosarcoma cells, which should, in the future, be verified in animal cell transplantation studies. Interestingly, Roumes et al. [30] could show that rhabdomyosarcoma cells are characterized by enhanced migration velocities, correlating with metastatic behavior and a disorganized cytoskeleton, and that this migratory activity is the result of enhanced activity of calcium-dependent proteases of the Calpain superfamily. Consistently, we could previously demonstrate that skNAC-depleted, non-transformed myoblasts were characterized by strongly increased migration rates as a result of increased Calpain gene expression and Calpain activity, accompanied by disorganized sarcomeres [24], and we show here that skNAC-overexpressing Rh30 cells are also characterized by decreased Calpain 1 expression. These data suggest that low skNAC levels in certain rhabdomyosarcoma cells might result in high

123


Calpain activities, promoting cell migration and metastatic activity. Taken together, our data suggest that re-introduction of skNAC into at least some rhabdomyosarcoma cell types can inhibit their proliferation rate, induce apoptosis and enhance the cells’ differentiation potential, which results in reduced metastasis. These findings might have important clinical implications and should therefore be reproduced in suitable in vivo models as a next step. Acknowledgments We thank Lorena Landuzzi and Pier-Luigi Lollini, University of Bologna, for RD/12, RD/18, and CCA cells, Rene´ St.-Arnaud, McGill University, Montre´al, for pCI-skNAC, and Sabine Schleicher, University Hospital Tubingen, for help with Rh30 cell culture and helpful discussions. This project was specifically funded by the Deutsche Forschungsgemeinschaft (GRK1631—Myograd), and the German Foundation for Cardiac Research (DSHF). Work in the authors’ laboratory is furthermore supported by grants from the the German Research Foundation (DFG Mu 1556/5-1), the intramural fortune program of the Tubingen University Medical Clinic, and a grant from the Friede-Springer-Herz-Stiftung (to B.M.). Conflict of interest

The authors declare no conflict of interest.

References 1. Xia SJ, Pressey JG, Barr FG (2002) Molecular pathogenesis of rhabdomyosarcoma. Cancer Biol Ther 1:97–104 2. De Giovanni C, Landuzzi L, Nicoletti G, Lollini P-L, Nanni P (2009) Molecular and cellular biology of rhabdomyosarcoma. Fut Oncol 5:1449–1475 3. Breitfeld PP, Meyer WH (2005) Rhabdomyosarcoma: new windows of opportunity. Oncologist 10:518–527 4. Lollini P-L, De Giovanni C, Landuzzi L, Nicoletti G, Scotlandi K, Nanni P (1991) Reduced metastatic ability of in vitro differentiated human rhabdomyosarcoma cells. Inv Metast 11:116–124 5. Wiedmann B, Sakai H, Davis TA, Wiedmann M (1994) A protein complex required for signal-sequence-specific sorting and translocation. Nature 370:434–440 6. Preissler S, Deuerling E (2012) Ribosome-associated chaperones as key players in proteostasis. Trends Biochem Sci 37:74–83 7. Yotov WV, St-Arnaud R (1996) Differential splicing-in of a proline-rich exon converts alpha NAC into a muscle-specific transcription factor. Genes Dev 10:1763–1772 8. Otten A, Firpo E, Gerber A, Brody L, Roberts J, Tapscott S (1997) Inactivation of MyoD-mediated expression of p21 in tumor cell lines. Cell Growth Diff 8:1151–1160 9. Astolfi A, De Giovanni C, Landuzzi L, Nicoletti G, Ricci C, Croci S, Scopece L, Nanni P, Lollini P-L (2001) Identification of new genes related to the myogenic differentiation arrest of human rhabdomyosarcoma cells. Gene 274:139–149 10. Nanni P, Nicoletti G, Palladini A, Astolfi A, Rinella P, Croci S, Landuzzi L, Monduzzi G, Stivani V, Antognoli A, Murgo A, Ianzano M, De Giovanni C, Lollini PL (2009) Opposing control of rhabdomyosarcoma growth and differentiation by myogenin and interleukin 4. Mol Cancer Ther 8:754–761 11. Aguanno S, Bouche` M, Adamo S, Molinaro M (1990) 12-Otetradecanoylphorbol-13-acetate-induced differentiation of a human rhabdomyosarcoma cell line. Cancer Res 50:3377–3382 12. Avirneni-Vadlamudi U, Galindo KA, Endicott TR, Paulson V, Cameron S, Galindo RL (2012) Drosophila and mammalian models uncover a role for the myoblast fusion gene TANC1 in rhabdomyosarcoma. J Clin Invest 122:403–407

Clin Exp Metastasis (2014) 31:869–879 13. De Giovanni C, Nanni P, Nicoletti G, Ceccarelli C, Scotlandi K, Landuzzi L, Lollini P-L (1989) Metastatic ability and differentiative properties of a new cell line of human embryonal rhabdomyosarcoma (CCA). Anticancer Res 9:1943–1949 14. Douglass EC, Valentine M, Etcubanas E, Parham D, Webber BL, Houghton PJ, Houghton JA, Green AA (1987) A specific chromosomal abnormality in rhabdomyosarcoma. Cytogenet Cell Genet 45:148–155 15. Thulasi R, Dias P, Houghton PJ, Houghton JA (1996) a2aInterferon-induced differentiation of human alveolar rhabdomyosarcoma cells: correlation with down-regulation of the insulin-like growth factor type I receptor. Cell Growth Diff 7:531–541 16. Miekus K, Lukasiewicz E, Jarocha D, Sekula M, Drabik G, Majka M (2013) The decreased metastatic potential of rhabdomyosarcoma cells obtained through MET receptor downregulation and the induction of differentiation. Cell Death Dis 4:e459. doi:10.1038/cdds.2012.199 17. Rees H, Williamson D, Papanastasiou A, Jina N, Nabarro S, Shipley J, Anderson J (2006) The MET receptor tyrosine kinase contributes to invasive tumor growth in rhabdomyosarcomas. Growth Factors 24:197–208 18. Rapa E, Hill SK, Morten KJ, Potter M, Mitchell C (2012) The over-expression of cell migratory genes in alveolar rhabdomyosarcoma could contribute to metastatic spread. Clin Exp Metast 29:419–429 19. Munz B, Hildt E, Springer ML, Blau HM (2002) RIP2, a checkpoint in myogenic differentiation. Mol Cell Biol 22:5879– 5886 20. Munz B, Wiedmann M, Lochmu¨ller H, Werner S (1999) Cloning of novel injury-regulated genes. Implications for an important role of the muscle-specific protein skNAC in muscle repair. J Biol Chem 274:13305–13310 21. Gloesenkamp C, Nitzsche B, Lim AR, Normant E, Vosburgh E, Schrader M, Ocker M, Scheru¨bl M, Ho¨pfner M (2012) Heat

879

22.

23.

24.

25. 26.

27.

28.

29.

30.

shock protein 90 is a promising target for effective growth inhibition of gastrointestinal neuroendocrine tumors. Int J Oncol 40:1659–1667 Berger F, Berkholz J, Breustedt T, Ploen D, Munz B (2012) Skeletal muscle-specific variant of nascent polypeptide associated complex alpha (skNAC): implications for a specific role in mammalian myoblast differentiation. Eur J Cell Biol 91:150–155 Annavarapu SR, Cialfi S, Dominici C, Kokai GK, Uccini S, Ceccarelli S, McDowell HP, Helliwell TR (2013) Characterization of Wnt/b-catenin signaling in rhabdomyosarcoma. Lab Invest 93:1090–1099 Berkholz J, Zakrzewicz A, Munz B (2013) skNAC depletion stimulates myoblast migration and perturbs sarcomerogenesis by enhancing calpain 1 and 3 activity. Biochem J 453:303–310 Fulda S (2008) Targeting apoptosis resistance in rhabdomyosarcoma. Curr Cancer Drug Targets 8:536–544 Li P, Zhao Y, Wu X, Xia M, Fang M, Iwasaki Y, Sha J, Chen Q, Xu Y, Shen A (2012) Interferon gamma (IFN-c) disrupts energy expenditure and metabolic homeostasis by suppressing SIRT1 transcription. Nucl Acids Res 40:1609–1620 Londhe P, Davie J (2011) Gamma interferon modulates myogenesis through the major histocompatibility complex class II transactivator, CIITA. Mol Cell Biol 31:2854–2866 Londhe P, Zhu B, Abraham J, Keller C, Davie J (2012) CIITA is silenced by epigenetic mechanisms that prevent the recruitment of transactivating factors in rhabdomyosarcoma cells. Int J Cancer 131(4):E437–E448. doi:10.1002/ijc.26478 Kim JR, Moon YJ, Kwon KS, Bae JS, Wagle S, Yu TK, Kim KM, Park HS, Lee J-H, Moon WS, Lee H, Chung MJ, Jang KY (2013) Expression of SIRT1 and DBC1 is associated with poor prognosis of soft tissue sarcomas. PLoS ONE 8(9):e74738. doi:10.1371/journal.pone.0074738 Roumes H, Leloup L, Dargelos E, Brustis J-J, Daury L, Cottin P (2010) Calpains: markers of tumor aggressiveness? Exp Cell Res 316:1587–1599

123