Letters to the Editor
842 perhaps through the activity of executioner caspase proteases. Interestingly, time-dependent downregulation of Mcl-1 paralleled caspase-3 activation described previously, and when ALCL cells were exposed to bortezomib for 24 h, Mcl-1 was completely degraded unless the cells were pre-treated with the broad-range caspase-inhibitor z-VAD-fmk (Figure S4B, SR786 and FE-PD). Consistently, Mcl-1 associated to Bak in the mitochondria of untreated ALCL cells, but this complex was disrupted when the cells were cultivated in the presence of bortezomib, unless z-VAD-fmk caspase inhibitor was added before bortezomib (Figure S4C, FE-PD). These data support the hypothesis that late Mcl-1 downregulation observed in ALCL cell lines occurs downstream of caspase activation, and the inability of the proteasome inhibitor bortezomib to affect steady state and function of Mcl-1 in SUDHL1 or KARPAS299 cells would depend on the level of activated caspases. In conclusion, this study underlines for the first time the effectiveness of bortezomib to induce, at clinically achievable concentrations, growth inhibition and apoptosis in ALCL cells in vitro, regardless of the expression and activity of NPM-ALK protein, and suggests that targeting 26S proteasome may represent a novel therapeutic strategy for ALCLs, especially for those that do not express ALK and are associated with worse prognosis.
Acknowledgements The authors thank Millenniium Pharmaceutical Inc., Cambridge, MA, USA, for the kind gift of bortezomib; S Disaro`, Department of Pediatrics, University of Padova, for the flow cytometry analysis. This research was supported by Fondazione Citta` della Speranza and by MIUR (Ministero Istruzione Universita` e Ricerca). PB is supported by IOV (Istituto Oncologico Veneto).
P Bonvini, E Zorzi, G Basso and A Rosolen Hematology and Oncology Clinic of Pediatrics, Azienda Ospedaliera-University of Padova, Padova, Italy E-mail:
[email protected]
References 1 Adams J. The proteasome: a suitable antineoplastic target. Nat Rev Cancer 2004; 4: 349–360. 2 Boccadoro M, Morgan G, Cavenagh J. Preclinical evaluation of the proteasome inhibitor bortezomib in cancer therapy. Cancer Cell Int 2005; 5: 1–9. 3 Pulford K, Morris SW, Turturro F. Anaplastic lymphoma kinase proteins in growth control and cancer. J Cell Physiol 2004; 199: 330–358. 4 Zheng B, Georgakis GV, Li Y, Bharti A, McConkey D, Aggarwal B B et al. Induction of cell cycle arrest and apoptosis by the proteasome inhibitor PS-341 in Hodgkin disease cell lines is independent of inhibitor of nuclear factor-kappaB mutations or activation of the CD30, CD40, and RANK receptors. Clin Cancer Res 2004; 10: 3207–3215. 5 Gu T-L, Tothova Z, Scheijen B, Griffin JD, Gilliland DG, Sternberg DW. NPM-ALK fusion kinase of anaplastic large-cell lymphoma regulates survival and proliferative signaling through modulation of FOXO3a. Blood 2004; 103: 4622–4629. 6 Ricci JE, Gottlieb RA, Green DR. Caspase-mediated loss of mitochondrial function and generation of reactive oxygen species during apoptosis. J Cell Biol 2003; 160: 65–75. 7 Rust R, Harms G, Blokzijl T, Boot M, Diepstra A, Kluiver J et al. High expression of Mcl-1 in ALK positive and negative anaplastic large cell lymphoma. J Clin Pathol 2005; 58: 520–524. 8 Nencioni A, Hua F, Dillon CP, Yokoo R, Scheiermann C, Cardone MH et al. Evidence for a protective role of Mcl-1 in proteasome inhibitor-induced apoptosis. Blood 2005; 105: 3255–3262.
Supplementary Information accompanies the paper on the Leukemia website (http://www.nature.com/leu)
A novel NUP98-PHF23 fusion resulting from a cryptic translocation t(11;17)(p15;p13) in acute myeloid leukemia Leukemia (2007) 21, 842–844. doi:10.1038/sj.leu.2404579; published online 8 February 2007
Chromosome translocations are recurrent features of various hematological malignancies. The cloning of the translocation breakpoints has led to the discovery of numerous important genes and considerable advancement in the understanding of leukemogenesis. The nucleoporin gene NUP98 is a frequent target of chromosomal translocations in various hematological malignancies, including pediatric and adult, de novo and therapy related, myeloid and lymphoblastic T-cell leukemia (reviewed by Slape and Aplan1). These translocations produced fusions between NUP98 and various partner genes that are either homeobox (HOX) and non-homeobox (non-HOX) genes (Table 1). We report here the identification of a cryptic translocation t(11;17)(p15;p13) in a patient with acute myeloid leukemia (AML). Molecular characterization of the translocation breakpoint revealed a fusion of NUP98 to a new non-HOX partner PHF23 or plant homeodomain (PHD) finger 23. PHF23 Leukemia
is a novel gene encoding a hypothetical protein with a PHD finger. Significantly, recent publications identify the PHD finger as a previously uncharacterized chromatin-binding module found in a large number of chromatin-associated proteins with functions in transcriptional regulation.2,3 Our patient was a 42-year-old male presented with white blood cells count 100 109/l with 79% blasts. The blast cells had following surface marker expression: CD7, CD11c, CD13, CD14 (dim), CD33, CD38, CD64, CD117 and human leukocyte antigen (HLA)-DR. He was newly diagnosed with AML and received induction therapy of idarubicin and ara-C followed by four cycles of high-dose ara-C consolidation. After achieving clinical and cytogenetic remission for 11 months, he relapsed with the same translocation. He did not respond to the reinduction chemotherapy and died in 3 months. Initial karyotype analysis on a bone marrow specimen indicated a possible deletion in the terminal region of 17p (Figure 1a). In order to clarify this finding, we performed fluorescence in situ hybridization (FISH) using a P53 probe at 17p13.1 and a LIS1 probe 17p13.3 (Abbott Molecular, Des
Letters to the Editor
843 Plaines, IL, USA). The P53 probe showed a normal signal pattern, but the LIS1 probe showed a signal pattern consistent with a balanced translocation between 11p and 17p. Considering that the NUP98 gene at 11p15 is commonly involved in translocations associated with AML, we constructed a break-apart probe set using bacterial artificial chromosome (BAC) clones RP11-120E20 and RP11-438N5 (BACPAC Resources, Oakland, CA, USA) containing the telomeric and centromeric ends of the NUP98 gene, respectively. This probe set confirmed the disruption of the NUP98 gene by the translocation. In order to identify the new partner gene for NUP98, we constructed and tested a series of BAC clonederived FISH probes within the region between P53 and LIS1. Clone RP1-4G17 was found to display a split hybridization signal pattern, demonstrating that the translocation breakpoint on 17p was within this clone (Figure 1b). The patient gave informed consent on an International Review Boardapproved protocol for further molecular characterization of the translocation. Based on the position of RP1-4G17 on the human genome map, we considered PHF23 as a candidate fusion partner for NUP98. Although PHF23 is an uncharacterized gene, its annotated mRNA sequence is in GenBank along with a few cDNA clones including BC002509 and NM_024297. These sequences helped us to design primers for the amplification of a putative NUP98–PHF23 fusion transcript. Total RNA was isolated from patient’s peripheral blood and reverse transcribed to first-strand cDNA using SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). NUP98–PHF23 fusion cDNA was amplified using primer pair NUP98-F: CCAAGCAC CAGTGTATTACTGC (NM_016320, nt 842–863) and PHF23R: CCCAGGAGGTGGGAGTCTAT (BC002509, nt 864–883). Polymerase chain reaction (PCR) was carried out for 35 cycles at 941C for 30 s, 601C for 30 s and 721C for 2 min. Indeed, the NUP98-F and PHF23-R primer pair yielded a positive PCR product (Figure 2a). Cloning and sequencing of this product confirmed a NUP98–PHF23 fusion. Sequence analysis of the NUP98–PHF23 fusion transcript revealed that NUP98 exon 13 was fused in-frame to PHF23 exon 4 (Figure 2b). The full-length NUP98–PHF23 sequence has been submitted to the GenBank, with accession number EF071958. Table 1
In contrast to NUP98, PHF23 is a novel gene. In order to verify the sequence of PHF23 transcripts, we conducted 30 and 50 rapid amplification of cDNA ends (RACE) using a SMARTRACE cDNA amplification kit (Clontech, Mountain View, CA, USA) to obtain both ends and compared our sequence data with those in GenBank. A reverse primer: GATCAAAGAGA GAGTCCTTGAGCTTCATCTTCTCAA (BC002509, nt 558–593) and a forward primer: GGGGATGGGGAAAAGAGATCTC GAATCAAGAAGAGC (BC002509, nt 794–829) were used for the 50 and 30 RACE, respectively. PCR conditions were followed as described by the manufacturer. Although the 50 RACE resulted in one PCR band, the 30 RACE resulted in two PCR bands. These RACE products were cut from the agarose gel and cloned into a TA cloning vector (Invitrogen, CA, USA). Purified DNA from selected plasmid clones were sequenced and compared with PHF23 sequences in GenBank. Our sequence, including both 50 and 30 untranslated regions, matched to BC002509 and an updated version of NM_024297. The second 30 RACE product (from a shorter PCR band) represented a
Fusion partners of NUP98 in hematological malignancies
Chromosomes
Fusion partner genes
Leukemia subtype
1q24 2q31 3p24 4q21 5q35 6q24
AML, MDS, CML AML M4, MDS AML M5a T-ALL AML M2 AML
7p15
PMX1 (PRRX1) HOXD11, 13 TOP2B RAP1GDS1 NSD1 C6ORF80 (CCDC28A) HOXA9, 11, 13
8p11 9p22 9q34 10q25 11q22 12p13 12q13 20q11
NSD3 LEDGF PRRX2 ADD3 DDX10 JARID1A HOXC11, 13 TOP1
AML M2 and M4, MDS, CML AML M1 AML M1, CML AML T-ALL AML M1 and M4, MDS AML M7 AML M1 MDS
Abbreviations: AML, acute myeloid leukemia; CML, chronic myeloid leukemia; MDS, myelodysplastic syndrome; T-ALL, T-cell acute lymphoid leukemia. Modified from http://atlasgeneticsoncology.org//Genes/NUP98.html.
Figure 1 A cryptic t(11;17)(p15;p13) translocation in AML. (a) Karyotype of a bone marrow cell with a possible abnormality in chromosome 17p13. (b) FISH revealed translocation breakpoint on 17p. BAC RP11-186B7 (green signal) hybridizes to both copies of 17p, indicating that it is centromeric to the translocation breakpoint. BAC RP1-4G17 (red signal) hybridizes to both copies of 17p as well as one of the two copies of 11p, indicating that the translocation breakpoint on 17p is within this BAC clone. The split red signal pattern due to the translocation is also evident in an interphase cell shown in the upper right corner. Leukemia
Letters to the Editor
844
Figure 2 A novel NUP98–PHF23 fusion. (a) RT-PCR amplification of the NUP98–PHF23 fusion transcript. Lane1 represents amplification of a NUP98-PHF23 fragment with NUP98-F and PHF23-R derived from the internal sequences of the two genes. Lane 2 represents amplification of a full-length NUP98–PHF23 fusion gene. (b) NUP98–PHF23 fusion cDNA sequence and predicted fusion protein. NUP98 breakpoint is at the end of exon 13 and PHF23 breakpoint is within exon 4. The predicted fusion protein contains the N-terminus of NUP98 and C-terminus of PHF23. Functional domains are indicated for wild-type NUP98, PHF23, and NUP98–PHF23 fusion protein. FG, Phe-Gly repeats (docking site); GLEB, binding domain for shuttling mRNA export factor RAE1; PHD, plant homeodomain.
transcript with a variant 30 untranslated region (submitted to GenBank with accession number EF071959). NUP98 has various fusion partner genes that are either HOX or non-HOX genes. The HOX genes are a known class of transcription factors characterized by the presence of a conserved DNA-binding homeodomain and play a significant role in the regulation of normal hematopoietic development.4 In contrast, the non-HOX fusion partner genes are diverse in function and are not known to have a specific function in hematopoiesis. However, these apparently unrelated molecules appear to encode proteins with a coiled-coil conformation that may facilitate interaction with other transcription factors or cofactors.5 Using COILS, a coiled-coil domain prediction program, we analyzed the NUP98–PHF23 fusion sequence and found that this fusion protein has a 99% probability of forming a coiled-coil domain. The coiled-coil domain is located in the PHF23 portion of the fusion protein. The plant homeodomain (PHD) finger, adjacent to the coiledcoil domain, was also retained in the fusion protein. Recent studies suggest that the PHD finger, a protein structural fold coordinated by two zinc atoms found in nuclear proteins, is capable of mediating chromatin remodeling in control of gene expression.2,3 It is worth noting that two other non-HOX fusion partner genes NSD1 and NSD3 also contain several PHD fingers.6,7 Although a number of studies have focused on NUP98–HOX fusion, much less is known about the role of NUP98–non-HOX fusion in leukemogenesis. The only functional study involving a non-HOX partner gene is topoisomerase I (TOP1). Strikingly, the leukemogenic activity of NUP98–TOP1 fusion gene was found to be independent of the isomerase activity. However, the two DNA-binding domains in TOP1 are required for the in vitro growth promoting activity.8 These findings combined with our identification of a novel NUP98–PHF23 fusion and the knowledge of PHD finger-mediated chromatin remodeling in control of gene expression support the hypothesis that both NUP98–HOX and NUP98–non-HOX fusion proteins may function as aberrant transcription factors. They act by binding to DNA and signaling the recruitment of transcription regulators to form a regulatory complex leading
Leukemia
to transcriptional dysregulation. Further identification of their target genes and coregulators will not only improve our understanding of the molecular pathogenesis of NUP98 fusion-mediated leukemia but also contribute to the development of targeted therapies.
1
JC Reader1, JS Meekins1, I Gojo2 and Y Ning1 Department of Pathology and Program in Human Genetics, University of Maryland, Baltimore, MD, USA and 2 Department of Hematology-Oncology, University of Maryland, and Marlene and Stewart, Greenebaum Cancer Center, Baltimore, MD, USA E-mail:
[email protected]
References 1 Slape C, Aplan PD. The role of NUP98 gene fusions in hematologic malignancy. Leuk Lymphoma 2004; 45: 1341–1350. 2 Wysocka J, Swigut T, Xiao H, Milne TA, Kwon SY, Landry J et al. A PHD finger of NURF couples histone H3 lysine 4 trimethylation with chromatin remodelling. Nature 2006; 442: 86–90. 3 Shi X, Hong T, Walter KL, Ewalt M, Michishita E, Hung T et al. ING2 PHD domain links histone H3 lysine 4 methylation to active gene repression. Nature 2006; 442: 96–99. 4 Eklund EA. The role of HOX genes in myeloid leukemogenesis. Curr Opin Hematol 2006; 13: 67–73. 5 Hussey DJ, Dobrovic A. Recurrent coiled-coil motifs in NUP98 fusion partners provide a clue to leukemogenesis. Blood 2002; 99: 1097–1098. 6 Jaju RJ, Fidler C, Haas OA, Strickson AJ, Watkins F, Clark K et al. A novel gene, NSD1, is fused to NUP98 in the t(5;11)(q35;p15*5) in de novo childhood acute myeloid leukemia. Blood 2001; 98: 1264–1267. 7 Rosati R, La Starza R, Veronese A, Aventin A, Schwienbacher C, Vallespi T et al. NUP98 is fused to the NSD3 gene in acute myeloid leukemia associated with t(8;11)(p11.2;p15). Blood 2002; 99: 3857–3860. 8 Gurevich RM, Aplan PD, Humphries RK. NUP98-topoisomerase I acute myeloid leukemia-associated fusion gene has potent leukemogenic activities independent of an engineered catalytic site mutation. Blood 2004; 104: 1127–1136.
