[CANCERRESEARCH57. 3910-3913. September 5, 19971
Advances in Brief
p53-dependent Induction of WAF1 by a Low-pH Culture Condition in Human Glioblastoma Cells' Toshio
Ohtsuho,
Xin.jiang
Wang,
Akihisa
Takahashi,
Ken Ohnishi,
Hitoshi
Saito, Chang
W. Song, and
Takeo Ohnishi2 Department of Otorhinolarvngology, Fukui Medical School, Matsuoka Fukui 910-1 1, Japan IT. 0., H. S.]; Department of Biology, Nara Medical University, Kashihara, Nara 634, Japan IX. W., A. T., K. 0.. T. 0.): and Department of Therapeutic Radiology. University ofMinnesota, Minneapolis, Minnesota 55455 (C. W. S.]
Abstract The effects of an acidic condition (pH 6.5) on WAFJ gene expression and p53 accumulation
was Investigated
in human glioblastoma
cells with
different p53 statuses. WAF1 and p53 accumulation after treatment in acidic conditions was observed in A-172 cells carrying the wild-type p53 gene but not in T98G cells carrying the mutant p53 gene. Northern blot analysis showed that WAFJ gene activation by acidic conditions only occurred in A-172 cells. Consistent with this, activation of the binding of p53 to Its specific DNA sequence by acidic stress was detected by gel
results indicate that WAFJ is inducible by acidic conditions, which may be due to the activation of p53-mediated signal transduction by nongenotoxic acidic stress. This provides the first evidence that a physiologically acidic condition may act in vivo as an important selection pressure in the evolution of cancer cells in solid tumors, through the activation of the p53-mediated signal transduction path way. Materials
and Methods
mobility shift assay using p53 consensus sequence as a probe. Moreover,
the increased WAF1 protein and mRNA levels that were due to acidic treatment returned to normal levels upon the return of the cells to neutral conditions, 6 h after the cells had been cultured in acidic conditions for 6 or 12 h. These findings suggest that WAFJgene activation is inducible by acidic conditions in human glioblastoma cells, which is probably due to activation of the p53-dependent signal transduction pathway.
Cell Culture and Reagents. HumanglioblastomaA-l72 cells (provided by JCRB, Setagaya, Tokyo, Japan), bearing the wtp533 gene (12), are com petent in activating the expression of both a p53—dependent reporter gene and WAFJ (13). T98G cells (provided
a single 0-to-A
bearing homologous
mpS3, have
missense mutant of Met to Ile (14), and they have their lost nuclear translo cation ability but kept their p53-independent WAF1 induction pathway.4 These cells were cultured in DMEM containing 10% (v/v) fetal bovine serum, 50
Introduction
units/ml penicillin,
It has long been known that the microenvironment in solid tumors is intrinsically hypoxic, nutritionally poor, and acidic relative to normal tissue. Recently, it has been reported that hypoxia provides a physiological selection pressure in tumors for the expansion of van ants that have lost their apoptotic potential and, in particular, for cells that have acquired p53 mutations (1, 2). However, the effects of a low-pH condition, another common feature of tumor microenviron ments, on p53 or WAF1 response remains undocumented. WAF1, also known as p21/CIP1/sdil, is an universal inhibitor of cyclin-dependent
@
by JCRB),
transition in the third position of codon 237, resulting in a
kinases
(3—5). In addition
to well-established
50
@g/mlstreptomycin,
and 50
@g/mlkanamycin.
Antihu
man WAF1 monoclonal antibody (EAIO) and antihuman p53 monoclonal antibody
(PAb18O1)
were obtained
from Oncogene
Science
Inc. (Uniondale,
NY). Horseradish peroxidase-conjugated antimouse IgG antibody was pur chased from Zymed Labs Inc. (San Francisco, CA). Millipore Immobilon polyvinylidene fluoride membranes were purchased from Millipore Co. (Bed ford, MA). BLAST and GeneScreen membranes were purchased from DuPont1 NEN (Boston, MA). The Bio-Rad Protein Assay Kit was purchased from Bio-Rad (Richmond, CA). RNAzo1 was purchased from Biotecx Laboratories,
Inc. (Houston, TX). MEGALABEL was purchased from TaKaRa Shuzo Co., Ltd. (Ohtsu, Shiga, Japan). Double-stranded p53CON oligonucleotides
were
geno
synthesized by Japan Bioservice (Niiza, Saitama, Japan). Poly(dI-dC):poly(dI toxic agents, a variety of other kinds of agents, which include inhib dC) was purchased from Pharmacia Biotech (Uppsala, Sweden). The radioim itors of cell proliferation and inducers of differentiation and the munoprecipitation assay buffer contained 50 mt@i Tris (pH 7.2), 150 mMNaCl, nongenotoxic stress of hyperthermia, have been found to induce 1% (v/v) Nonidet P-40, I% (w/v) sodium deoxycholate, and 0.05% (w/v) SDS. WAFJ in either a p53-dependent or -independent manner (6—9). The 4-morpholinepropanesulfonic acid buffer contained 0.04 Msodium 4-mor pholinepropanesulfonic acid (pH 7.2), 5 mM sodium citrate, and 0.5 m'vi Accumulated WAFI inhibits the kinase activities of various cyclin EDTA. The washing buffer contained 10 mMTris-HC1(pH 7.5), 130 mM dependent kinase complexes, and as a result, cells are arrested in NaCl, 5 mM KCI, and 8 mM MgCl2. Hypotonic buffer contains 20 m@i (10). Because, in most cases, WAFJ induction by stress depends on p53 staus (7, 9—11), from this point of view,
WAF1
could play an
important role in p53-mediated tumor evolution. This is because cells carrying mutant p53 will not undergo cell growth delay, due to a lack of p53-dependent WAFJ induction, and will gradually dominate the tumor cell population via clonal expansion. Here, we have investigated the responses of WAFJ in acidic con ditions in human glioblastoma cells with different p53 statuses. Our Received 5/1/97; accepted 7/24/97. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. I This
work
was
supported
in part
by a grant
from
the Ministry
of Education,
HEPES-KOH
NaCl, 1.5 mM MgCI2, 0.2 mM EDTA-NaOH (pH 8.0), 0.5 mM DTF, 0.5 mM
PMSF, 25% (v/v) glycerol, and 1.2 ,@Mspermidine. Binding buffer contains 20 mMHEPES-KOH (pH 7.6), 0.5 mMEDTA-NaOH (pH 8.0), 50 mMKC1,0.5 mM
whom
requests
DT1@, 0.5
0.05%
reprints
should
be addressed,
at Department
of Biology,
mM
PMSF,
bromphenol
and
10%
blue, 0.05%
(v/v)
glycerol.
(w/v)
xylene
Dye
cyanol,
solution
contained
5% (v/v) glycerol,
Treatment Procedure. The cells were plated 12 h before treatment with acidic medium. The medium acidity was adjusted with 1 N HCI to a final pH
of 6.5. The pH of the medium was measured on a pH ion meter 225 (Iwaki Glass, Tokyo, Japan) before and after treatment. During treatment, culture
Science 3 The
for
(w/v)
and 0.05 MEDTA.
and Culture of Japan. 2 To
(pH 7.6), 5 mM KCI, 0.5 mM MgCl2, 0.5 msi D11@,and 0.5 mM
PMSF.The extractionbuffercontained20 mMHEPES-KOH(pH7.6), 500mM
Nai-a
Medical University, 840 Shijo-cho, Kashihara, Nara 634, Japan. Phone: 81-7442-2-3051 ext. 2264; Fax: 81-7442-5-3345. E-mail:
[email protected].
abbreviations
used
are:
wtpS3,
wild-type
p53;
mp53,
mutant
p53;
p53CON,
p53
consensus sequence; PMSF, phenylmethylsulfonyl fluoride; GMSA, gel mobility shift assay. 4 Unpublished
3910
data.
@
2@2@A-172 ACIDITY INDUCES WAF! IN A p53-DEPENDENTMANNER
flasks were tightly closed to avoid the effect of carbon dioxide on the pH of medium.Changesin pH were not observedaftercells were treated. Colony Formation Assay. After cells were treated with acidic medium, the mediumwas replacedwith fresh mediumof neutralpH (pH 7.4) and cultured at 37°C.Ten days later, they were stained in the flasks with May-Grunwald Giemsa, and colonies containing more than 50 cells were counted. Western Blot Analysis. The cells were washed once with PBS after being trypsinized (0.0025%), and then they were centrifuged and pelleted at 4°C.The
cells were resuspended in radioimmunoprecipitation assay buffer and then completelylysed by threecycles of freeze-thawing.The proteincontentsof the supernatants that were obtained after centrifugation (10,000 X g, 15 mm) were quantified using Bio-Rad protein assay reagent and then loaded on an SDS 15% polyacrylamide
gel at 20 pg/well.
Other details of the Western blotting
procedure were as described previously (9). Northern Blot Analysi& Total cellular RNA was prepared using the RNA zol methodaccordingto the manufacturer'sinstructions.RNA was quantified by spectrophotometric methods. Fifteen @tg oftotal cellular RNA were used for Northern blot analysis. WAFJ mRNA was detected with a WAFI cDNA probe
cut from plasmid 2Db-S. Other details of the Northernblotting procedure were as described previously (9). GMSA. The p53 DNA-bindingactivitywas measuredby a GMSA using a synthetic double-stranded
p53CON (GGACATGCCCGGGCATGTCC;
Ref.
15) oligonucleotide as a probe. This probe was labeled with [y-32PJATPusing MEGALABEL
and then incubated
with nuclear extracts
(5 g@gprotein/
1—3X l0-@cpm probe) at room temperature for 30 mm in the presence of poly(dl-dC):poly(dI-dC)(I @&g) in a total reactionvolume of 15 pAadjusted with binding
buffer.
For the competition
experiment,
a 100-fold
excess
of
unlabeled p53CON was added to the binding reaction mixture. Other details of the GMSA procedure were as described previously (9).
Results and Discussion To examine the effects of a low-pH condition on WAF1 accumu lation, Western blot analysis was performed. Briefly, A-l72 and T98G cells were plated (2 X l05/25-cm2 flask) 12 h before treatment with acidic medium (pH 6.5). Cells were harvested after continuous culture in acidic condition for 6, 12, and 24 h, or they were incubated in a neutral pH condition for 6 and 12 h after being cultured in acidic medium for 6 h. Then, total proteins were extracted and 20-pjg aliquots of protein were loaded on an SDS-polyacrylamide gel for Western blot analysis. No cytotoxicity was observed after treatment in an acidic (pH 6.5) condition for up to 24 h, as revealed by the
A
colony-forming
ability
(data not shown).
Fig. 1, A and B, show that
the accumulation of WAF1 occurred at 6 h after exposure to an acidic condition (7.9-fold), reaching a peak at 12 h (23-fold), and was maintained until 24 h (22-fold) in A-l72 cells bearing wtp53. How ever, when cells were returned to a normal pH (pH 7.4) condition after 6 h of acidic treatment, elevated WAF1 levels rapidly decreased to control levels 6 h after medium was replaced with a medium at normal pH 7.4. In contrast, in T98G cells bearing mp53, the basal level of WAFI was relative low, and no accumulation was observed after cells were exposed to an acidic condition during the observation period. Because WAFJ is one of the downstream genes of the p53 stress response pathway, we examined the changes in p53 levels in these cells after acidic culture. As shown in Fig. I, C and D, the accumu lation of wtp53 occurred at 6 h after exposure to an acidic (pH 6.5) condition (2.1-fold), was maintained at 12 h (2.0-fold), and then gradually declined to control level at 24 h. This elevated level also decreased to a control level after medium was changed to a medium at normal pH 7.4, which is consistent with WAF1 accumulation in A-l72 cells. However, the level of mp53 in T98G cells did not change after acidic culture condition. These Western blot results demon strated that WAF1 accumulation after exposure to an acidic condition (pH 6.5) occurred only in A-l72 cells bearing wtp53, accompanied with an increase of wtp53, but not in T98G cells bearing mp53. To confirm that acidic culture-induced WAFI accumulation was the consequence of the activation of WAFJ expression, Northern blot analysis was carried out. Briefly, total RNA was prepared from treated cells with the same procedure as that used for protein extraction of Western blot and quantified, and then it was subjected to electrophore sis (15 @.tg RNA/well) on a 1% agarose gel containing 17% formal dehyde. After blotting, the membranes were probed to detect WAFJ/ sdil mRNA. Methylene blue staining of 285 rRNA blotted on the membranes
was used
as an internal
control
for equal
loading.
1
A-172.;
C
@]_@AF1
T98G.T98G
Fig. 1. Inductionof WAFI and p53 accumula tim
by an acidic
culture
condition.
A, WAFI
accu
mulationby an acidic culture condition.WAFI bands are indicated. B, relative levels of WAFI protein at different time points after acidic treat
meat, as compared with those of nontreated cells (time,
0 h). Cells
were exposed
to an acidic
condi
tion (pH 6.5) for graded periods. 0, A-l72; •,
B
D C
C
T98G.Cellswere exposedto an acidiccondition (pH 6.5) for 6 h, followed by culture in a normal condition of pH 7.4 for graded periods. A, A- I72; A, T98G. C, p53 accumulation by an acidic culture condition. p53 bands are indicated. D, relative 1ev
els of p53 protein at differenttime points after acidic treatment, as compared with those in control
As
shown in Fig. 2, an apparent increase in WAFJ mRNA was observed in A-l72 cells 6 and 12 h after acidic culture. The increased WAFI mRNA at 6 h after acidic treatment decreased to the level of non treated cells following incubation for 6 or 12 h in the pH 7.4 medium. Consistent with Western blot results, WAFI mRNA in T98G cells was very low in control medium and did not change after acidic stress.
0
0. U. ‘C
C')
In
0
0
4)
4.'
C
C
cells. Symbols are the same as those in B. ‘C
a, >
4..
Time after Treatment (h) 3911
Time after
Treatment
(h)
ACIDITY INDUCES WAFI IN A p53-DEPENDENT MANNER
Thus, these Northern blot results stress-induced WAFI accumulation
clearly demonstrated that acidic was a consequence of the activa
A-172
A
tion of WAFJ expression, which was also dependent on p53 status. p53 transactivates its downstream genes through specific DNA
)1'@4WWW 6789
binding to specific sequences located in the upstream of p53-targeted genes (15). To demonstrate the effects of acidic culture on p53 DNA binding activity, a GMSA using a p53CON
T98G
as a probe was carried out.
B
Briefly, nuclear extracts were prepared from the cells before or after 10 C,, acidic treatment. The nuclear extracts were then incubated with the labeled p53CON. After electrophoresis, the gel was dried, and the ,@ signals were visualized on a BAS1000. The p53-specific bands were determined by the competition experiment with an unlabeled > 0 p53CON. As shown in Fig. 3, the intensity of p53-specific bands paralleled the pattern of p53 accumulation in A- 172 cells after acidic C condition, whereas no DNA binding of mp53 in T98G was observed. .5 C The results of GMSA provided evidence that acidic stress could activate the DNA-binding activity of wtp53 in human glioblastoma cells, which, in turn, might have led to the induction of WAFJ .s expression. 0 The biological functions of p53 are completed by the induction of its downstream mediator genes, such as WAFI, box, and GADD45 (3, . 6'4 16, 17) or through interactions with other regulatory proteins, all of @io6>,@ which are involved either in cell cycle control, DNA repair, or “4 apoptosis. Thus, p53-centered signal transduction represents a very Fig. 3. The activation of p53 DNA-binding activity by acidic stress. A, GMSA was important mechanism in the cellular responses to various stresses. carried out with the nuclear extracts prepared from the cells exposed to an acidic condition WAFI induction by cellular stresses, including those that are geno (pH6.5)forgradedperiodsor exposedto acidiccondition(pH6.5)for 6 h followedby toxic and nongenotoxic, has been shown to be p53 dependent (8—10). culturein a normalconditionof pH 7.4 forgradedperiods.Lanes 1 and6, nontreatedcells; Although WAFI induction by DNA-damaging agents, such as ‘y-ray Lanes 2 and 7, pH 6.5 for 6 h; Lanes 3 and 8, pH 6.5 for 12 h; Lanes 4 and 9, pH 6.5 for 6 h followed by pH 7.4 for 12 h; Lane 5, pH 6.5 for 12 h plus 100-fold molar excess of and UV light, has been intensively studied in recent years, our unlabeled (cold) p53CON. B, relative binding activity of p53 at different time points after interests has been focused on WAFI response to nongenotoxic tumor acidic treatment, as compared with that in control cells. 0, A-l72; , T98G. The band environmental stresses. Here, we have shown that acidic condition is positionof specificp53-p53CONcomplexwas confirmedby competitivebindingof
‘a
a,
@
100-fold molar excess of unlabeled (cold) p53CON.
a potent inducer for WAFI expression, probably through a p53dependent pathway. The present finding implies that p53-mediated stress response
pathway
may have critical impact on the evolution
of
tumor cells because physiological acidic condition is a common feature of solid tumors. This notion is supported by the fact that WAF1 is the major mediator for p53-dependent growth arrest and by a recent demonstration that WAFI provides a survival signal that antagonizes p53-dependent apoptosis (18), which may confer growth advantage on cells bearing mutant p53. Apoptosis is generally an encoded program of cell death that can be activated under physiolog ical conditions (19, 20) and is an important safeguard against tumor development (21—23).Thus, on one hand, an acidic condition in tumor tissue may activate the p53 pathway and eliminate the apoptosis competent cells via induction of p53-dependent apoptosis, and on the other hand, this will only lead to growth arrest via accumulation of WAFI in cells that still possess wild-type p53 but have lost apoptosis potential. This may underlie the expansion of cancer cells with growth
A-172
I @
A
WAF1mRNA—.@. t• (2.1 kb)
@
B
@A-@
0
treatment
1980
@1 I
advantage in tumor tissue. However, using flow cytometry analysis and histochemical staining with DNA-binding dye Hoechst 33258, we could not obtain evidence for WAFI-mediated 01 arrest or apoptosis under acidic conditions (data not shown) in the presence of significant accumulation ofWAFl in A-l72, which suggests that this cell line has lost both p53-dependent G1 arrest and apoptosis potential during tumor evolution. Apparently, to understand the biological significance of activation of the p53 pathway by acidic conditions in cell cycle regulation and apoptosis requires further studies, using a wide range of in vitro-cultured tumor cell types and in vivo tumor tissues of different stages, because the consequence of activation of the p53 pathway also depends on many other cellular components, such as retinoblastoma protein, Bcl-2, Bax, and so on, which may have been altered in some cell lines or tumor cells of certain stages but not in the others. Taking our previous observations of WAF1 induction by heat
I
•@
______________________________________________________
@•Ø@ØØ@@
selection @
@‘@‘4,
(9), cold shock,
and protein
kinase
inhibitor,4
we conclude
that nongenotoxic stressors can be potent inducers for p53-dependent WAFI induction. From this point of view, WAF1 seems to be a general stress responsive protein that is sensitive to both genotoxic and nongenotoxic cellular stresses, which further emphasizes the importance of p53-mediated signal transduction in the maintenance of genomic stability. Our data also support the hypothesis that the clonal %‘ ‘@‘s‘@e
Fig. 2. Inductionof WAFI expression by an acidic culture condition. A, Northern blotting analysis of WAFI mRNA. B, methylene blue-stained bands of 28S rRNA on a
of p53 status
in solid tumors
may be induced
not only by
hypoxia but also by acidic stress. Acknowledgments
blotted membrane. Cells were exposed to an acidic condition (pH 6.5) for 6 or 12 h, and
cells exposed for 6 h were then cultured in a normal condition of pH 7.4 for 6 or 12 h. 3912
We aregratefulto Dr. A. NodaforprovidingWAFJcDNA plasmid2Db-S.
ACIDITY INDUCES WAFI IN A p53-DEPENDENT MANNER
12. Matsumoto, H., Shimura, M., Omatsu, T., Okaichi, K., Majima, H., and Ohnishi, T.
References
p53proteinssecumulatedby heatstressassociatewithheatshockproteinsHSP72J I. Oraeber, T. 0., Peterson, J. F., Tsai, M., Monica, K., Fornace, A. J., Jr., and Giaccia, A. J. Hypoxia induces accumulation of p53 protein. but activation of a 0,-phase checkpoint by low-oxygen conditions is independent of p53 status. Mol. Cell. Biol., 14: 6264—6277,1994. 2. Graeber, T. 0., Osmanian, C., Jacks, T., Housman, D. E., Koch, C. J., Lowe, S. W., and Giaccia, A. J. Hypoxia-mediated selection of cells with diminished apoptotic
HSC73 in human glioblastoma cell lines. Cancer Lcu., 87: 39-46, 1994. 13. Jung, J. M., Li, H., Kobayashi, T., Kyritsis, A. P., Langford, L A., Bruner, J. M., Levin, V. A., and Zhang, W. Inhibition of human glioblastoma cell growth by WAF1/Cipl can be attenuated by mutant p53. Cell Growth Differ., 6: 909—913,1995. 14. Ullrich, S., Mercer, E., and Appclla, E. Human wild-type p53 adopts a unique
conformational and phosphorylation state in vivoduring growth arrest of glioblastoma cells. Oncogene, 7: 1635—1643, 1992.
potential in solid tumors. Nature (Land.), 379: 88—91,1996. 3. El-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., Un, D., Mercer, W. E., Kinzler, K. W., and Vogelstein, B. WAF1, a potential mediator of p53 tumor suppression. Cell, 75: 817—825, 1993. 4. Xiong, Y., Hannon, 0. J., Thang, H., Casso, D., Kobayashi, R., and Beach, D. P21 is a universal inhibitor of cyclin kinases. Nature (Load.), 366: 701—704,1993. 5. Node, A., Ning, Y., Venable, S. F., Pereira-Smith, 0. M., and Smith, J. R. Cloning of
15. El-Deiry, W. S., Kern, S. E., Pietenpol, J. A., Kinzler, K. W., and Vogelstein, B.
Definitionof a consensus bindingsite for p53. Nat. Genet., I: 45—49,1992. 16. Miyashita, T., and Reed, J. C. Tumor-suppressor p53 is a direct transcriptional
activatorof the humanbaxgene.Cell,80: 293—299, 1995. 17. Kastan, M., Than, Q., El-Deiry, W.. Carrier, F., Jacks, T., Walsh, W., Plunken, B.,
senescent cell-derived inhibitors of DNA synthesis using an expression screen. Exp.
Vogelstein, B., and Fornance, A., Jr. A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia telangiectasia. Cell, 7!: 587—597,
CellRes.,211:90—98, 1994. 6. Michiei, P., Chedid, M., Un, D., Pierce, J. H., Mercer, W. E., and Givol, D. Induction of WAFJ/CIPI by a p53-independent pathway. Cancer Rca., 54: 3391—3395,1994. 7. Maclead, K. F., Sherry, N., Hannon, G., Beach, D., Tokino, T., Kinzler, K., Vogelstein, B., and Jacks, T. p53—dependentand independent expression of p21 during cell growth, differentiation, and DNA damage. Genes Dcv., 9: 935—944,1995. 8. Steinman, R. A., Hoffman, B., Ira, A., Guillouf, C., Liebermann, D. A., and El Houscini, M. E. Induction of p21 (WAF-l/CJPI) during differentiation. Oncogene (Land.), 9: 3389—3396, 1994.
1992. 18. Polyak, K., Waldman, T., He, T. C., Kinzler, K. W., and Vogelstein, B. Genetic determinants of p53-induced apoptosis and growth arrest. Genes Dcv., 10: 1945—
1952, 1996. 19. Bellamy, C. 0. C., Malcomson, R. D. 0., Harrison. D. J., and Wyllie, A. H. Cell death in health and disease: the biology and regulation of apoptosis. Semin. Cancer Biol., 6: 3—16,1995.
9. Ohnishi,T.,Wang,X.,Ohnishi,K.,Matsumoto,H.,andTakalsaShi, A.p53-dependent 20. Thompson, C. B. Apoptosis in the pathogenesis and treatment of disease. Science induction of WAFI by beat treatment in human glioblastoma cells. J. Biol. Chem., 271: 14510—14513,1996.
10. Dulic,V., Kaufman,W.,Wilson,S., Tisty,T., Lees,E., Harper,J., Elledge,S., and Reed, S. p53-dependent inhibition of cydlin-dependent kinase activities in human fibroblasts during radiation-induced G, arrest. Cell, 76: 1013—1023, 1994.
II. Bae, I., Fan, S., Bhatia,K., Kohn,K. W., Fornace,A. Jr., and O'Connor,P. M. Relationshipbetween0, arrestand stabilityof the p53andp21/Cipl/Waflprotein
(Washington DC), 267: 1456—1462.1995. 21. Harrington, E. A., Fanidi, A., and Evan, G. I. Oncogenes and cell death. Curr. Opin. Genet. Dcv., 4: 120—129,1994. 22. Wyllie, A. H. The genetic regulation of apoptosis. Curr. Opin. Genet. Dcv., 5:
97—104,1995. 23. Deng, C., Zhang, P., Harper. J. W., Elledge, S. J.. and Leder, P. Mice lacking
following ‘y-irradiation ofhuman lymphoma cells. Cancer Res., 55: 2387—2393,1995.
3913
p2JC@@@@1 undergo normal development
control. Cell, 82: 675—684,1995.
but are defective
in 0,
checkpoint
