the method described by Suzuki et al.45 The wild- ..... ular complexes of wild-type p53 with proteins of .... Kanematsu T: Mutations in the Kirsten-ras oncogene.
American Jouirnzal of Patbology, Vol. 142, No. 5, May 1993 Copyright ©) American Society for Investigative Pathology
Pancreatic Adenocarcinomas Frequently Show p53 Gene Mutations
Aldo Scarpa,*t Paola Capelli,*t Kiyoshi Mukai,* Giuseppe Zamboni,t Tatsuya Oda,* Calogero lacono,A and Setsuo Hirohashi* From the Pathology Division,* National Cancer Center Research Institute, Tokyo, Japan, and Istituto di Anatomia Patologicat and Clinica Chirurgica,t Universitd di Verona, Verona, Italy
Thirty-four pancreatic adenocarcinomas were studiedfor the presence ofp53 gene mutations by the single-strand conformation polymorphism method and by direct sequencing of PCRampliftedfragments. p53 protein expression was immunohistochemically evaluated using monoclonal PAb1801 and polyclonal CM1 antibodies. Mutations were detected in 14 cases. The transitions were six G to A and two A to G; the transversions were one C to G and two A to C the remaining three were frameshift mutations. Immunostaining results were identical with both antibodies. Nuclear immunohistochemical p53positive cells were found in nine p53 mutated cases and in 12 cases in which no mutation was detected In most of these latter cases only a minority of cancer ceUs showed immunohistochemical positivity. Twenty-nine cases, including aU p53 mutated cancers, were known to contain codon 12 Ki-ras gene mutations. Also in the light of the demonstrated cooperation of ras and p53 gene alterations in the transformation ofcultured ceUls, our data suggest that P53 mutation is one of the genetic defects that may have a role in the pathogenesis of a proportion ofpancreatic cancers.
(Am JPathol 1993, 142:1534-1543)
There is increasing evidence that the accumulation of genetic abnormalities, activating the oncogenic potential of protooncogenes and inactivating the growth repressor function of tumor suppressor genes, underlies the multistage processes of tumorigenesis and progression of malignancy.1
1534
Different studies have consistently reported a strong association of codon 12 Ki-ras gene mutations with pancreatic adenocarcinoma.2 7 Very little is known, however, about additional genetic abnormalities in this malignancy. In a recent study,8 nuclear accumulation of p53 protein was immunohistochemically detected in a portion of primary pancreatic carcinomas, accounting for up to 60% of cases when analyzed on frozen samples. In the same study p53 gene mutations were found in five of seven and three of five immunohistochemically positive cell lines and primary cancers, respectively. Mutations of p53 gene are frequent genetic abnormalities in different human malignancies.9 This gene encodes a 53-kd DNA binding nuclear phosphoprotein with a short half-life that negatively regulates cell growth and proliferation,10-12 and its alteration or loss is thought to deprive the cell of these inhibitory signals. Many mutated proteins show a prolonged half-life, and their accumulation in th-e nuclei of the affected cells may be immunohistochemically detectable using p53-specific monoclonal antibodies.8 13-15 Mutant p53 alleles may act according to either a recessive or a dominant-negative genetic model. Their recessive behavior is suggested both at the experimental level16-18 and by the demonstration, in several human tumors, that the mutation of one allele is consistently associated to the loss of the other p53 gene locus.9 13'19-21 Different p53 mutant alleles, however, can transform target cells in vitro and cause tumorigenesis in transgenic mice even in the presence of the normal allele.22'23 Although the most frequent causative factor accounting for the nuclear accumulation of p53 in difSupported by a grant-in-aid for the Comprehensive 10-Year Strategy for Cancer Control from the Ministry of Health and Welfare of Japan and by a grant of the Associazione Italiana per la Ricerca sul Cancro, Milan, Italy. AS and PC have been supported by a Foreign Research Fellowship of the Foundation for Promotion of Cancer Research, Tokyo, Japan. TO has been awarded a Research Resident Fellowship. Accepted for publication October 6, 1992. Address reprint requests to Aldo Scarpa, M.D., Ph.D., Istituto di Anatomia Patologica, UniversitA di Verona, Policlinico Borgo Roma, 1-37134 Verona, Italy.
p53 Mutations in Pancreatic Cancer 1535 AJP May 1993, Vol. 142, No. 5
ferent tumors has been shown to be the presence of p53 gene mutations, other mechanisms could be responsible for this phenomenon. These include the formation of stable molecular complexes of p53 with a variety of viral proteins,24 26 as well as with peculiar host proteins, such as heat shock (hsp7O)27-29 or MDM2 proteins.30 The study of the mutational spectrum of the p53 gene in pancreatic cancer might be of greater interest than that of the Ki-ras gene. In fact, whereas mutations of Ki-ras gene in cancer are essentially restricted to one codon, those altering the function of p53 gene are distributed troughout a significant region of the coding sequence (ie, exons 5-8).9 We could expect that the study of the pattern of p53 gene mutation in pancreatic cancer may provide relevant information about the origins of mutations. In fact, exogenous carcinogens and endogenous sources of mutations generate specific kinds of base substitutions at certain preferred sites.9 The aim of this study was to explore the presence and pattern of mutations of the p53 gene and of p53 protein immunohistochemical expression in a panel of human pancreatic adenocarcinomas and to compare the results with clinicopathological data. We used a simple and sensitive method for the detection of structural alterations of DNA including point mutations, which is single-strand conformation polymorphism (SSCP) analysis of DNA fragments obtained by the polymerase chain reaction (PCR) (PCR-SSCP analysis).3132 This method has been successfully used for the detection of mutations in different genes (for a review see Ref. 32), including ras family33 and p53 genes.34-38 Our study shows that, in pancreatic adenocarcinoma, p53 gene mutations are frequent genetic abnormalities, often associated with the immunodetectable nuclear accumulation of p53 protein. Also in the light of the demonstrated cooperation of mutated ras and p53 genes in in vitro transforming assays,39 our data suggest that p53 mutation is one of the genetic defects that may have a role in the pathogenesis of a proportion of pancreatic cancers.
Materials and Methods Pathologic Samples and Controls Thirty-five samples of pancreatic tissue were collected from the Pathology Departments of Verona University, Verona, Italy (21 cases) and of the National Cancer Center of Tokyo, Japan (14 cases). All samples were collected at the time of surgery from the same number of patients with pancreatic adenocarcinomas, except Japanese case 1, which was
obtained at autopsy. Formalin-fixed paraffinembedded tissues were used for conventional histology. Frozen or AMeX-fixed paraffin-embedded tissues40 were used for immunohistochemical reactions and as a source of DNA. High-molecularweight DNA was extracted according to described procedures from frozen samples,41 including all of the Italian and six of the Japanese cases, and from AMeX-fixed paraffin-embedded tissues42 in the remaining eight Japanese samples (J6-J12 and J14). Before DNA extraction, 5-pm hematoxylin-eosinstained sections were examined to verify the exact tissue analyzed and to evaluate neoplastic cellularity. All samples contained a proportion of cancer cells ranging from 5% to 80%, except for two Italian samples (cases 2 and 13) in which cancer cells were less than 5%. The frozen section of Italian case 6 displayed a pattern of intraductal papillary dysplasia. All cases but five (cases 2, 6, 10, 13, and J13) showed Ki-ras codon 12 mutations in previous experiments (Capelli et al, in preparation) (see Tables 1 and 2). DNA from Italian case 18 was unamplifiable in four different PCR experiments using primers to amplify the Ki-ras gene. In 13 Italian cases (cases 1-12 and 21), normal tissue from the same patients was also available and was used as an internal control in DNA study.
PCR-SSCP Analysis and DNA Sequencing As 98% of p53 gene mutations in different cancers have been found in exons 5-8,9 we focused our study on these exons. PCR-amplified fragments were analyzed by the SSCP method.3132 The positive cases were further analyzed by direct sequencing of PCR products.
Oligonucleotide Primers The oligonucleotides were synthesized by the phosphoramidite method with a DNA synthesizer model 380A (Applied Biosystem Company, Tokyo) and purified through OPC columns following the manufacturer's instructions. The sequences of primers, derived from published sequences,43 used to PCRamplify different exons of p53 gene were as follows (5'-3'): exon 5, TTCCTCTTCCTGCA-GTACTCC and GCCCCAGCTGCTCACCATCG; exon 6, CGATGGTGAGCAGCTGGGGC and AGTTG-CAAACCAGACCTCA; exon 7, TCCTAGGTTGGCTCTGAC and CAAGTGGCTCCTGACCTGGA; exon 8, CCTATCCTGAGTAGTGGTAA and CCTGCTTGCTTACCTCGCT.
1536 Scarpa et al AJP May 1993, Vol. 142, No. 5
Table 1. Italian Pancreatic Adenocarcinomas: Clinicopathological Data
Case*
Age/sex
Histologyt
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
76/M 67/M 67/M 59/F 76/M 61/M 59/F 42/M 73/M 57/F 60/F 56/M 48/M 61/F 65/F 69/F 57/M 68/M 46/F 49/M 62/F
P M
P M M W M M M M M M Mucinous P M P M M P M W
Maximum diameter 7 3 2 6
2 2.5 3 2 2.5 3 3 5 3 5 5.5 3 5.4 6 8 2.5 4
Metastasist distant LN + _ + + NA + + NA + _
_ +
+ -
-
+ + -
Follow-up/
Gene mutation
months§
K-rasl
p53n
DOD/4 AD/1i DOD/13 DOD/8 DOD/18 DOD/34 DOD/16 AW/33 AW/28 DOD/12 DOD/22 AW/4 DOD/13 DOD/10
GTT
+ -
IOD
DOD/14 DOD/3 AD/11 DOD/6 DOD/8 AW/5
-
p53 immunohistochemistry ++
GTT GAT GAT GTT GAT GTT
+ + -
-
-
+
GTT GTT GAT GAT GTT GAT NA GTT GAT GAT
+ -
+++
-
+ + +
+ +
++++ ++++
+++
-
++++
+
+
+
++++
All the tumors were localized at the head of pancreas except cases 1, 16, 19 in which the tumor was body-tail, and 10 tail. W, M, P = well, moderately, and poorly differentiated. Case 19 had a synchronous liver metastasis. Metachronus metastatic disease was present in: case 4, liver after 7 months; case 6, liver and peritoneum after 30 months; case 11, liver after 12 months; case 2 had a lymph node metastasis 14 months later. § All cases were treated with pancreatoduodenectomy except: 1, 10, and 16 = left pancreatectomy; 13 and 18 = palliation. I All K-ras gene mutation involved codon 12 (GGT). ¶n In cases 2 and 13 the neoplastic cells in the frozen samples accounted for less than 5%. The frozen sample of case 6 was represented by ductal hyperplasia and atypia. Abbreviations: AD = alive with disease; AW = alive and well; DOD = died of disease; IOD = intraoperatory death. *
t t
Table 2. Japanese Pancreatic Adenocarcinomas: Clinicopathological Data
Case* Ji J2 J3 J4 J5 J6 J7 J8 J9
Jio
Jil J12 J13 J14
Age/sex
Histologyt
60/M 77/M 75/F 77/F 75/F 69/M 72/F 51/F 52/M 73/F 47/F 55/M 73/M 70/F
W W M W P M P M M M W W
Mucinous M
Maximum diameter
NA 2.5 3 2 13 2.7 2.7 7 8 NA 3.8 2.5 8 3
Metastasis distantt LN NA + + + + + + + + + + + + +
Follow-up/
Gene mutation p53
months§
K-ras4
NA -
Autoptic DOD/17
-
DOD/7 AW/31 DOD/6 AD/5 DOD/2 DOD/5 DOD/3 DOD/i AW/9 DOC/3
GTT GAT GAT GTT CGT GAT GTT GAT GAT GAT GTT GAT -
-
-
+ -
DOC/13
-
-
AW/4
GAT
p53 immunohistochemistry
+ +++ + ++ + + -++++ ++ -+++ + + + + + +
* All the tumors were localized at the head of pancreas except case J13 body-tail, and J10 body. Patient J13 had an ampullary carcinoma 7 years before. Patient J14 had a gastric carcinoma 16 years before. t W, M, P = well, moderately, and poorly differentiated. $ Case J10 had a synchronous liver metastasis. § All cases were treated with pancreatoduodenectomy except: XXX = left pancreatectomy; J10 = palliation. All K-ras gene mutation involved codon 12 (GGT). Abbreviations: AD = alive with disease; AW = alive and well; DOD = died of disease; DOC = died of other causes.
Such primers amplify DNA fragments of the following respective lengths: 215 bp for exon 5; 204 bp for exon 6; 138 bp for exon 7; and 176 bp for exon 8. This allows the effective analysis by SSCP of the following p53 gene sequences: exon 5, codons 128-184; exon 6, codons 187-222 and 66 bp of intron 5; exon 7, codons 229-259; exon 8, codons 264-304.
PCR The primers were 5'-end-labeled with [y-32P]ATP as previously described.44 The PCR mixture contained 0.25 pmol each of the labeled primers, 2 nmol each of the four deoxynucleotides, 0.1 pg of genomic sample DNA, and 0.25 U of Taq polymerase in 10 pl of the buffer specified in the Gene
p53 Mutations in Pancreatic Cancer 1537 AJP May 1993, Vol. 142, No. 5
Amp kit (Perkin-Elmer Cetus, Norwalk, CT). Thirtyfive cycles of the reaction at 94 C, 55 C, and 72 C for 0.5, 0.5, and 1 min, respectively, were run in a Thermocycler (Perkin-Elmer Cetus).
SSCP Two p1 of the PCR mixture were mixed with 2 p1 of 95% formamide, 20 mmol/L EDTA, 0.05% bromophenol blue, and 0.05% xylene cyanol, heated at 80 C, and applied (1 p1/lane) to a 6% polyacrylamide gel (20 x 40 x 0.03 cm, 0.5 cm/lane) containing 90 mmol/L Tris-borate (pH 8.3) and 4 mmol/L EDTA. To obtain maximum sensitivity in the SSCP analysis, the samples were also run on two additional 6% polyacrylamide gels, the first in a cold room, the second at room temperature with the addition of 5% glycerol. Electrophoresis was performed at 30 W for 2-6 hours with cooling by fans. The gels were dried on filter paper and exposed to X-ray film at -80 C for 0.5-12 h with an intensifying screen (DuPont, Dreiheich, Germany).
Direct DNA Sequencing Abnormal bands detected by SSCP analysis were eluted from the gel and amplified by 55 cycles of asymmetric (20:1 primer ratio) PCR according to the method described by Suzuki et al.45 The wildtype bands of the same cases were also eluted from the same gels and sequenced, as an internal control. In 4 cases (J14, 16, 17, 18) PCR sequencing was also performed directly from genomic DNA. The single-strand products were purified with a Centricon 30 microconcentrator (Amicon, Beverly, MA) and subjected to sequencing using a 7-deaza GTP Sequenase ver.2 kit (USB, Cleveland, OH) with
5'-end-labeled primers.46 The products were analyzed in 6% polyacrylamide gels containing 5 mol/L urea. The sense (s) and antisense (a) sequencing primers of each exon were as follows (5'-3'): 5s TCTTCCTGCAGTACTCCCCT, 5a AGCTGCTCACCATCGCTAT; 6s CACTGATTGCT-CTTAGGT, 6a TGCAAACCAGACCTCAGG; 7s TAGGTTGGCTCTGACTGT, 7a GTGGCTCCTGACCTGGAGTC; 8s ATCCTGAGTAGTGGTAATCT, 8a GCTTGCTTACCTCGCTTAGT.
Immunohistochemical Analysis All cases were characterized on frozen or AMeXfixed sections for the presence of p53 protein using the anti-p53 monoclonal antibody PAb18O1 (Oncogene Science, Inc., Manhasset, NY) that recognizes a denaturation-resistant epitope between amino acids 32 and 79.47 All Italian cases were also stained with CM1 anti-p53 polyclonal antibody,48 which is reactive on formalin-fixed paraffin sections. lmmunohistochemical analysis was performed as previously described.49 Briefly, frozen or AMeX-fixed sections were incubated for 1 hour in a humid chamber with anti-p53 antibody diluted 1:50 inphosphate-buffered saline containing 20% rabbit serum and 0.1% saponin. The same procedure was used for the paraffin sections staining with CM1 antibody (diluted 1:1000) except for the incubation step, which was performed overnight. Antibody localization was determined using the standard avidin-biotin-peroxidase technique.
Results The clinicopathological characteristics of the patients are summarized in Tables 1 and 2. The results
Table 3. Mutations ofp53 Gene in Pancreatic Adenocarcinomas Case
Sequence Exon
Codon
mutation
5 5 5 5 7 7 7 8
132 152 175 177 249 243-245 258 295
AAG -AGG CCG - del CC CGC -CAC CCC-4CGC AGG - GGG
5 5 5 6 7 8
175 173 139 215 245 272
Italian 1 4 17 21 5 11 20 19
Japanese J2 J3 J14 J1
J10 J9
Insertion of G and duplication of codons 243 and 244.
Complex*
GAA - AAA CCT -4 del CC CGC -CAC
A GTG ATG
AAG -ACG AGT -CGT GGC -*GAC
GTG - ATG
Protein mutation Lys - Arg Frameshift + STOP n179 Arg -His Pro -Arg Arg eGly Frameshift + STOP n265 Glu - Lys Frameshift + STOP n304 Arg -His Val -Met Lys eThr Ser -Arg Gly -Asp Val Met
1538
Scarpa et al
AJP May 1993, Vol. 142, No. 5
of SSCP and sequence analyses are summarized in Table 3 and those of immunohistochemical study in Tables 4 and 5.
Table 5. Neoplastic Cellularity and Proportion ofp53 Immunobistochemically Positive Cells
Mutations of the p53 Gene
Case
Shifted bands at SSCP analysis were found in 16 cases (Figure 1). Italian case 20 showed a shifted band in both exons 6 and 7. Direct sequencing showed that the abnormal bands of 14 cases were due to pathologic alterations of the normal sequence, whereas the three shifted bands in exon 6 of Italian cases 16, 18, and 20 contained a silent mutation at codon 213 (CGA to CGG, both coding for arginine), corresponding to a described polymorphism.50 The negative result from SSCP analysis of Italian cases 2, 6, and 13 is not formally reliable due to the low content in neoplastic cells in the samples (
