PACAP regulates BDNF exon IV expression through ...

Endocrinology. First published ahead of print May 1, 2008 as doi:10.1210/en.2008-0131

PACAP regulates BDNF exon IV expression through the VPAC1 receptor in the amphibian melanotrope cell Abbreviated title: PACAP regulates BDNF expression Adhanet H. Kidane, Eric W. Roubos and Bruce G. Jenks Department of Cellular Animal Physiology, Donders Centre for Neuroscience, EURON, Faculty of Science, Radboud University Nijmegen, 6525 ED Nijmegen, The Netherlands Corresponding author: Bruce G. Jenks, Department of Cellular Animal Physiology, Radboud University Nijmegen, P.O. Box 9010, 6500 GL Nijmegen, The Netherlands. E-mail: [email protected] Keywords: αMSH, BDNF, intermediate lobe, melanotrope, neural lobe, PAC1-R, VPAC1-R Support: This work was supported by a grant from The Netherlands Organization for Scientific Research, NWO (#813.07.001). Disclosure statement: The authors have nothing to disclose

Copyright (C) 2008 by The Endocrine Society

Abstract In mammals, pituitary adenylate cyclase-activating polypeptide (PACAP) and its receptors PAC1-R, VPAC1-R and VPAC2-R play a role in various physiological processes including proopiomelanocortin (POMC) and brain-derived neurotrophic factor (BDNF) gene expression. We have previously found that PACAP stimulates POMC gene expression, POMC biosynthesis and αMSH secretion in the melanotrope cell of the amphibian Xenopus laevis. This cell hormonally controls the process of skin color adaptation to background illumination. Here we have tested the hypothesis that PACAP is involved in the regulation of Xenopus melanotrope cell activity during background adaptation and that part of this regulation is through the control of the expression of autocrine acting BDNF. Using quantitative RT-PCR, we have identified the Xenopus PACAP receptor, VPAC1-R, and show that this receptor in the melanotrope cell is under strong control of the background light condition, while expression of PAC1-R was absent from these cells. Moreover, we reveal by quantitative immunocytochemistry that the neural pituitary lobe of white-background adapted frogs possesses a much higher PACAP content than the neural lobe of black-background adapted frogs, providing evidence that PACAP produced in the hypothalamic magnocellular nucleus plays an important role in regulating the activity of Xenopus melanotrope cells during background adaptation. Finally, an in vitro study demonstrates that PACAP stimulates the expression of BDNF transcript IV.

2

Introduction Pituitary adenylate cyclase-activating polypeptide (PACAP) belongs to the vasoactive intestinal peptide (VIP), glucagon, secretin and growth hormone-releasing hormone family of peptides (1). PACAP binds to three G-protein-coupled PACAP/VIP receptors, PAC1-R, VPAC1-R and VPAC2R. PAC1-R has a 100-1000 times higher affinity for PACAP than for VIP while VPAC1-R and VPAC2-R have the same affinities for both peptides (2). PACAP and its receptors are widely distributed in the vertebrate central nervous system and peripheral organs, and control various physiological processes (for references see 35). In the mouse, PACAP stimulates proopiomelanocortin (POMC) gene expression and secretory activity of pituitary melanotrope cells (6), and also activates the expression of brain-derived neurotrophic factor (BDNF) in primary cultures of cortical neurons and astrocytes (7), indicating a role of PACAP in the control of neuronal plasticity. However, the physiological significance of PACAP-regulation of neuroendocrine secretory activity and of BDNF expression-dependent neural plasticity is unknown. A suitable physiological model to study the role of PACAP in the regulation of neural and neuroendocrine secretion and plasticity is the well-characterized background-adaptation process in the frog Xenopus laevis. In frogs placed on a black background, the melanotrope cells in the pars intermedia of the pituitary gland release αmelanophore-stimulating hormone (αMSH). This peptide stimulates the dispersion of melanin pigment granules in dermal melanophores, giving the animal a black appearance. In animals on a white background the release of αMSH is inhibited and consequently the pigment granules in the melanophore cell are aggregated around its nucleus, and the animal takes on a pale appearance (8, 9). On a black background the melanotrope cell diameter is about twice as large as on a white background (10) and the production of POMC and the secretion of its end product αMSH are strongly enhanced (11). POMC biosynthesis and αMSH

secretion by Xenopus melanotropes are regulated by a wide variety of neurochemical factors, both classical neurotransmitters and neuropeptides (for references see e.g. 12, 13). Recently PACAP has been added to the list of neuropeptides acting on Xenopus melanotrope cells as pharmacological studies with isolated cells have shown that PACAP directly stimulates both αMSH secretion and POMC biosynthesis (14). In this same study immunocytochemical analysis revealed that nerve terminals in the pituitary neural lobe are the likely source of PACAP for controlling melanotrope cell function. Besides αMSH, Xenopus melanotropes also produce BDNF, as shown with in situ hybridization and immunocytochemistry (15). The expression of BDNF is considerably enhanced in blackadapted frogs (15). BDNF and αMSH are cosequestered in and presumably co-released from melanotrope secretory granules (16). BDNF stimulates POMC biosynthesis in Xenopus melanotrope cells, implying that it acts as a stimulatory autocrine factor (15). This idea is supported by the observation that Xenopus melanotropes express the BDNF full length TrkB receptor (17). In the present study we have tested the hypothesis that PACAP is involved in the regulation of Xenopus melanotrope cell activity during background adaptation and that part of this regulation is through the control of the expression of autocrine acting BDNF. To this end we have studied the expression profiles of the PACAP receptors PAC1-R and VPAC1-R in Xenopus melanotropes, examined PACAPimmunoreactivity in neural lobes of whiteand black-background adapted animals, and determined the effect of PACAP on BDNF gene expression in the melanotrope cell. Our results show that Xenopus melanotropes express VPAC1-R mRNA and that PACAP stimulates expression of the BDNF gene.

Materials and Methods Animals Young-adults of the South African clawed frog Xenopus laevis, aged 6 months, were reared in our laboratory under standard conditions, kept in tap water at 22 °C, and fed

3

beef heart and trout pellets (Touvit, Trouw, Putten, The Netherlands). To ensure full adaptation to the state of background illumination, animals were kept on a black or white background under incident continuous light, for 3 weeks. Animal treatment was in agreement with the Declaration of Helsinki and the Dutch law concerning animal welfare, as verified by the committee for animal experimentation of Radboud University Nijmegen. Molecular cloning of X. laevis VPAC1-R We first identified a presumptive frog VPAC1-R sequence in the genome database (JGI version 4.1; Joint Genome Institute) of Xenopus tropicalis (which genome is fully known, in contrast to that of its close relative X. laevis) by searching for sequences with similarity to Rana ridibunda VPAC1-R, the only known amphibian VPAC1-R sequence, (18). This yielded sequences in the X. tropicalis genome on Scaffold 869. To locate strong homology regions, we conducted a BLAST search of the X. tropicalis genome using the R. ridibunda sequences. Then primers with 100% identity were designed, namely forward: 5’TTCATCATGAGAGCCATCGC-3’ and reverse: 5’GGCGAACATGATATAATGAAC-3’. With these primers and RT-PCR a VPAC1-R cDNA fragment from the X. laevis brain and pituitary neurointermediate lobe (NIL) was amplified and subsequently cloned into pGEM-T Easy vector following the manufacturer’s instructions (Promega, Madison, WI, USA). This vector was used for sequencing with the sequencing GenomeLab DTCS Quick start kit in a Beckman Coulter CEQ8000 genetic analysis system (Beckman Coulter, Fullerton, CA, USA). RNA extraction and cDNA synthesis After decapitation, freshly dissected NILs of 15 black-adapted animals were collected in Xenopus L15 (XL15) culture medium containing 67% Leibowitz medium (L15, Life Technologies, Paisley, UK), 0.1% kanamycin (Life Technologies) and 0.1% antibiotic/antimyotic solution (Life Technologies) with 0.08 mg/ml CaCl2 and 0.2 mg/ml glucose (pH 7.4). The NILs were then rinsed 3 times in XL15 and once in XL15

containing 10% foetal calf serum (FCS, Life Technologies). Then NILs were individually incubated in 48-well plates (Nunclon, Roskilde, Denmark), for 2 days at 22 °C, each well containing 300 µl XL15 with 10% FCS. During incubation, ten NILs were treated with 10-6 M neuropeptide Y (NPY; American Peptide Company, Sunnyvale, CA, USA) to keep POMC biosynthesis at a low level. On day 2, 10-5 M frog PACAP-38 (AnaSpec, San Jose, CA, USA) (we previously showed that both types of PACAP, PACAP-38 and PACAP-27, stimulate αMSH release with similar potency; for reference see 14) was added to five of the NPY-treated lobes, for 16 hours. Then, all NILs were individually collected in 500 µl ice-cold Trizol (Life Technologies) and homogenized by sonification. Total RNA was extracted with chloroform and precipitated with isopropyl alcohol, dissolved in 25 µl RNAse-free H2O, and measured with an Eppendorf Biophotometer (Vaudaux-Eppendorf AG, Basel, Switzerland). First strand cDNA synthesis was performed with 1 µg RNA and 5 mU/µl random primers (Roche, Mannheim, Germany), at 70 °C for 10 min, followed by double strand synthesis in strand buffer (Life Technologies) with 10 mM DTT, 20 U Rnasin (Promega), 0.5 mM dNTPs (Roche) and 100 U Superscript II reverse transcriptase (Life Technologies), at 37 °C for 75 min and at 95 °C for 10 min. RT-PCR and quantitative RT-PCR The hypothalamus was micro-dissected from the brain of 3 black-adapted animals and this tissue, in addition to NILs, distal lobes and samples of peripheral organs (heart, lung, muscle, kidney, liver and spleen, see Table 1) were individually collected in 500 µl ice-cold Trizol (Life Technologies) and homogenized by sonification. Total RNA was extracted with chloroform and precipitated with isopropyl alcohol, dissolved in 25 µl RNAsefree H2O, and measured with an Eppendorf Biophotometer (Vaudaux-Eppendorf AG, Basel, Switzerland). First strand cDNA synthesis was performed with 1 µg RNA and 5 mU/µl random primers (Roche, Mannheim, Germany), at 70 °C for 10 min, followed by double strand synthesis in strand buffer (Life Technologies) with 10 mM DTT, 20 U Rnasin (Promega), 0.5 mM dNTPs (Roche)

4

and 100 U Superscript II reverse transcriptase (Life Technologies), at 37 °C for 75 min and at 95 °C for 10 min. To determine if there is expression of the PAC1-R, RT-PCR was performed on the NIL and hypothalamic samples of the 3 animals. Each determination was performed in a total volume of 25 µl buffer containing 5 µl of template cDNA, 3 mM MgCl2, 0.625 U FastStart Taq DNA polymerase (Roche), 0.25 mM dNTPs (Roche) and 0.3 mM of each primer. The following primers were used for PAC1-R (accession no. AF187878), forward: 5’TGGCAATCACAATCAGAATC-3’, reverse: 5’GTCACAGGCTTCAGAGTAATG-3’ (product size: 398 bp). The optimum temperature cycling protocol, determined with a programmable thermal cycler (Eppendorf, Mastercycler gradient, Hamburg, Germany), was 95 °C for 30 sec, 60 °C for 30 sec and 72 °C for 2 min. After PCR, the reaction products were run on a 2% agarose gel and visualized with ethidium bromide to check the length of the amplified cDNA. To obtain a general overview of the level of expression of the VPAC receptor in various tissues real-time RT-PCR was performed for the hypothalamic and other tissue colleted from the 3 animals. Each determination was in a total volume of 25 µl buffer solution containing 5 µl of template cDNA, 12.5 µl SYBR Green Master Mix (Applied Biosystems Benelux, Nieuwerkerk aan den IJssel, The Netherlands) and 0.6 µM of each primer pair; VPAC1-R (Genbank accession no. EU547209), forward: 5’TTCATCATGAGAGCCATCGC-3 and reverse: 5’- TGGCCATGATGCAGTACTGG -3 (product size: 135 bp); GAPDH primer pair (GenBank accession no. U41753), forward: 5’GCTCCTCTCGCAAAGGTCAT-3’ and reverse: 5’-GGGCCATCCACTG TCTTCTG-3’ (product size: 101 bp). The optimum temperature cycling protocol was 95 °C for 10 min followed by 35 reaction cycles at 95 °C for 15 sec and at 60 °C for 1 min, using a 7500 Real Time PCR System (Applied Biosystems). For each mRNA, the cycle threshold (Ct) was determined, i.e., the number of cycles needed to reach an arbitrary fluorescence value (0.2) where Ct-values of

all mRNAs to be compared were within the linear phase of amplification. Quantitative RT-PCR was performed from NILs of 4 black-adapted and 4 whiteadapted animals in 3 independent quantitative RT-PCR runs (total 12 black-adapted and 12 white adapted animals). The following primer pairs were used; BDNF (Genbank accession no. EU363497), forward: 5’CTATATTATCCAGAGTTTCAG-3’ and reverse: 5’CACTCTTCTCACCTGATGGAA -3’ (product size: 101 bp), and for GAPDH and VPAC1-R the same primer sets were used as for real-time RT-PCR. The same cycling protocol was used as for real-time PCR. Then, to correct for possible variations in melanotrope cell content among different NIL samples, the Ct-values of VPAC1-R mRNA and BDNF mRNA were adjusted to ∆Ct values, by subtracting the corresponding Ctvalue of the mRNA of the housekeeping enzyme GAPDH. Then, the relative amount of mRNA (AmRNA) for VPAC1-R or BDNF, was calculated as 2-∆Ct, expressed in arbitrary units. The quantitative RT-PCR was performed in 3 independent experiments, which gave essentially the same results. Immunocytochemistry For immunocytochemistry, 4 black-adapted and 4 white-adapted frogs were transcardially perfused with 100 ml ice-cold 0.6% NaCl solution, for 5 min, followed by 250 ml icecold Bouin’s fixative for 15 min. After dissection, brains with the pituitary gland attached were postfixed in Bouin’s fixative, for 16 h at 4 oC, washed in 70% alcohol to eliminate excess of picric acid, for 24 h, further dehydrated through a graded series of ethanol, and embedded in paraffin. Coronal sections (7 µ) were mounted on poly-Llysine-coated slides (Sigma Chemical, St. Louis, MO, USA), allowed to air-dry, for 16 h at 45 oC, deparaffinized, and rehydrated. For immunodetection, the tyramide signal amplification (TSA) technique was applied as follows. Sections were pre-treated with 0.01 M sodium citrate (pH 6.0), and to quench endogenous peroxidase, incubated with 1% hydrogen peroxide in 0.1 M sodium phosphate-buffered saline (PBS), pH 7.4, for 30 min. After rinsing in PBS, sections were incubated for 30 min in PBS containing 0.5%

5

Triton X-100 (PBS-T; Sigma Chemical). To prevent aspecific binding, sections were, after rinsing in PBS, incubated for 1 h in incubation buffer, consisting of PBS-BT (PBS-T plus 0.5% TSA blocking reagent; NEN Life Science Products, Boston, MA, USA), 2.5% normal goat serum (NGS; Vector Laboratories) and 2.5% normal horse serum (NHS; Vector Laboratories). Then they were rinsed in avidine/biotine blocking solution (Vector Laboratories), for 15 min, and incubated with monoclonal mouse antiPACAP (generous gift from Dr J. Hannibal, Copenhagen, Denmark) diluted 1:50 in incubation buffer, for 16 h at 20 oC. After rinsing in PBS, sections were incubated in biotinylated secondary horse-anti-rabbit antiserum (Vector Laboratories) diluted 1:200 in incubation buffer, rinsed in PBS, and incubated in streptavidin conjugated to horseradish peroxidase (1:100; NEN Life Science Products), for 30 min. After rinsing in PBS, they were incubated in fluoresceinconjugated tyramide solution (1:200 in amplification diluent; NEN Life Science Products), for 30 min, rinsed in PBS, coverslipped in Fluorsave (Calbiochem, La Jolla, CA, USA), and examined with a Leica DMRBE light microscope (Leica Microsystems, Heerbrugg, Switzerland). Specificity of the antiserum The mouse monoclonal PACAP antiserum has been raised against the PACAP amino acid sequence 6-16 present in both PACAP38 and PACAP-27, and recognizes these PACAP types with high specificity (19, 20). In the present study we did not find any immunosignal in brain or pituitary gland when this serum was omitted from the immunocytochemical procedure or was used after its preadsorption with excess synthetic rat PACAP-27 (AnaSpec, San Jose, CA, USA). Morphometry Digital images were taken in 3 consecutive coronal sections per animal in the middle part of the neural lobe, at a resolution of 1200 x 1600 dpi, with a Leica DMRBE optical system and Leica DC 500 digital camera (Leica Microsystems) connected to an IBM computer running Scion Image software (version 3.0b; NIH, Bethesda, MD, USA). The density of the immunofluorescence signal

was measured using Image J software (version 1.37, NIH) and corrected for the background density outside the neural lobe in the unstained intermediate lobe, yielding the specific signal density (SSD) expressed in arbitrary units. Statistics Data were expressed as mean and standard error of the mean per experimental group, and analyzed by Student’s t-test (α=5%) using Microsoft Excel software.

Results Cloning and distribution of VPAC1-R With RT-PCR, no amplification signal was detected for PAC1-R mRNA in the NIL, whereas there was strong amplification signal in the hypothalamus (Fig. 1). We next studied the presence of the other receptor of PACAP, VPAC1-R. Including the primer sequences, the isolated and sequenced X. laevis VPAC1R mRNA fragment contained 525 bp, and corresponded to the transmembrane domains II - VI of VPAC1-R. The sequence of VPAC1-R is submitted to GenBank, (accession no. EU547209). The sequenced fragment showed strong homology with the corresponding VPAC1-R fragment of X. tropicalis (91%), R. ridibunda (80%), chicken (77%), mouse (74%) and rat (74%). The distribution of VPAC1-R mRNA in different brain regions and in various peripheral organs was studied using real-time RT-PCR. We found mRNA expression in all regions and organs studied, with similar degrees of expression (Table 1). Background-related expression of VPAC1-R mRNA in the NIL Using quantitative RT-PCR, VPAC1-R mRNA expression in the NIL was tested for its possible regulation by the background light condition. As Fig. 2 shows, the VPAC1R mRNA expression in NILs of whiteadapted frogs appeared to be approximately 4 times as high as in NILs of black-adapted animals (n = 4; P < 0.005). PACAP-immunoreactivity in the pituitary neural lobe Only weak, dispersed PACAPimmunoreactivity was observed in

6

neurohemal axon terminals in the neural pituitary lobe of black-adapted animals (Fig. 3A). In white-adapted animals, however, PACAP-immunoreactivity appeared to be very strong and extensive (Fig. 3B). No PACAP-immunoreactivity was found in the intermediate lobe (which contains the melanotrope cells), nor in the distal part of the pituitary gland. To quantify the effect of background light intensity on PACAPimmunoreactivity in the neural lobe, the SSD of PACAP-immunofluorescence was determined (Fig. 4). The SSD appeared to be 7 times higher in neural lobes of whiteadapted animals (9.40 ± 2.79) than in those of black-adapted ones (1.35 ± 0.09; P < 0.05). Effect of PACAP on BDNF mRNA expression To study if PACAP can stimulate the expression of BDNF mRNA in the NIL, BDNF mRNA expression was first suppressed by incubating NILs in NPY, enabling the reduced expression to be stimulated again by PACAP. Quantitative RT-PCR revealed that, compared to untreated control lobes, 10-6 M NPY decreased the amount of BDNF mRNA by 4.8 times (P < 0.0001), while 10-6 M NPY + 10-5 M PACAP increased the amount of BDNF mRNA compared to NPY-treated NILs, by 2.7 times (P < 0.005; Fig. 5). Discussion We have previously shown that PACAP stimulates αMSH secretion in isolated melanotrope cells of Xenopus laevis. Pharmacological studies have indicated that this action of PACAP would be through VPAC1-R/VPAC2-R rather than through PAC1-R, as PACAP and VIP were equipotent in stimulating the secretory activity of the melanotropes (14). Extending these findings, we here demonstrate the presence of VPAC1R mRNA in the NIL of X. laevis whereas the NIL did not show any expression of PAC1-R mRNA. This latter observation extends an in situ hybridization study showing that the Xenopus intermediate pituitary lobe lacks a hybridization signal for PAC1-R mRNA (21). This is the first report of the presence of a sequence with a coding region for VPAC1-R in the X. laevis pituitary gland. This sequence is strongly homologous to that of VPAC1-R in other non-mammalian as well as in

mammalian species and, furthermore, it is expressed in the central nervous system and in all peripheral organs studied. In fact, its brain and peripheral occurrence is similar to that of VPAC1-R in R. ridibunda (18), zebrafish (22) and mammals (23). This similarity underlines the importance of the pleiotropic actions of this receptor throughout the vertebrate class. In this study we could only identify one VPAC1-R, despite the fact that Xenopus laevis has undergone wholegenome duplication. Therefore, we do not know if the quantitative RT-PCR is measuring one form or both forms of VPAC1-R expression. Also, we can not rule out the possibility that Xenopus possesses a VPAC2 receptor, since such a receptor is reported for the frog R. tigrina rigulosa (24). The, VPAC1-R expression is under control of the background light condition, as we have demonstrated a substantially higher amount of VPAC1-R mRNA in the NIL of white-adapted than of black-adapted frogs. Although the amount of mRNA in melanotropes of white-adapted Xenopus is generally down-regulated compared to blackadapted frogs (15, 17, 25-27), an observation in line with the smaller size and lower cellular activity of such cells, VPAC1-R mRNA is not the only receptor mRNA that is up-regulated under white background condition. Placing frogs on a white background up-regulates TRH-R3 mRNA and CRH-R1 mRNA (28, 29). Interestingly, PACAP, TRH and CRH all stimulate αMSH-secretion from Xenopus melanotropes (12, 14, 30). Possibly, upregulation of VPAC1-R, TRH-R3 and CRHR1 is part of a mechanism by which melanotropes of white-adapted animals are sensitized to stimulatory input so that, as soon as the animal is placed on a black background, the cells can quickly start to secrete αMSH in order to achieve rapid skin colour adaptation to the new environmental light situation. Nerve terminals in the neural lobe are the source of a number of stimulatory neuropeptides including TRH, CRH and urocortin. These peptides are presumed to diffuse from the neural lobe into the pars intermedia to act upon the melanotropes (for review see 13). Retrograde tracing studies with DiI and horseradish peroxidase showed that the nerve terminals in the neural lobe originate exclusively from magnocellular

7

neurons (31). Previous studies have demonstrated PACAP-containing axon terminals in the Xenopus neural lobe (14) and in situ hybridization studies have shown a complete lack of PACAP mRNA in the Xenopus pitutitary gland but show the presence of PACAP-positive neurons in the magnocellular nucleus (21). The present study reveals that the neural lobe of whiteadapted X. laevis has a dramatically higher PACAP-content than that of black-adapted frogs. The low PACAP content in blackadapted frogs is likely due to strong PACAP release from the neurohemal axon terminals, while in the neural lobe of white-adapted animals PACAP would be stored. Since we know that PACAP stimulates αMSH release from isolated melanotrope cells (14), the demonstration of background-dependent changes in PACAP dynamics in the neural lobe provides strong evidence that magnocellular PACAP, released from nerve terminals of the pars nervosa, stimulates αMSH release when frogs are placed on black background. This physiological, stimulatory action of PACAP on Xenopus melanotropes is likely not restricted to αMSH secretion, as our earlier in vitro study showed that PACAP also stimulates POMC gene expression and POMC biosynthesis (14). In mouse cortical neurons and astrocytes, PACAP stimulates the expression of BDNF (7). From this observation and our observation that the Xenopus melanotrope cell sequesters and releases αMSH together with BDNF (16), we have hypothesized that in Xenopus melanotropes, PACAP is involved in

the co-regulation of POMC and BDNF gene expression. Recently, we found that the Xenopus BDNF gene possesses 7 promoters and analysis of the expression of promoterspecific exons revealed that BDNF transcript IV is strongly up-regulated in NILs of frogs placed on a black background (A.H. Kidane et al., unpublished data). Therefore, in the present study we focused our attention on BDNF transcript IV. Our results show that PACAP stimulates BDNF mRNA expression, supporting our hypothesis that PACAP regulates the expression of both POMC and BDNF genes. Like the POMC gene (32), the BDNF gene has been duplicated and both the two POMC and two BDNF transcripts are upregulated to a similar degree by PACAP treatment (A.H. Kidane, unpublished results). In conclusion, we provide evidence that PACAP plays an important role in regulating the activity of Xenopus melanotrope cells, as a function of adaptation to background illumination. Since the neural lobe releases a wide variety of neuro-active factors that are able to stimulate melanotrope cell activity in vitro (12-14, 24,), it will be of interest to assess the interplay between PACAP and these factors in the integrative control of melanotrope cell activity and plasticity in X. laevis. Acknowledgements The authors are grateful to Peter M.J.M. Cruijsen, Ron J.C. Engels, and Frouwke J. Kuijpers-Kwant for technical assistance.

8

References 1.

2.

3. 4.

5. 6.

7. 8. 9. 10.

11.

12. 13. 14.

15.

16.

17.

18.

Sherwood NM, Krueckl SL, McRory JE 2000 The origin and function of the pituitary adenylate cyclase-activating polypeptide (PACAP)/glucagon superfamily. Endocr Rev 21:619670 Buscail L, Gourlet P, Cauvin A, De Neef P, Gossen D, Arimura A, Miyata A, Coy DH, Robberecht P, Christophe J 1990 Presence of highly selective receptors for PACAP (pituitary adenylate cyclase activating peptide) in membranes from the rat pancreatic acinar cell line AR 4-2J. FEBS Lett 262:77-81 Arimura A 1998 Perspectives on pituitary adenylate cyclase activating polypeptide (PACAP) in the neuroendocrine, endocrine, and nervous systems. Jpn J Physiol 48:301331 Vaudry D, González BJ, Basille M, Yon L, Fournier A, Vaudry H 2000 Pituitary adenylate cyclase-activating polypeptide and its receptors: from structure to functions. Pharmacol Rev 52:269-324 Vaudry H, Laburthe M 2006 VIP, PACAP and related peptides: from gene to therapy. Ann NY Acad Sci Blackwell Publishers. Pp. 500. Rene, F., Monnier, D., Gaiddon, C., Felix, J.M., Loeffler, J.P 1996 Pituitary adenylate cyclase-activating polypeptide transduces through cAMP/PKA and PKC pathways and stimulates proopiomelanocortin gene transcription in mouse melanotropes. Neuroendocrinology 64:2-13 Pellegri G, Magistretti PJ, Martin JL 1998 VIP and PACAP potentiate the action of glutamate on BDNF expression in mouse cortical neurones. Eur J Neurosci 10:272-280 Bagnara JT, and Hadley ME 1973 Chromatophores and Color Change: The Comparative Physiology of Animal Pigmentation. Englewood Cliffs, NJ: Prentice Hall Wilson JF, Morgan MA 1979 α−Melanotropin-like substances in the pituitary and plasma of Xenopus laevis in relation to colour change responses. Gen Comp Endocrinol 38:172-182 De Rijk EPCT, Jenks BG, Wendelaar Bonga SE 1990 Morphology of the pars intermedia and the melanophore-stimulating cells in Xenopus laevis in relation to background adaptation. Gen Comp Endocrinol 79:74-82 Martens GJM, Weterings KAP, van Zoest ID, Jenks BG 1987 Physiologically-induced changes in proopiomelanocortin mRNA levels in the pituitary gland of the amphibian Xenopus laevis. Biochem. Biophys. Res Commun 143:678-684 Roubos EW, Scheenen WJJM, Jenks BG 2005 Neuronal, neurohormonal, and autocrine control of Xenopus melanotrope cell activity. Ann NY Acad Sci 1040:172-183 Jenks BG, Kidane AH, Scheenen WJJM, Roubos EW 2007 Plasticity in the melanotrope neuroendocrine interface of Xenopus laevis. Neuroendocrinology 85:177-185 Kidane AH, Cruijsen PMJM, Ortiz-Bazan MA, Vaudry H, Leprince J, Kuijpers-Kwant FJ, Roubos EW, Jenks BG 2007a Actions of PACAP and VIP on melanotrope cells of Xenopus laevis. Peptides 28:1790-1796 Kramer BMR, Cruijsen PMJM, Ouwens DTWM, Coolen MW, Martens GJM, Roubos EW, Jenks BG 2002 Evidence that brain-derived neurotrophic factor acts as an autocrine factor on pituitary melanotrope cells of Xenopus laevis. Endocrinology 143:1337-1345 Wang LC, Meijer HK, Humbel BM, Jenks BG, Roubos EW 2004 Activity-dependent dynamics of coexisting brain-derived neurotrophic factor, pro-opiomelanocortin and αmelanophore-stimulating hormone in melanotrope cells of Xenopus laevis. J Neuroendocrinol 16:19-25 Kidane AH, van Dooren SH, Roubos EW, Jenks BG 2007b Expression and physiological regulation of BDNF receptors in the neuroendocrine melanotrope cell of Xenopus laevis. Gen Comp Endocrinol 153:176-181 Alexandre D, Anouar Y, Jegou S, Fournier A, Vaudry H 1998 A cloned frog vasoactive intestinal polypeptide/pituitary adenylate cyclase-activating polypeptide receptor exhibits

19. 20.

21.

22.

23. 24.

25.

26.

27.

28.

29.

30.

31.

32.

pharmacological and tissue distribution characteristics of both VPAC1 and VPAC2 receptors in mammals. Endocrinology 140:1285-1293 Hannibal J 2002 Pituitary adenylate cyclase-activating peptide in the rat central nervous system: an immunohistochemical and in situ hybridization study. J Comp Neurol 453:389-417 Hannibal J, Mikkelsen JD, Clausen H, Holst JJ, Wulff BS, Fahrenkrug J 1995 Gene expression of pituitary adenylate cyclase activating polypeptide (PACAP) in the rat hypothalamus. Regul Pept 55:133-148 Hu Z, Lelievre V, Tam J, Cheng JW, Fuenzalida G, Zhou X, Waschek JA 2000 Molecular cloning of growth hormone-releasing hormone/pituitary adenylyl cyclase-activating polypeptide in the frog Xenopus laevis: Brain distribution and regulation after castration. Endocrinology 141:3366-3376 Fradinger EA, Tello JA, Rivier JE, Sherwood NM 2005 Characterization of four receptor cDNAs: PAC1, VPAC1, a novel PAC1 and a partial GHRH in zebrafish. Mol Cell Endocrinol 231:49-63 Usdin TB, Bonner TI, Mezey E 1994 Two receptors for vasoactive intestinal polypeptide with similar specificity and complementary distributions. Endocrinology 135:2662-2680 Hoo RLC, Alexandre D, Chan SM, Anouar Y, Pang RTK, Vaudry H, Chow BKC 2001 Structural and functional identification of the pituitary adenylate cyclase-activating polypeptide receptor VPAC2 from the frog Rana tigrina rugulosa. J Mol Endocrinol 27:229-238 Kolk SM, Berghs CAFM, Vaudry H, Verhage M, Roubos EW 2001 Physiological control of Xunc18 expression in neuroendocrine melanotrope cells of Xenopus laevis. Endocrinology 142:1950-1957 Kolk SM, Groffen AJ, Tuinhof R, Ouwens DTWM, Cools AR, Jenks BG, Verhage M, Roubos EW 2004 Differential distribution and regulation of expression of synaptosomalassociated protein of 25 kDa isoforms in the Xenopus pituitary gland and brain. Neuroscience 128:531-543 Jenks BG, Ouwens DTWM, Coolen MW, Roubos EW, Martens GJM 2002 Demonstration of postsynaptic receptor plasticity in an amphibian neuroendocrine interface. J Neuroendocrinol 14:843-845 Bidaud I, Galas L, Bulant M, Jenks BG, Ouwens DT, Jegou S, Ladram A, Roubos EW, Tonon MC, Nicolas P, Vaudry H 2004 Distribution of the mRNAs encoding the thyrotropinreleasing hormone (TRH) precursor and three TRH receptors in the brain and pituitary of Xenopus laevis: effect of background color adaptation on TRH and TRH receptor gene expression. J Comp Neurol 477:11-28 Calle M, Jenks BG, Corstens GJH, Veening JG, Barendregt HP, Roubos EW 2006 Localisation and physiological regulation of corticotrophin-releasing factor receptor 1 mRNA in the Xenopus laevis brain and pituitary gland. J Neuroendocrinol 18:797-805 Calle M, Corstens GJ, Kozicz LT, Denver RJ, Barendregt HP, Roubos EW 2005 Evidence that urocortin I acts as a neurohormone to stimulate αMSH release in the toad Xenopus laevis. Brain Res 1040:14-28 Tuinhof R, Artero C, Fasolo A, Franzoni MF, Ten Donkelaar HJ, Wismans PG, Roubos EW 1994 Involvement of retinohypothalamic input, suprachiasmatic nucleus, magnocellular nucleus and locus coeruleus in control of melanotrope cells of Xenopus laevis: a retrograde and anterograde tracing study. Neuroscience 61(2):411-420 Deen PM, Bussemakers MJ, Terwel D, Roubos EW, Martens GJ 1992 Comparative structural analysis of the transcriptionally active proopiomelanocortin genes A and B of Xenopus laevis. Mol Biol Evol 9:483-494

10

Figure Legends Figure 1. Agarose gel electrophoresis of PAC1-R mRNA reaction product of RT-PCR on total RNA from the Xenopus laevis neurointermediate lobe (NIL) and hypothalamus (Hyp), using primers for the X. laevis receptor. Note absence of visible PAC1-R mRNA in NIL. Molecular weight markers are indicated at the left.

Figure 2. Quantitative RT-PCR analysis of VPAC1-R mRNA expression in NILs of black- (B) and white- (W) adapted X. laevis. The amount of mRNA, AmRNA, is expressed in arbitrary units on the basis of 2-∆Ct. The two group means (n=4), presented with the standard error of the mean, differ statistically at P < 0.005. Figure 3. Fluorescence immunocytochemistry of PACAP in the pituitary gland, showing (A) low immunoreactivity in neural lobe (n) of black-adapted and (B) high immunoreactivity in the neural lobe of white- adapted X. laevis. d = distal lobe, i = intermediate lobe. Bar = 50 µm. Figure 4. Specific signal density (SSD) of PACAP-immunoreactivity in the neural lobe of the pituitary gland of black- (B) and white- (W) adapted X. laevis. The two group means (n = 4), presented with the standard error of the mean, differ statistically at P < 0.05. Figure 5. Quantitative RT-PCR analysis of BDNF mRNA expression in control NILs (C) and in NILs treated with 10-6 M NPY (N) or with 10-6 M NPY + 10-5 M PACAP38 (N + P) of black- (B) and white- (W) adapted X. laevis. The relative amount of mRNA, AmRNA, is expressed in arbitrary units on the basis of AmRNA = 2-∆Ct. Means (n = 4) between two groups, presented with the standard error of the mean, differ statistically at P < 0.005 (*) or P < 0.0001 (**).

11

Table 1. Real-time RT-PCR analysis of the expression of VPAC transcript in different tissues in Xenopus laevis

Remove brain from table VPACR1 GAPDH 24.65 16.51 Brain 18.29 Hypothal 24.35 25.95 20.49 Heart 25.59 20.99 Lung 25.59 16.89 Muscle 30.24 22.64 Kidney 25.36 16.36 Liver 28.07 21.87 Spleen 25.51 21.26 PD 24.36 19.12 NIL 40 40 NTC Real-time RT-PCR on total RNA from different tissues. The Ct (cycle threshold) values after a PCR run of 40 cycles. The PCR determination included an analysis of the expression of the housekeeping gene GAPDH. A high Ct value represents a low expression and a low Ct value represents a high expression. NTC = non template control; hypothal = hypothalamus.

Figure 1

13

Figure 2

14

Figure 3

15

Figure 4

16

Figure 5

17